Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Anoura geoffroyi is a nectar bat distributed throughout the Neotropics from Mexico to Brazil (Ortega & Alarcon-D, 2008). It is particularly abundant in mid-elevation cloud forests, and reaches higher elevations than any other nectar bat (>3500m, in the Andes of South America; Muchhala, pers. obs.) . It feeds primarily on pollen and nectar from flowers, supplementing this diet with insects and, less frequently, fruit (Álvarez & González 1970; Muchhala & Jarrín 2002; Zortéa 2003). Like other nectar bats of the subfamily Glossophaginae, it possesses adaptations to nectarivory such as an elongated snout, a highly extensible tongue, and the ability to hover during flower visits (Winter & Helversen 2003; Fleming & Muchhala 2008).

  • Álvarez, T., and L. González Quintero. 1970. Analisis polinico del contenido gastrico de murcielagos Glossophaginae de Mexico. Anales de la Escuela Nacional de Ciencias Biologicas 18:137-165.
  • Fleming, T. H., and N. Muchhala. 2008. Nectar-feeding bird and bat niches in two worlds: Pantropical comparisons of vertebrate pollination systems. Journal of Biogeography 35:764-780.
  • Muchhala, N., and P. Jarrín-V. 2002. Flower visitation by bats in cloud forests of western Ecuador. Biotropica 34:387-395.
  • Ortega, J., and I. Alarcon-D. 2008. Anoura geoffroyi (Chiroptera: Phyllostomidae). Mammalian Species 818:1-7.
  • Winter, Y., and O. v. Helversen. 2003. Operational tongue length in phyllostomid nectar-feeding bats. Journal of Mammalogy 84:886-896.
  • Zortéa, M. 2003. Reproductive patterns and feeding habits of three nectarivorous bats (Phyllostomidae: Glossophaginae) from the Brazilian cerrado. Brazilian Journal of Biology 63:159-168.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Nathan Muchhala

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs in Peru, Bolivia, southeast Brazil, the Guianas, Suriname, and Ecuador to Tamaulipas and Sinaloa (Mexico); It is also found on Trinidad, and on Grenada (Lesser Antilles) (Simmons, 2005). In Nicaragua it only occurs in central and northern regions, in high areas (Medina pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Anoura geoffroyi, Geoffroy's tailless bat, is found from central Mexico to central South America and in Trinidad and Grenada.

Biogeographic Regions: neotropical (Native )

  • Wilson, D., D. Reeder. 1993. Mammal Species of the World: A Taxonomic and Geographic Reference; Second Edition. Washington: Smithsonian Institution Press.
  • Nowak, R. 1999. Walker’s Mammals of the World: Sixth Edition; Volume 1. Baltimore: The John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Geoffroy's tailless bats have a dull-brown color when viewed from above and a gray-brown color when viewed from below. They usually have a silvery-gray color on the shoulders and neck. No tail is present. Nowak (1999) describes the calcar as rudimentary and the cheek teeth as narrow and elongate. The tongue is long and has papillae, and the muzzle is elongate. The average mass for A. geoffroyi is 15.2 g. In Peru body length ranges from 61 to 71 mm, skull length ranges from 24.3 to 26.6 mm, and forearm length ranges from 41 to 45 mm.

In central Brazil, males and females were reported to be about the same size. Mean male mass, forearm length and wing area were 14.9 g, 42.1 mm and 91.43 cm2 respectively; mean female mass, forearm length and wing area were 14.7 g, 42.3 mm and 91.77 cm2 respectively. However, in central Trinidad, Heideman observed that “females had slightly longer forearms than males (females 42.3 ± 0.1 mm, males 39.9 ± 0.3 mm).” This difference in forearm length may be related to reproduction, since females carry a single pup until it is ready to fly on its own.

Average mass: 15.2 g.

Range length: 61 to 71 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 15.2 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is strongly associated with streams within tropical evergreen forest. It feeds on nectar, fruit, and pollen, and may visit flowers primarily to obtain insects. Plant species visited in Mexico include Agave, Ceiba, Calliandra, Eucalyptus, Ipomoea, Pinus, and various composites. It roosts in small groups in caves, tunnels or tree hollows and is found in lowland rainforest, deciduous forest, gardens, and plantations. A colony of about 75 was found in a tunnel in Peru, grouped into several small clusters and hanging from the ceiling. Although common only where there are caves or rock crevices, and they are rare or perhaps absent from lowland Amazonian forests lacking high ground, rocks, and caves. A single birth peak occurs each year, late in the wet season (Emmons and Feer, 1997; Gardner, 1977; Handley, 1976; Reid, 1997; Tuttle, 1970; Wilson, 1979).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat requirements of A. geoffroyi have not been described. Caves where A. geoffroyi have been reported occur in tropical rain forests and in savanna-like cerrado near trees.

Habitat Regions: tropical

Terrestrial Biomes: savanna or grassland ; rainforest

Other Habitat Features: caves

  • Baumgarten, J., E. Vieira. 1994. Reproductive seasonality and development of Anoura geoffroyi (Chiroptera: Phyllostomidae) in central Brazil. Mammalia, 58/3: 415-422.
  • Heideman, P., P. Deoraj, F. Bronson. 1992. Seasonal Reproduction of a tropical bat, Anoura-geoffroyi, in relation to photoperiod. Journal of Reproduction and Fertility, 96/2: 765-773.
  • Zortea, M. 2003. Reproductive patterns and feeding habits of three nectarivororus bats (Phyllostomidae: Glossophaginae) from the Brazilian Cerrado. Brazilian Journal of Biology, 63/1: 1-9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Anoura geoffroyi eats insects, fruit, nectar and pollen. Although this bat is a generalist, it prefers fruit and arthropods in central Brazil. Anoura geoffroyi can be considered a foliage gleaner because it eats insects that are on leaves, nectar and flowers.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: fruit; nectar; pollen

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Anoura geoffroyi eats insects and pollinates plants. In Brazil it is sympatric with two other nectarivorous bats, Glossophaga soricina and Anoura caudifer, with which it may compete.

Members of the genus Anoura host macronyssid mites that cause periodontal disease. This may result in the first premolars being lost.

Ecosystem Impact: pollinates

Commensal/Parasitic Species:

  • macronyssid mites

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

More research is needed to understand predation on A. geoffroyi. It is likely that small mammals, snakes, and birds of prey could take these bats as prey items. Because they are gleaners, taking isects from surfaces, and feeders on fruit and nectar, they are relatively slow in flight, making them more susceptible to aerial predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Phyllostomids use calls for echolocation and communication. Heideman et al. (1992) described the eyes of A. geoffroyi as large and suggested that the bat relies on vision in addition to echolocation. In addition to use of echolocation, these bats likely have some vocal communication, as is common in the family. Scent probably plays some role in communication, as it does in most mammals, during reproduction. Tactile communication undoubtedly occurs between mothers and their offspring as well as between mates. This for of communication may occur between bats in the roost.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic ; echolocation

  • Gould, E. 1977. Echolocation and Communication. Pp. 247-279 in R Baker, K Jones, Jr., D Carter, eds. Biology of Bats of the New World Family Phyllostomatidae. Part II. Lubbock, Texas: Texas Tech Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

It is likley that like all microchiropterans, these bats live longer than other mammals of similar size. Although there are no data on maximum lifespan, or population age composition, one member of this species in captivity is known to have lived longer than 10 years.

Range lifespan

Status: captivity:
>10 (high) years.

Typical lifespan

Status: captivity:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

No information is available about mating systems of A. geoffroyi. In fact, data are lacking on the mating system of most bats in the family Phyllosomidae. This may be because they are small, nocturnal, and fly--making it difficult to observe mating and courtship.

More research is needed to understand reproductive strategies of A. geoffroyi across its range. Heideman et al. (1992) suggested that Geoffroy's tailless bats have a seasonal cycle “with geographic variation in timing.” In Trinidad mating occurs from July to August. Females give birth to one pup in late November or early December, after a gestation of four months. Births occur between the wet and dry seasons, and lactation occurs in the early dry season. Flowering peaks occur in the dry season, resulting in nectar and pollen abundance. Synchronization of lactation with food abundance may help female bats during a time of high energy demand. Heideman et al. (1992) suggested that reproductive timing of A. geoffroyi in Trinidad may have evolved to accommodate the simultaneous occurrence of lactation and food abundance.

Two studies carried out in different parts of central Brazil found that A. geoffroyi had a seasonal monoestrous cycle. However, birthing and pregnancy timing differed between the two study sites. Both study sites had wet and dry seasons, but the sites experienced the seasons in different months. Nowak (1999) stated that pregnant A. geoffroyi have been collected in Nicaragua during July, in Costa Rica during March, and inPeru during June, and that lactating females have been collected July, November and December in Mexico. Unless lactation lasts for more than 6 months, this may indicate that in some places the bats undergo two reproductive cylces per year, having young both in summer and late autumn months.

Breeding interval: Anoura geoffroyi likely breeds once a year, although females in some populations may have two young per year.

Breeding season: Breeding season varies greatly with geography.

Average number of offspring: 1.

Average gestation period: 4 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 5.1 g.

Average number of offspring: 1.

More research is needed to understand parental care of A. geoffroyi across its range. Females carry pups in flight until the pups can fly on their own. They presumably provide the young with food and protection as well as transportation during this period. The first growth phase of young bats in Brazil involves rapid forearm growth. A young bat’s forearm in Brazil must grow to about 95% of its mother’s forearm length before it flies independently. The second growth phase involves more rapid weight gain. In Brazil, the wing areas of adult females were not greater than the wing areas of males. An increase in forearm length that is faster than weight gain likely enables young bats to fly alone sooner. In Trinidad, Heideman et al. (1992) reported that females had somewhat longer forearms than males (females 42.3 ± 0.1 mm, males 39.9 ± 0.3 mm).

More research is needed to understand the father’s role (if any) in postpartum care of offspring. Adult males may sometimes use different roosts than females and young. Baumgarten et al. (1994) found that the number of adult male bats decreased in the cave when pregnant females or females with young were present.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Baumgarten, J., E. Vieira. 1994. Reproductive seasonality and development of Anoura geoffroyi (Chiroptera: Phyllostomidae) in central Brazil. Mammalia, 58/3: 415-422.
  • Heideman, P., P. Deoraj, F. Bronson. 1992. Seasonal Reproduction of a tropical bat, Anoura-geoffroyi, in relation to photoperiod. Journal of Reproduction and Fertility, 96/2: 765-773.
  • Nowak, R. 1999. Walker’s Mammals of the World: Sixth Edition; Volume 1. Baltimore: The John Hopkins University Press.
  • Zortea, M. 2003. Reproductive patterns and feeding habits of three nectarivororus bats (Phyllostomidae: Glossophaginae) from the Brazilian Cerrado. Brazilian Journal of Biology, 63/1: 1-9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anoura geoffroyi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 81 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTATACTTACTGTTTGGTGCCTGAGCCGGTATAGTAGGCACTGCACTTAGCCTTCTCATCCGCGCCGAATTGGGCCAACCTGGAGCTTTATTAGGTGATGACCAAATCTATAATGTAATCGTAACAGCTCATGCATTCGTGATAATTTTCTTCATAGTGATACCAATCATAATTGGAGGCTTTGGTAACTGACTAATCCCTCTGATAATTGGGGCACCTGATATAGCATTTCCTCGAATAAATAATATAAGCTTCTGACTCCTTCCTCCTTCTTTTCTACTATTACTGGCCTCCTCCACAGTCGAGGCTGGAGTAGGGACTGGCTGAACTGTTTATCCTCCTTTAGCAGGAAACCTAGCACATGCCGGGGCCTCTGTTGATCTGGCAATCTTTTCCCTTCACTTAGCGGGTGTATCATCCATTTTAGGAGCAATCAACTTTATCACCACTATCATTAATATAAAACCTCCAGCACTTTCCCAATATCAAACTCCCTTATTCGTGTGGTCTGTATTAATCACAGCCGTTCTATTATTGTTATCTCTCCCTGTACTGGCAGCAGGCATTACCATGCTACTAACTGATCGAAATTTAAATACCACCTTTTTCGACCCTGCAGGAGGAGGGGACCCTATTTTATATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anoura geoffroyi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 77
Specimens with Barcodes: 103
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Mantilla, H., Molinari, J., Arroyo-Cabrales, J., Álvarez Castañeda, S.T., Cuarón, A.D. & de Grammont. P.C.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, occurrence in a number of protected areas and because it is likely to be stable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anoura geoffroyi does not appear on the IUCN Red List. No data were returned on searches for Anoura geoffroyi or Anoura at the CITES website. No data were returned on searches for Anoura geoffroyi at the US Federal List website.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is common and widespread (Emmons and Feer, 1997).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats. Cave mining and tourism can be a threat. Habitat loss in Mexico (Arroyo-Cabrales pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occurs in a number of protected areas throughout its range. Protect the caves.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No known negative effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Anoura geoffroyi eats insects and pollinates plants. However, whether it polinates crops or controls pest populations is not known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Geoffroy's tailless bat

Geoffroy's tailless bat (Anoura geoffroyi) is a species of phyllostomid bat from the American tropics.[1]

Physical description[edit]

Geoffroy's tailless bat is a medium-sized bat, measuring around 7 cm (2.8 in) in total length and weighing 10 to 15 g (0.35 to 0.53 oz). It has dark to dull brown fur over much of its body, with greyish-brown underparts and silvery-grey fur on the neck and shoulders. The wings are black or very dark brown, while the membrane between the legs is relatively small and covered in hair. As its name suggests, the bat does not possess a tail. It has a long muzzle, a projecting lower jaw, and short, rounded ears. Its tongue is long and narrow, with a pointed tip covered with fine papillae that help to draw up nectar when it feeds.[2]

Males and females do not vary much in size in Brazil, but in Trinidad, another area where Anoura geoffroyi lives, the females are reported to have slightly longer forearms than the males.[citation needed]

Distribution and habitat[edit]

Geoffroy's tailless bat is found from northern Mexico, through much of Central America, across northern South America, and through Peru to parts of Bolivia and Brazil immediately south of the Amazon Basin. It has also been reported from both Trinidad and Grenada.[1] The bat inhabits wooded environments between 400 and 2,500 m (1,300 and 8,200 ft) elevation, including pine and oak forests, cloud forest, cerrado, and agricultural land.[2]

Three subspecies are currently recognised:

Behaviour and diet[edit]

The bat is primarily insectivorous, with up to 90% of its diet consisting of moths and beetles.[2] However, they also eat some fruit and lap up nectar and pollen from a wide range of flowers,[3] and has even been reported to subsist entirely on nectar in some parts of its range.[4]

They are nocturnal, resting in caves close to water during the day, either alone, or in colonies of up to 300 individuals,[5] although colony sizes of 20 to 75 are more common. The species is a swift flier, and is able to hover. It uses both vision and echolocation to navigate, with its hearing being most sensitive between 65 and 75 kHz.[2] Since it feeds on similar insects to other local species of bats, it may avoid competition by feeding at discrete altitudes not favoured by those bats.[6]

Lifecycle[edit]

Mating in Geoffroy's tailless bats seems to take place primarily between March and August, corresponding with the rainy season and allowing the young to be born when food is most abundant. However, the precise mating season, if any, seems to vary across the bat's range.[2] Gestation takes four months and births have been found to be in different months by geography: July in Nicaragua, June in Peru, March in Costa Rica, etc.[citation needed]

References[edit]

  1. ^ a b c Mantilla, H., Molinari, J., Arroyo-Cabrales, J., Ticul Alvarez Castaneda, S., Cuarón, A.D. & de Grammont. P.C. (2008). Anoura geoffroyi. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 18 February 2009.
  2. ^ a b c d e Ortega, J. & Alarcón-D, I. (2008). "Anoura geoffroyi (Chiroptera: Phyllostomidae)". Mammalian Species: Number 818, pp. 1–7. doi:10.1644/818.1. 
  3. ^ Muchhala, N. & Jarrin-V, P. (2002). "Flower visitation by bats in cloud forests of western Ecuador". Biotropica 34 (3): 387–395. doi:10.1111/j.1744-7429.2002.tb00552.x. 
  4. ^ McNab, B.K. (1971). "The Structure of Tropical Bat Faunas". Ecology 52 (2): 352–358. JSTOR 1934596. 
  5. ^ Ramirez-Pulido, J. et al. (2001). "Colony size fluctuation of Anoura geoffroyi (Chiroptera: Phyllostomidae) and temperature characterization in a Mexican cave". Mammalian Species 46 (3): 358–362. JSTOR 3672433. 
  6. ^ Willig, M.R. et al. (1993). "Dietary overlap in frugivorous and insectivorous bats from edaphic Cerrado habitats of Brazil". Journal of Mammalogy 74 (1): 117–128. JSTOR 1381910. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!