Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Range Description

Tamaulipas, Sonora and Trés Marías Isls (Mexico) south to the Guianas, Southeastern Brazil, Northern Argentina, Paraguay, Bolivia, and Peru; Margarita Isl (Venezuela); Trinidad; Grenada (Lesser Antilles); Jamaica (Simmons 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Northern Mexico to Paraguay and northern Argentina, Jamaica, Bahamas.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The average weight of of 6 adults from north coast of Colombia is 9 g; average weights of 10.5 g have been reported for other populations. Average forearm skull lengths for 4 males from Nicaragua are 36.4 and 21.45 mm, respectively. The same measurements for 4 females from Nicaragua are 35.75 and 21.3 mm.

Average mass: 9.6 g.

Average basal metabolic rate: 0.164 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found in forests (south), rural and urban areas (north). Nectarivorous. Found in caves, tunnels, and houses. Co-inhabit with Carollia. Willig (1983) found more than 2,000 individuals in an abandoned house in Brazil.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Foraging habitat for G. soricina is described as moist and open.

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Pollen, nectar, flower parts, fruit, insects. Glossophaga soricina is known to consume parts of at least 34 different species of plants and shows clear preferences locally.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
10.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproductive behavior varies somewhat geographically, though most accounts indicate that G. soricina either breeds continuously throughout the year or is bimodally polyestrous. Gestation lasts approximately 3.5 months. Normally only single offspring, but twins have been reported. Parturition occurs with the young in the head down position. Young cling cross-wise to the mother's ventral surface with the head just posterior to the mother's throat. Young have been obsereved hanging on their own at 18 days, but they are known to remain attached to their mother as late as 20 days old. Flight begins at about 25 to 28 days after birth.

Average gestation period: 106 days.

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Wing overcomes resistance: Pallas's long-tongued bat
 

The wing of Pallas's long-tongued bat overcomes the continuous resistance on its membrane by flipping its outer edge upside down and then quickly back up during the upstroke.

     
  "On the downstroke of a bird's wing during slow flight, for instance, the primary feathers form a solid plane that pushes downward and backward on the air, propelling the bird upward and forward. On the upstroke, the primaries separate, and much of the air that would push the bird back down rushes through the gaps instead. The wing of a bat, however, is a membrane that offers continuous resistance. What happens during its upstroke?

Anders Hedenström of Lund University in Sweden and his colleagues studied vortices in the wake of the Pallas's long-tongued bat, Glossophaga soricina, in the fog-filled air of a wind tunnel. At slow speeds, they discovered, both the downstroke and the upstroke push the animal up and forward. To move the bat forward and upward during the upstroke, the outer part of the wing flips upside down and flicks quickly backward. (At high speeds, the wing doesn't flip and part of it does push the bat down during the upstroke, but that resistance is at least partly compensated for by continuous lift on the front of the wing at the higher speed.)

Whether the flip-flop is common to all bats or an adaptation special to the ones that hover—such as G. soricina, a nectar-eater—remains to be seen. (Science)" (Reebs 2007)


"The flapping flight of animals generates an aerodynamic footprint as a time-varying vortex wake in which the rate of momentum change represents the aerodynamic force. We showed that the wakes of a small bat species differ from those of birds in some important respects. In our bats, each wing generated its own vortex loop. Also, at moderate and high flight speeds, the circulation on the outer (hand) wing and the arm wing differed in sign during the upstroke, resulting in negative lift on the hand wing and positive lift on the arm wing. Our interpretations of the unsteady aerodynamic performance and function of membranous-winged, flapping flight should change modeling strategies for the study of equivalent natural and engineered flying devices." (Hedenström 2007:894)

Watch Videos
  Learn more about this functional adaptation.
  • Hedenström, A.; Johansson, L.C.; Wolf, M.; von Busse, R.; Winter, Y.; Spedding, G.R. 2007. Bat flight generates complex aerodynamic tracks. Science. 316: 894-897.
  • Johansson, L.C.; Wolf, M.; von Busse, R.; Winter, Y.; Spedding, G.R.; Hedenström, A. 2008. The near and far wake of Pallas’ long tongued bat (Glossophaga soricina). J. Exp. Biol. 211: 2909-2918.
  • Muijres, F.; Johansson, C.J.; Barfield, R.; Wolf, M.; Spedding, G.R.; Hedenström, A. 2008. Leading edge vortex improves lift in slow-flying bats. Science. 319: 1250-1253.
  • Stéphan Reebs. 2007. Flip-Flop Flap. Natural History: Samplings--News from Nature [Internet], Accessed 9/18/2007.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Glossophaga soricina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 296 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTGTACCTACTATTCGGCGCTTGAGCTGGTATAGTAGGAACCGCATTAAGCCTACTTATCCGTGCCGAGCTTGGTCAACCCGGAGCTCTGCTGGGTGATGATCAGATCTATAATGTAATTGTAACTGCTCATGCTTTTGTAATAATCTTCTTTATAGTAATGCCTATCATGATTGGAGGTTTTGGCAATTGATTGATTCCTCTAATAATTGGGGCACCTGATATAGCATTCCCTCGGATAAATAATATAAGCTTTTGACTTTTACCACCTTCCTTTCTATTACTACTGGCCTCTTCTACAGTTGAGGCTGGGGTAGGTACAGGTTGAACAGTTTATCCTCCCTTAGCAGGTAATCTAGCGCATGCTGGAGCCTCTGTAGACCTAGCTATCTTTTCTCTGCATTTAGCAGGGGTTTCCTCTATTCTAGGAGCTATTAATTTTATCACAACTATTATTAATATGAAGCCCCCAGCTCTATCTCAATACCAAACACCTTTGTTTGTATGATCTGTATTAATTACCGCTGTCTTGTTACTTCTTTCTCTTCCTGTACTGGCTGCAGGTATTACTATGTTATTAACGGATCGAAACCTCAATACGACTTTCTTTGACCCTGCTGGAGGTGGAGACCCTATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Glossophaga soricina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 196
Specimens with Barcodes: 415
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barquez, R., Perez, S., Miller, B. & Diaz, M.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern in because of its wide distribution, presumed large population, occurrence in a number of protected areas, tolerance to some degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There are no indications that G. soricina is threatened at present.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is scarce on the south and abundant in the north. In Argentina they face many threats (Barquez pers. comm.).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats throughout its range. Deforestation is a localised threat. Populations are scarce in south.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Avoid habitat loss. Needs taxonomic revision. Found in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

This species is probably important as a pollinator of flowers and disperser of seeds of economically important plant species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pallas's long-tongued bat

Pallas's long-tongued bat (Glossophaga soricina) is a South and Central American bat.[1] It has the fastest metabolism ever recorded in a mammal, similar to those of hummingbirds. Although it uses 50% of its stored fat over the course of a day, over 80% of its energy comes directly from the simple sugars that compose its diet of nectar, without being stored in any form.[2]

References

  1. ^ "Infonatura". 
  2. ^ C.C. Voigt & J.R. Speakman (2007). "Nectar-feeding bats fuel their high metabolism directly with exogenous carbohydrates". Funct. Ecol. OnlineEarly Articles (5): 913. doi:10.1111/j.1365-2435.2007.01321.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!