Articles on this page are available in 1 other language: Spanish (17) (learn more)

Overview

Distribution

Range Description

This species occurs throughout Veracruz (Mexico) to Ecuador and Peru, Bolivia, north and southwest Brazil, and Guianas; It is also found on Trinidad (Simmons, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Vampyrum spectrum lives primarily in northern South America and Central America. Their range extends from central Brazil and Peru to southern Mexico. They are also found on Trinidad in the Antilles.

Biogeographic Regions: neotropical

  • Nowak, R. 1999. Walker's Mammals of the World. Baltimore: The Johns Hopkins University Press.
  • Vehrencamp, S., F. Stiles, J. Bradbury. 1977. Observations on the foraging behavior and avian prey of the neotropical carnivorous bat, Vampyrum spectrum. Journal of Mammalogy, 58: 469-477.
  • Navarro, D., D. Wilson. 1982. Vampyrum spectrum. Mammalian Species, 184: 1-4. Accessed 05/24/03 at http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/default.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Vampyrum spectrum is the largest bat species in the New World. Adults weigh between 145 and 190 g, and have a wingspan of 762-914 mm (some exceed 1 m). Head and body length is 125 to 135 mm, there is no tail. The ears are rounded and large, extending to the nose when laid forward, they measure 39 to 42 mm in length. The noseleaf is also large, 17 mm in length on average. The majority of the body is reddish brown, with a slightly paler underside. The fur is short and and fine. This large bat species is distinguished from other large phyllostomids by their generally larger size, lack of a tail, and by the presence of 4 upper and lower incisors as compared to 4 above and 2 below in the similar species Chrotopterus auritus and Phyllostomus hastatus. The dental formula is 2/2, 1/1, 2/3, 3/3 = 34.

Range mass: 170 to 180 g.

Range wingspan: 700 to 900 mm.

Sexual Dimorphism: male larger

  • Greenhall, A. 1968. Notes on the behavior of the false vampire bat. Journal of Mammalogy, 49: 337-340.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Vampyrum spectrum
Catalog Number: USNM 78127
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull; Remainder in Fluid
Collector(s): E. Nelson
Year Collected: 1896
Locality: Coatzacoalcos, Veracruz, Mexico, North America
  • Type: Goldman, E. A. 1917 May 23. Proc. Biol. Soc. Wash. 30: 115.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Top predator with large home range, occurs in small and dispersed populations. This bat is usually found in lowland, evergreen forest, and occasionally in cloud or deciduous forest or swampy areas. It is carnivorous, eating birds and small mammals around 20 to 150 grams. Remains of birds recorded in its roosts include 18 species, some of then include motmots, doves, trogons, cuckoos, wrens, and orioles. Also, a bat (Rhogeessa sp.) was found in feces of an individual in Guatemala. This bat is often attracted to distress calls of smaller bats. It roosts in groups of 1 to 5 in hollow trees (including Ceiba pentandra, Mora excelsa, and Spondias mombin). Groups usually consist of an adult pair and their offspring, which hang tightly clumped together. Activity begins at dusk; after foraging for an hour or more, the group returns to the day roost for part of the night. Reproductive dates are limited; a single young appears to be born at the onset of the rainy season and is tended by both parents (McCarthy, 1987; Reid, 1997; Vehrencamp et al., 1977).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

They roost in dense, lowland forest below 1,650 m elevation, usually near a river or stream. They are also found in other moist, evergreen forest, yards, secondary growth woodlands, forest edges, and swampy areas. They have been observed roosting in human structures and hollow trees.

Range elevation: 1650 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of V. spectrum includes a number of avian, bat, and rodent species. Preferred birds are usually gregarious, or have a very strong odor, and typically roost on branches as opposed to cavities. Prey is apparently located by scent more than by sight or echolocation, and following location it is carefully stalked before a strike is made. These bats begin feeding around dusk, and may have several feeding periods throughout the night. Adults typically feed solitarily, while their mate stays in the nest with the young. Remains of 84 birds of 18 species were found in a single V. spectrum roost.

These bats were previously thought to feed on blood, hence their common name, "False Vampire". It is thought that they may also eat fruit but a mated pair kept in captivity for 5 years refused any fruit offered to them.

Animal Foods: birds; mammals; insects

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Vampyrum spectrum are large, predatory bats which impact their prey communities, especially rodents, birds, and other bats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predation on V. spectrum has not been described, although it is likely that young in roosts can be taken by large, arboreal snakes and other arboreal predators, such as coatis and cat species. They may also be taken by large birds of prey, such as owls and eagles, while in flight.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Vampyrum spectrum preys on:
Insecta
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

These bats presumably communicate among themselves using the modes of communication widely used in mammals: chemical, auditory, visual, and tactile modes, though this has not been carefully studied in these animals. Males enclose females and their young in their wings while roosting.

These bats use echolocation to help them navigate during flight and prey location. They have been observed using vision to locate prey, which they then capture with a stealthy approach. It has been suggested that they use their sense of smell to locate roosting birds and other prey at night.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: echolocation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In captivity, V. spectrum can live for up to 5.5 years. Their longevity in the wild is unknown.

Range lifespan

Status: captivity:
5.5 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

These bats form monogamous pairs, possibly for life.

Mating System: monogamous

The estrous cycle, gestation period, and details of the early growth of young have not been determined for this species. Births have been recorded from May to July but data are scarce. It's possible that births occur at the end of the dry season and beginning of the rainy season in the regions where these bats live.

Breeding interval: These bats breed once yearly.

Breeding season: The breeding season is unknown.

Average number of offspring: 1.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Both adults assist in the rearing of young. Both parents bring food back to roosts for their young and are solicitous of the young until they reach independence. Males are known to wrap their wings around both mothers and their young while roosting.

Parental Investment: male parental care ; female parental care

  • Nowak, R. 1999. Walker's Mammals of the World. Baltimore: The Johns Hopkins University Press.
  • Greenhall, A. 1968. Notes on the behavior of the false vampire bat. Journal of Mammalogy, 49: 337-340.
  • Vehrencamp, S., F. Stiles, J. Bradbury. 1977. Observations on the foraging behavior and avian prey of the neotropical carnivorous bat, Vampyrum spectrum. Journal of Mammalogy, 58: 469-477.
  • Navarro, D., D. Wilson. 1982. Vampyrum spectrum. Mammalian Species, 184: 1-4. Accessed 05/24/03 at http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/default.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vampyrum spectrum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACCTATTGTTTGGGGCCTGAGCCGGAATGGTGGGTACCGCATTGAGCCTTCTTATTCGCGCTGAACTCGGTCAACCTGGCACCCTACTAGGCGATGACCAGATCTACAATGTCATCGTAACCGCCCACGCCTTCGTGATGATCTTCTTTATAGTGATGCCCATCATAATCGGGGGCTTTGGCAACTGACTGGTCCCTCTAATAATTGGAGCGCCGGATATAGCATTTCCCCGGATAAATAATATAAGCTTCTGACTACTGCCCCCATCATTCCTTTTACTACTCGCCTCCTCCACCATTGAAGCCGGAGTCGGCACTGGTTGAACAGTCTACCCCCCATTAGCAGGCAACCTTGCCCACGCTGGAGCCTCAGTCGACTTAGCTATCTTCTCCCTACACCTAGCAGGGGTGTCCTCTATCCTGGGAGCAATTAACTTTATCACTACCATCATCAACATAAAACCCCCTGCTCTCTCCCAATACCAAACCCCCCTCTTCGTCTGATCCGTCTTGATTACAGCCGTCCTACTACTCCTCTCACTCCCCGTCCTAGCAGCAGGCATCACCATACTACTAACAGACCGAAACCTTAACACCACTTTCTTTGATCCTGCCGGAGGGGGCGACCCGGTACTGTATCAGCACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Vampyrum spectrum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aguirre, L., Mantilla, H., Miller, B. & Dávalos, L.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
The species is listed as Near Threatened due to its dependence on primary forest habitat and is rare and dispersed anywhere it is found, making it extremely susceptible to habitat fragmentation and population decline. It is very difficult to estimate rates of decline with such a widespread and rare species - thus further work is needed to measures rates of decline due to habitat loss and human disturbance. Almost qualifies as threatened under criterion A.

History
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vampyrum spectrum has been designated as 'Lower risk / near threatened' by the IUCN.

IUCN Red List of Threatened Species: near threatened

  • IUCN Redlist. 1996. "International Union for the Conservation of Nature and Natural Resources" (On-line ). Accessed May 12, 2003 at http://www.redlist.org/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is rare and local (Reid, 1997). Occurs in low densities throughout its range.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats throughout its range. Local threats include habitat fragmentation and destruction. This species is forest dependant (although sometimes captured in pastures and fruit groves near forest edge), and likely required primary forest habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation of intact forest. In Mexico it is listed as endandered under NOM - 059 - SEMARNAT - 2001 (Arroyo-Cabrales pers. comm.). Found in protected areas. This species is considered Endangered in Bolivia (Aquirre 1999, Flores and Bedregado 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of V. spectrum on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The economic importance of V. spectrum to humans is not known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spectral bat

The genus Vampyrum contains only one species, the spectral bat (V. spectrum). Some alternate names for this species are the false vampire bat, Linnaeus's false vampire bat and the spectral vampire bat. Confusingly, they are not related to the Old World family of large carnivorous bats to be found in the Megadermatidae that are also called false vampires.

Contents

Description [edit]

This species is the largest bat (Chiroptera) native to the New World and the largest carnivorous bat in the world. The wingspan typically ranges from 60 to 91.5 cm (24 to 36.0 in), with the largest specimens attaining just over 100 cm (39 in). The length is 12.5–13.5 cm (4.9–5.3 in) (there is no tail) and body mass is 145–190 g (5.1–6.7 oz).[3] The fur on the upper parts of the bat is normally dark brown, chestnut brown or rust-orange and quite short and fine. The ears are very long and rounded. There is no discernible tail, but the tail membrane is long and broad. The large feet are robust, with long curved claws. The muzzle is long and narrow, and the teeth are strong. The noseleaf, averaging 1.7 cm (0.67 in) long, is medium-sized, lance-shaped, horseshoe and spear with continuous rim raised to form a hollow cup around the nostrils. Underparts are usually pale, dirty gray-brown to yellow-brown – the fur is much shorter than on the front.

Range and habitat [edit]

The range of the species is southern Mexico to Peru and Ecuador to central and northern Brazil, Suriname, Guyana, and the island of Trinidad. These bats are typically found roosting, usually on tree branches, but sometimes in hollow trees or even man-made structures, in dense, lowland neotropical forests, below an elevation of 1,650 m (5,410 ft). They are found in the greatest numbers in riparian areas. While foraging, they visit more diverse habitats and can be found in moist, evergreen forest, yards, secondary growth woodlands, forest edges, and muggy areas.[3]

Feeding [edit]

The spectral bat is a formidable aerial night hunter. While true vampire bats, for which it was formerly named, parasitically feed on the blood of larger animals, often as they sleep and usually with little ill effect, this species rather actively hunts and kills other animals.[3] This large predatory species primarily lives on relatively large vertebrate prey, such as small birds, small mammals (including other species of bats) and occasionally amphibians and reptiles. Prey is usually selected that lives or gathers in groups, has a strong odor and typically roosts on branches rather than in cavities. Most prey selected weighs from 20 to 150 g (0.71 to 5.3 oz), which is equal to ther own weight.[1] The remains of 84 bird specimens of 18 different species, including motmots, doves, trogons, cuckoos, wrens and orioles, were discovered at one spectral bat roost.[1] Insects are also included in the diet, especially large crickets, cicadas, etc.[3]

When hunting, this species is extremely stealthy. Their characteristic flight is slow and low to the ground. They can appear bouncy but are actually quite maneuverable fliers. It will often actively stalk their prey and then pounce from a position on an above branch onto its prey or, in an owl-like fashion, hunt by patrolling back and forth along forest edges, suddenly dropping on something in the grass. Spectral bats do not seem to forage by sight or echolocation as do most bats, but apparently hunt so mainly by scent.[3] However, they have been recorded as being attracted to the stress calls of smaller bats while hunting.[1] Their wing structure allows them to take flight in confined spaces and to carry heavy prey items. These bats were once thought to supplement their diet with fruit, but a captive pair refused to eat any fruit over a 5 year period.[3] Spectral bats usually hunt several times a night and, during the breeding season, the male will hunt for food alone and bring food back to the female and their young.

Life history [edit]

Spectral bats usually roost in a hollow tree with a mate and their young of the year. Little data is available on the breeding details of the species, though births have been observed from May to July, at the onset of the rainy season. One young or pup is usually produced each year, though up to 3 have been recorded. The mother is reportedly very attentive and gentle with her offspring. The male is often in attendance as well and will frequently sleep with both the female and their young completely wrapped up in his wings. Pairs may mate for life.[3] Young spectral bats may be predated by arboreal predators such as tree snakes, coatis and Leopardus cats. Adults may be killed in flight by owls.[3] At this point, the little-known spectral bat is classified as Near Threatened, due only to its apparent dependency on mature forest, which is being heavily logged in some parts of the species range.[1]

References [edit]

  1. ^ a b c d e Aguirre, L., Mantilla, H., Miller, B. & Dávalos, L. (2008). "Vampyrum spectrum". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 22 November 2012. 
  2. ^ Linnæus, Carl (1758). Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (in Latin) (10 ed.). Holmiæ: Laurentius Salvius. p. 31. Retrieved 21 November 2012. 
  3. ^ a b c d e f g h Hamman, David. (2003-05-12) Vampyrum spectrum. Animaldiversity.ummz.umich.edu. Retrieved on 2012-12-29.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!