Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

The northern short-tailed shrew (Blarina brevicauda) ranges throughout the north- central and northeastern United States and into southern Canada (George et al., 1986). It eats insects, worms, snails, and other invertebrates and also may eat mice, voles, frogs, and other vertebrates (Robinson and Brodie, 1982). Because they prey on other vertebrates, shrews can concentrate DDT (and presumably other bioaccumulative chemicals) to levels 10 times higher than either Peromyscus and Clethrionomys (Dimond and Sherburne, 1969). Shrews are an important component of the diet of many owls (Palmer and Fowler, 1975; Burt and Grossenheider, 1980) and are also prey for other raptors, fox, weasels, and other carnivorous mammals (Buckner, 1966).

Short-tailed shrews are 8 to 10 cm in length with a 1.9 to 3.0 cm tail (Burt and Grossenheider, 1980). The short-tailed shrew is the largest member of the genus, with some weighing over 22 g (George et al., 1986; see table). Some studies have found little or no sexual dimorphism in size (Choate, 1972), while other reports show that males are slightly larger than females (George et al., 1986; Guilday, 1957).

Short-tailed shrews are active for about 16 percent of each 24-hour period (Martinsen, 1969).

They inhabit a wide variety of habitats and are common in areas with abundant vegetative cover (Miller and Getz, 1977), and need cool, moist habitats because of their high metabolic and water-loss rates (Randolph, 1973).

The short-tailed shrew is primarily carnivorous. Stomach analyses indicate that insects, earthworms, slugs, and snails can make up most of the shrew's food, while plants, fungi, millipedes, centipedes, arachnids, and small mammals also are consumed (Hamilton, 1941; Whitaker and Ferraro, 1963). Small mammals are consumed more when invertebrates are less available (Allen, 1938; Platt and Blakeley, 1973, cited in George et al., 1986). Shrews are able to prey on small vertebrates because they produce a poison secretion in their salivary glands that is transmitted during biting (Pearson, 1942, cited in Eadie, 1952). The short-tailed shrew stores food, especially in the autumn and winter (Hamilton, 1930; Martin, 1984).

  • Please refer to the original article for references and additional information.
Public Domain

 

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

"Northern Short-tailed Shrews have poisonous saliva. This enables them to kill mice and larger prey and paralyze invertebrates such as snails and store them alive for later eating. The shrews have very limited vision, and rely on a kind of echolocation, a series of ultrasonic ""clicks,"" to make their way around the tunnels and burrows they dig. They nest underground, lining their nests with vegetation and sometimes with fur. They do not hibernate. Their day is organized around highly active periods lasting about 4.5 minutes, followed by rest periods that last, on average, 24 minutes. Population densities can fluctuate greatly from year to year and even crash, requiring several years to recover. Winter mortality can be as high as 90 percent in some areas. Fossils of this species are known from the Pliocene, and fossils representing other, extinct species of the genus Blarina are even older."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Say, T., 1823.  in Account of an expedition from Pittsburgh to the Rocky Mountains: performed in the years 1819 and ?20, by order of the Hon. J.C. Calhoun, sec?y of war, under the command of Major Stephen H. Long : from the notes of Major Long, Mr. T. Say, and other gentlemen of the exploring party compiled by Edwin James, botanist and geologist for the expedition; in two vols., H.C. Carey and I. Lea, Philadelphia,1822-23. Vol 1, p 164.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Northern short-tailed shrews inhabit most of North America from southern Saskatchewan and Nova Scotia in Canada to central Nebraska and Georgia in the United States.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species occurs throughout southern Canada, west to central Saskatchewan and east to south east Canada, and south to Arkansas and Georgia in the United States.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Northern short-tailed shrews are only native in the Nearctic region. They inhabit most of east central North America from southern Saskatchewan and Nova Scotia in Canada to central Nebraska and Georgia in the United States.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Occurs throughout most of U.S. and southern Canada east of the Great Plains. See French (1981) for information on distribution in the southeastern U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Northern short-tailed shrews are 75 to 105 mm long from their head to the base of their tail. The tail length ranges from 17 to 30 mm. Males are slightly larger than females, especially in the skulls. The fur is velvety and soft, and the color almost uniformly slate gray, with the underparts being only slightly paler. Summer fur color is a shade paler than winter fur.

Northern short-tailed shrews are nearly the size of a meadow mouse. The snout is shorter and heavier than that of other shrews. The tail is short, the eyes small, and the ears are almost completely hidden by the fur.

Range mass: 18.0 to 30.0 g.

Average mass: 21.63 g.

Range length: 75.0 to 105.0 mm.

Sexual Dimorphism: male larger

Average basal metabolic rate: 0.344 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Head and body length is 75-105 mm, tail length is 17-30 mm. Males are slightly larger than females, especially in the skulls. The fur is velvety and soft, and the color almost uniformly slate gray, with the underparts being only slightly paler. Summer pelage is a shade paler than winter.

Blarina brevicauda is a robust-looking shrew, nearly the size of a meadow mouse; the snout is shorter and heavier than that of other shrews, the tail is short, the eyes small, and the ears are almost completely hidden by the fur.

Range mass: 18.0 to 30.0 g.

Average mass: 21.63 g.

Range length: 75.0 to 105.0 mm.

Sexual Dimorphism: male larger

Average basal metabolic rate: 0.344 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 14 cm

Weight: 29 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males may be slightly larger than females.

Length:
Range: 118-139 mm

Weight:
Range: 18-30 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

See Carraway (1995) for a key to western North American soricids based primarily on dentaries.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Northern short-tailed shrews are found in nearly all terrestrial habitats. They construct their nests in tunnels or under logs and rocks. They also construct elaborate runways under leaves, dirt, and snow.

Northern short-tailed shrews are most commonly found in damp brushy woodlands, bushy bogs and marshes, and weedy and bushy borders of fields. They are also common in cultivated fields, in flower and vegetable gardens, fence rows, and beside country roads. They need enough plants to provide cover. In the winter, they often retreat into barns, cellars, and sheds.

Habitat Regions: temperate

Terrestrial Biomes: chaparral ; forest ; scrub forest

Wetlands: marsh ; swamp ; bog

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
it is most abundant in hardwood forests with deep leaf-litter and abundant food, and avoids areas with little cover and extremes of temperature and moisture. It is semifossorial; and digs tunnels or uses existing ones. It constructs elaborate underground nest. Nests are placed under logs or stumps, or underground. It breeds mainly in early February or March through to September; and peaks may occur in spring and late summer or early fall. Gestation length is three weeks, and litter size is three to 10, average four to six. They have three or more litters per year, and are weaned by 25 days. They sexually mature in one to two months. (George et al. 1986).

Home ranges of this species can be more than twice the size of those of most shrews. Estimates of home range size average about 2.5 ha; and ranges generally overlap (George et al. 1986). The northern short-tailed shrew is a carnivore and invertivore. It eats earthworms, slugs, snails, insect larvae, millipedes, other invertebrates, and small vertebrates (especially mice in winter). It may hoard food (especially snails).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern short-tailed shrews are found in nearly all terrestrial habitats. However, their populations are most dense in damp brushy woodlands, bushy bogs and marshes, and weedy and bushy borders of fields. These shrews are also common in cultivated fields, in flower and vegetable gardens, fence rows, and beside country roads. In the winter, they often retreat into barns, cellars and sheds. They need only sufficient vegetation to provide cover. They are slow to rehabit areas of forest burns. Northern short-tailed shrews construct elaborate runways under leaves, dirt, and snow and construct theirnests in tunnels or under logs and rocks.

Habitat Regions: temperate

Terrestrial Biomes: chaparral ; forest ; scrub forest

Wetlands: marsh ; swamp ; bog

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Most abundant in hardwood forests with deep leaf-litter and abundant food; avoids areas with little cover and extremes of temperature and moisture. Semifossorial; digs tunnels or uses existing ones. Constructs elaborate underground nest. Nests are placed under logs or stumps, or underground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Northern short-tailed shrews are voracious eaters and must feed frequently. It is estimated that they consume as much as three times their weight in food per day. They have to eat more in the winter than in the summer in order to keep their bodies warm. The diet of these shrews consists mainly of invertebrates, such as Oligochaeta, Myriapoda, Araneae, and Insecta. Small vertebrates and plant material are eaten as well. They store food for winter, including Gastropoda and Coleoptera. Shrews living in captivity put nutmeats, sunflower seeds, and other edibles into storage.

The salivary glands of northern short-tailed shrews produce venom that is effective in immobilizing prey. This enables them to prey upon animals much larger than they are, including Caudata, Anura, Squamata, Sigmodontinae, Aves, and other Soricidae. Northern short-tailed shrews cannot inject this venom into their prey like snakes and spiders do. Instead, they chew the venom into the prey until the prey is subdued.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Short-tailed shrews are voracious eaters and must feed frequently, commonly in the early and late afternoon. It is estimated that they consume and metabolize as much as three times their weight in food per day. The diet of Blarina brevicauda consists mainly of invertebrates, small vertebrates, and plant material. B. brevicauda stores food for winter, including snails and beetles, and in captivity puts nutmeats, sunflower seeds, and other edibles into storage.

The submaxillary salivary glands of Blarina brevicauda produce a toxic material which is effective in subduing its prey. This enables it to prey upon animals much larger than itself, including salamanders, frogs, snakes, mice, birds, and other shrews.

Primary Diet: carnivore (Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats earthworms, slugs, snails, insect larvae, millipedes, other invertebrates, and small vertebrates (especially mice in winter). May hoard food (especially snails).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Northern short-tailed shrews are highly abundant in many of the habitats in which they live. Because of this and the fact that they eat large quantities of invertebrates, they have a profound effect on invertebrate abundance. They are also an important prey species, especially for owls.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Northern short-tailed shrews are preyed upon by Strigiformes, Accipitridae, Serpentes, Mustela, Vulpes vulpes, Canis latrans, and occasionally Esox americanus, Salmoninae, and Centrarchidae when they venture near water. Northern short-tailed shrews are aggressive, and they threaten and physically drive away any intruders. They escape predation by remaining hidden in the cover of vegetation or under the soil or snow during foraging expeditions from their nest. They may also make themselves distasteful by exuding a musky odor from glands on their belly and sides. Many mammal predators, such as Mustela and Vulpes vulpes, may refuse to eat northern short-tailed shrews because of their foul taste.

Known Predators:

  • owls (Strigiformes)
  • snakes (Serpentes)
  • hawks (Accipitridae)
  • weasels (Mustela)
  • red fox (Vulpes_vulpes)
  • coyotes (Canis_latrans)
  • pickerel (Esox_americanus)
  • trout (Salmoninae)
  • sunfish (Centrarchidae)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Northern short-tailed shrews are highly abundant in many of the habitats in which they live. Because of this and the fact that they eat large quantities of invertebrates, they have a profound effect on invertebrate abundance. They are also an important prey species, especially for owls.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Northern short-tailed shrews are aggressive and will threaten and physically drive away any intruders. They escape predation by remaining hidden in the cover of vegetation or under the soil or snow during foraging expeditions from their nest. They may also make themselves distasteful by exuding a musky odor from glands on their belly and sides. Many mammal predators, such as weasels and foxes, may refuse to eat northern short-tailed shrews because of their foul taste.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Blarina brevicauda is prey of:
Squamata
Strigiformes
Accipitridae
Mustela
Canis latrans
Vulpes vulpes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Blarina brevicauda preys on:
non-insect arthropods
Sorex cinereus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Home ranges can be more than twice the size of those of most shrews. Estimates of home range size average about 2.5 ha; ranges generally overlap (George et al. 1986). Population density estimates range from 1.6/ha to about 121/ha (George et al. 1986). In 14-year study in Illinois, displayed annual but not multiannual population fluctuations; annual peak occurred in July or in Oct. in different habitats; average minimum density about 1-6/ha in winter, average peak density about 10-20/ha in summer or early fall; none survived more than 10 months following first capture (Getz 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Northern short-tailed shrews, especially males, release a musky odor from scent glands on their belly and sides. They may use this to mark their territories with scent. However, some researchers think this is unlikely because northern short-tailed shrews have a poor sense of smell. These researchers think the musky secretion may instead scare away predators because of its foul taste.

Northern short-tailed shrews have poor vision. It is possible they can only detect light from dark, but cannot see objects. They use a form of echolocation, similar to what bats and whales use, to detect and distinguish among objects in the environment. They send out a series of ultrasonic clicks and then listen for the returning echoes. (Ultrasonic means outside the range of human hearing). By decoding these echoes, shrews can perceive their environment without sight. Similar to other shrews, northern short-tailed shrews also have a highly developed sense of touch, particularly in the snout and vibrissae.

Northern short-tailed shrews shrews make a variety of sounds (chirps, buzzes, twitters) when fighting with other individuals. They make a clicking sound during courtship.

Communication Channels: acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Northern short-tailed shrews, especially males, exude a musky odor from scent glands on their belly and sides. They may use this to mark their territories with scent, though some researchers think this is unlikely because Northern short-tailed shrews have a poor sense of smell. This musky secretion may instead be used to deter predators because of its foul taste.

Northern short-tailed shrews also have poor vision, perhaps only being able to detect light and dark. They use a form of echolocation, similar to what bats and whales use, to detect and distinguish among objects in the environment. They send out a series of ultrasonic (outside of the human hearing range) clicks and then listen for the returning echoes. By decoding these echoes they can perceive their environment without sight. Northern short-tailed shrews utter a variety of sounds (chirps, buzzes, twitters) in their aggressive interactions with other individuals, and a clicking sound is used during courtship.

Communication Channels: acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Northern short-tailed shrews can live as long as 3 years, but most probably die in their first year or before they reach adulthood.

Range lifespan

Status: wild:
3.0 (high) years.

Average lifespan

Status: wild:
2.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Northern short-tailed shrews can live as long as 3 years, but most probably die in their first year or before they reach adulthood.

Range lifespan

Status: wild:
3.0 (high) years.

Average lifespan

Status: wild:
2.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 2.2 years (captivity) Observations: In the wild, these animals have been estimated to live up to 2.5 years (Bernhard Grzimek 1990), which could be overestimated. In captivity, they do not appear to live more than 2.2 years (Richard Weigl 2005), though some anecdotes indicate a longer lifespan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Elaborate mating nests, 150-250 mm long by 150-150 mm wide, are built out of shredded grass or leaves and placed in tunnels or under logs and rocks. The breeding season extends from early spring to early fall (March-September), although some scattered reproductive activity may occur throughout the entire year. Females may have up to 3 litters per year, although 2 is more usual. Gestation is 21-22 days and litter size is 3-10, although 5-7 pups is most common. The young leave the nest when 18-20 days old and are weaned several days later. Females reach sexual maturity at 6 weeks, while males mature at 12 weeks. The life span can be as long as 3 years, but it is usually much more brief.

Breeding interval: Female northern short-tailed shrews may have multiple litters throughout the warm months of the year, depending on food availability.

Breeding season: The breeding season lasts from March through September.

Range number of offspring: 3.0 to 10.0.

Average number of offspring: 6.0.

Range gestation period: 22.0 (high) days.

Range weaning age: 20.0 (low) days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; fertilization ; viviparous

Average birth mass: 1.34 g.

Average number of offspring: 6.

Average age at sexual or reproductive maturity (male)

Sex: male:
65 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
46 days.

Females care for their young in the nest for 18 to 20 days. After weaning, at 25 days old, the young leave their mother's nest and all parental care ends.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Little information is available regarding the mating systems of northern short-tailed shrews.

Northern short-tailed shrews build elaborate mating nests out of shredded grass or leaves. The nests are 150 to 250 mm long by approximately 150 mm wide and are placed in tunnels or under logs and rocks. The breeding season extends from early spring to early fall (March-September), although some scattered reproductive activity may occur throughout the entire year. Females usually have 2 litters in a year, although they sometimes have 3. Pregnancy lasts 21 to 22 days. Although 3 to 10 shrew pups may be born in a littler, between 5 and 7 young is most common. Young short-tailed shrews leave the nest at 18 to 20 days of age and are weaned several days later. Females reach adulthood at 6 weeks of age, while males become adults at 12 weeks.

Breeding interval: Female northern short-tailed shrews may have multiple litters throughout the warm months of the year, depending on food availability.

Breeding season: Short-tailed shrews breed between March and September.

Range number of offspring: 3 to 10.

Average number of offspring: 6.

Range gestation period: 22 (high) days.

Range weaning age: 20.0 (low) days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; fertilization ; viviparous

Average birth mass: 1.34 g.

Average number of offspring: 6.

Average age at sexual or reproductive maturity (male)

Sex: male:
65 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
46 days.

Females care for their young in the nest for 18 to 20 days. After weaning, at 25 days old, young northern short-tailed shrews leave the nest and all parental care ends.

Parental Investment: altricial ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds mainly early February or March through September; peaks may occur in spring and late summer or early fall. Gestation 3 weeks. Litter size: 3-10, average 4-6. Three or more litters per year. Weaned by 25 days. Sexually mature in 1-2 months. (Dapson 1968, George et al. 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Blarina brevicauda

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 43 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTATACATAGTATTTGGTGCCTGAGCTGGCATGGCAGGTACCGCCCTAAGCATTTTAATCCGCGCTGAGCTCGGACAACCGGGCGCCTTACTAGGTGATGATCAAATTTATAATGTAATTGTCACCGCCCACGCTTTCGTCATAATTTTCTTTATAGTTATGCCTATTATGATAGGAGGATTTGGCAACTGGCTTGTCCCCCTAATAATTGGAGCCCCTGATATAGCTTTCCCACGAATAAACAACATAAGCTTCTGGCTACTACCCCCCTCATTCCTACTATTATTAGCCTCATCAACAGTTGAAGCCGGAGCCGGAACAGGCTGAACCGTATACCCGCCCCTAGCCGGAAATCTTGCGCACGCAGGGGCCTCCGTCGACCTCGCAATCTTCTCCCTACACCTAGCAGGAGTCTCCTCAATCCTCGGTTCCATTAATTTCATTACTACTATCATTAACATAAAACCCCCAGCCATATCACAATACCAGACCCCTTTATTTGTCTGATCAGTCTTAATTACTGCTGTCTTACTATTACTATCACTCCCAGTTCTCGCTGCTGGCATTACAATACTACTCACTGATCGTAATTTAAACACAACTTTCTTTGACCCCGCCGGAGGAGGTGACCCTATTCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Blarina brevicauda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Northern short-tailed shrews are common through much of their range, especially in the areas surrounding the Great Lakes. As with many small mammals, their populations change frequently. Researchers are not sure what causes these changes.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
NatureServe (Hammerson, G.)

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Justification
Listed as Least Concern because this is a widespread and abundant species that is not experiencing any decline in population.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Blarina brevicauda is common through much of its range, especially in the areas surrounding the Great Lakes. As with many small mammals, its populations undergoes frequent fluctuations, the causes and effects of which are not well understood.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is widespread and abundant. Population density estimates range from 1.6/ha to about 121/ha (George et al. 1986). In a 14 year study in Illinois, the northern short-tailed shrew displayed annual but not multiannual population fluctuations; annual peak occurred in July or in October in different habitats; average minimum density about 1-6/ha in winter, average peak density about 10-20/ha in summer or early fall; none survived more than 10 months following first capture (Getz 1989).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The venom secreted from the salivary glands of northern short-tailed shrews can cause pain that lasts for several days in a human who is bitten. However, bites are rare, and usually occur when someone attempts to handle a shrew.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Because they eat large quantities of invertebrates, northern short-tailed shrews can be important in controlling crop pests, especially the larch sawfly. They also destroy snails and mice that damage crops and are pests to humans.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

The poison secreted from the submaxillary glands of Blarina brevicauda can cause pain that lasts for several days in a human who is bitten. However, bites are rare, and usually occur when someone attempts to handle a shrew.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Due to its insectivorous nature and ravenous appetite, Blarina brevicauda often serves as an important check on insect crop pests, especially the larch sawfly. It also destroys snails and mice that damage crops and are pests to humans.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern short-tailed shrew

The northern short-tailed shrew (Blarina brevicauda) is the largest shrew in the genus Blarina,[3] and occurs in the northeastern region of North America.[4] It is a semifossorial, highly active and voracious insectivore present in a variety of habitats.[5] It is one of the few venomous mammals. The specific epithet, brevicauda, is a combination of the Latin brevis and cauda, meaning "short tail".[3]

Contents

Taxonomy [edit]

B. brevicauda is a red-toothed shrew, one of three or four species (depending on the authority)[3] in the genus Blarina. It was formerly considered to be a sister subspecies of the southern short-tailed shrew (Blarina carolinensis).[3] The species has been divided into 11 subspecies based on morphological characteristics, which are grouped into two semispecies: brevicauda and talpoides. These groupings were mirrored by a molecular systematics study of the mitochondrial cytochrome b sequence.[6] The two groups of subspecies are thought to have been kept isolated from each other by Pleistocene glaciers.[6]

Description [edit]

Northern short-tailed shrew

This shrew has a total length of 108 to 140 mm (4.3 to 5.5 inches), of which 18 to 32 mm (0.7 to 1.3 inches) is tail; it weighs 15 to 30 grams (0.5 to 1.1 ounces).[5] The northern short-tailed shrew exhibits slight sexual dimorphism in size, with the male being slightly larger than the female.[3][4] The dorsal fur is thick and velvety, and can be black, brownish black, or silvery gray, with the ventral fur being a bit lighter and grayer.[5] The shrew molts from a summer coat, which is shorter and paler than the winter pelage in October and November, and back again sometime in February through July.[3] The tail is quite short, amounting to less than 25% of total body length (as measured from tip of snout to base of tail) length.[5] The species has one upper incisor, five unicuspids (simple teeth that cannot be easily identified), a premolar (the fourth), and three molars in the upper jaw. The lower dentition is identical, except only one is unicuspid.[3] Three well-developed scent glands are present, one on each side of the animal and one ventral. The scent may be used for marking territories, though the shrew's sense of smell is thought to be poor.[3]

Fossil record [edit]

Most records of B. brevicauda are from the Pleistocene,[7] though one record from the late Pliocene (Blancan land mammal age) is tentatively attributed to this species.[8] Another source indicates the earliest record of the genus Blarina is a specimen of the talpoides subspecies of B. brevicauda, from the Blancan (early Pleistocene) in Kansas. The species is thought to have arisen in the middle or late Pliocene.[3] The B. b. brevicauda subspecies appeared later.[3]

Range [edit]

This shrew is found throughout central and eastern North America, from southern Saskatchewan to Atlantic Canada and south to Nebraska, Georgia, and northern Arkansas.[4][9] It is probably the most common shrew in the Great Lakes region.[3][5] Population densities usually range from 5–30 shrews per hectare (2–12 per acre), but rarely exceed 200 per hectare (80 per acre).[5] The typical home range of a shrew is 2.5 hectares, and may overlap slightly with the ranges of other shrews.[3]

Habitat [edit]

Both disturbed and undisturbed habitats are used by the northern short-tailed shrew, including grasslands, old fields, fencerows, marshy areas, deciduous and coniferous forests, and household gardens,[3][4][5] though the preferred habitats are moist with a decent amount of leaf litter or thick plant cover.[3][5] Burned-over forests are not quickly recolonized by B. brevicauda,[4] and shrews quickly depart clear-cuts.[3]

Diet [edit]

The northern short-tailed shrew consumes up to three times its weight in food each day.[4] It eats small quantities of subterranean fungi and seeds, though it is mostly carnivorous.[5] It prefers insects, earthworms, voles, snails, and other shrews for the bulk of its diet, though amphibians, especially salamanders, and mice are also eaten.[5] This shrew consumes vertebrates more often than other shrews do.[5] The shrew mostly forages within a few hours after sunset, though it is also active during cloudy days.[5] High evaporative water loss requires the shrew to have access to a source of water, though it does obtain water from its food, as well.[3] The shrew often hoards food, especially in the fall and winter, or during a time of prey abundance.[3] One study found it caches 87% of the prey it catches, while 9% is eaten immediately and 4% is left where it was killed.[10]

Toxin [edit]

The saliva of the northern short-tailed shrew contains a kallikrein-like protease, used to paralyze and subdue its prey.[11] The toxin is strong enough to kill small animals, up to sizes somewhat larger than the shrew itself, and results in painful bites to humans who attempt to handle the shrew.[3] The poisonous saliva is secreted from submaxillary glands, through a duct at the base of the lower incisors, where the saliva flows along the groove formed by the two incisors, and into the prey.[3][5] The toxin is very similar in structure to the one used by the Mexican beaded lizard (Heloderma horridum), but evolved independently, however, from the same precursor protein.[12]

One of the venom components, a peptide called soricidin, has been patented and is being investigated in Canada for pain control and as an anticancer drug. Another component is being studied in Japan as an antihypertensive agent.[13]

Physiology [edit]

Senses [edit]

Their sense of smell is thought to be poor, and their eyes are degenerate and vision is thought to be limited to the detection of light,[3] but these shrews compensate by using echolocation and a fine sense of touch.[4][5]

Energetics [edit]

Its ability to consume almost anything it can catch allows the northern short-tailed shrew to survive the cold winters of temperate regions.[3] The thermoneutral zone of this species (no extra energy must be expended by the animal to maintain its body temperature, which averages 38–38.5 °C) is from 25 to 33 °C;[3] when the ambient temperature is within this range. Food consumption is 43% higher in winter than in summer,[3] as the shrew must increase its metabolic rate to maintain its body temperature under the cold conditions. Temperatures at or above 35 °C are lethal for this shrew.[3] A study of captive shrews found, though they were primarily nocturnal, the degree of nocturnality changed with the season. That is, during the colder winter months, the shrews exhibited more out-of-burrow activity earlier in the evening, but were active later in the night during the summer.[14] The study indicated this seasonal pattern was due to solar radiation and changing daily temperatures, and it allows the shrews to minimize the energy needed for thermoregulation.[14] Other winter adaptations include the creation of a lined nest, which helps the shrew conserve heat, caching of food in case of prey shortages, foraging below the leaf litter or snow where the temperature is milder, and decreasing activity levels during cold periods.[15] Along with these behavioral adaptations, this shrew increases its ability to generate body heat during the winter by nonshivering thermogenesis in brown adipose tissue.[15]

Behavior [edit]

Blarina brevicauda is a semi-fossorial animal meaning that it spends the majority of its time underground.[16] The shrews use their front feet to dig tunnels underground for shelter that often will resemble a honeycomb complex.[16] Despite living underground, they have been known to climb trees and other structures in the short bouts of time spent on the surface.[16] Other shrews spend more time above ground than does the northern short-tailed shrew, which prefers to tunnel along below ground, through the leaf litter, or at the snow/ground interface.[3][5] Bouts of frenzied activity, lasting about five minutes, are followed by longer periods of resting, with the total active time amounting to only 16% of a 24-hour day.[3] This animal is capable of digging at a rate of 2.5 cm/min, in-between resting.[3]

The shrews live in underground nests that are spherical in shape. These nests are often lined with the fur of meadow voles.[17] The shrew constructs a nest up to 20 cm (8 in) in diameter underground or underneath a log.[3][5] This nest is kept clean, with wastes deposited outside the nest in a latrine area.[3][5] Other parts of the burrow system are used for food storage.[5]

B. brevicauda has a high resting metabolic rate with their activity level is tied to the weather.[18] The animals are most active on cloudy days as opposed to rainy or sunny days.[16] The northern short-tailed shrew is widely considered solitary and unsocial which is likely due to its territorial nature.[18] Pairs of shrews introduced to a cage simultaneously coexisted for less than four months before one killed the other, and a new shrew placed in a cage containing an already established shrew is killed within a few hours.[19]

Another interesting aspect of B. brevicauda behaviour is their use of echolocation. The eyesight of the northern short-tailed shrew is particularly poor and they must accordingly rely on other sensory methods to succeed.[20] The animals have strong olfactory senses and are able to use echolocation.[20] They use echolocation for exploration of their environment and tunnel building.[20]

Reproduction [edit]

Reproduction in Blarina brevicauda occurs during the breeding season, which lasts from early February until September.[16] There are two peaks of breeding, the first in spring and the second in late summer to early autumn.[16]

During the reproductive period, female shrews tend to increase in size as well as appetite and will diversify their food sources and venture further to gain nutrients.[21] Because of their high resting metabolic rate, the shrews reproduce frequently with upwards of 20 or more matings occurring in a single day.[22] The repetitive copulation is needed in order to induce ovulation, as a minimum of six matings is required.[16] Copulation in the short-tailed shrew can last as long as 25 minutes with the average length being 5 minutes.[23] The female directs the copulation, positioning herself accordingly while the male is asleep.[16] The female strengthens the nest when the young are nursing, and is more active to support her increased nutritional needs.[3] The young, which were born hairless and blind, weighing less than a gram, may become sexually mature in as soon as two to three months. Those born in the spring mature more quickly than those born late in the season, and may themselves reproduce in the same year they were born.[3][5] The juvenile pelage is pale and quite similar to the adults' summer fur, and is molted when the young reaches adult size.[3]B. brevicauda is promiscuous. Male shrews in captivity were observed to make clicking sounds while courting a female.[24]

Once pregnancy has occurred, the gestation period is 21 to 22 days on average, with litters approaching a mean number of 6 or 7 young.[16] The weaning of the young occurs by 25 days old.[25] Most B. brevicauda do not live beyond a year and in the case of the death of the litter, estrous in the mother will reoccur.[16] The number of offspring in a population per year varies on a random basis leading to fluctuations in numbers but as the species is a generalist as are its predators, the impact of these random changes is not significant.[18]

Predation [edit]

The northern short-tailed shrew has a high mortality rate, though it attempts to escape predation by remaining hidden under vegetation, soil, leaf litter, or snow;[4] only 6% of a marked group of shrews survived to the next year,[5] and winter mortality of 90% has been recorded, probably due to cold stress.[3] This shrew is consumed by many predators: snakes, raptors, canids, cats, mustelids, skunks, raccoons, and opossums,[3][5] though mammalian carnivores appear to be deterred by the musky odor produced by the shrew's scent glands.[5]

Conservation [edit]

The northern short-tailed shrew is considered a species of least concern in the IUCN Red List, as it is widespread, abundant, and its population is not declining.[2]

References [edit]

  1. ^ Hutterer, R. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 269. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b NatureServe (Hammerson, G.) (2008). Blarina brevicauda. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 2008-11-23.
  3. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad ae af ag ah George, S.B.; Choate, J.B. and Genoways, H. H. "Blarina brevicauda". Mammalian Species Accounts 261: 1–9. 
  4. ^ a b c d e f g h Ballenger, L. (2000). Blarina brevicauda, Animal Diversity Web. Accessed December 30, 2012
  5. ^ a b c d e f g h i j k l m n o p q r s t u v Kurta, Allen (1995). Mammals of the Great Lakes Region. Ann Arbor, MI: The University of Michigan Press. pp. 46–49. ISBN 978-0-472-06497-7. 
  6. ^ a b Brant, Sara V.; Orti, Guillermo (2003). "Phylogeography of the Northern short-tailed shrew, Blarina brevicauda (Insectivora: Soricidae): past fragmentation and postglacial recolonization". Molecular Ecology 12 (6): 1435–1449. doi:10.1046/j.1365-294X.2003.01789.x. PMID 12755873. 
  7. ^ "The Paleobiology Database – Blarina brevicauda". Retrieved 2008-11-23. 
  8. ^ "Dixon: Blancan, Kansas". The Paleobiology Database – Collection 19930. Retrieved 2008-11-23. 
  9. ^ Pfau, R. S.; Sasse DB; Connior MB; Guenther IF (2011). "Occurrence of Blarina brevicauda in Arkansas and notes on the distribution of Blarina carolinensis and Cryptotis parva". Journal of the Arkansas Academy of Science 65: 61.  More than one of |author= and |last= specified (help)
  10. ^ Robinson, Denise E.; Brodie, Edmund D., Jr. (1982). "Food Hoarding Behavior in the Short-tailed Shrew Blarina brevicauda". American Midland Naturalist 108 (2): 369–375. doi:10.2307/2425498. JSTOR 2425498. 
  11. ^ Kita, Masaki; Nakamura, Yasuo; Ohdachi, Satoshi D.; Oba, Yuichi; Yoshikuni, Michiyasu; Kido, Hiroshi; Uemura, Daisuke; Uemura, D (2004). "Blarina toxin, a mammalian lethal venom from the short-tailed shrew Blarina brevicauda: Isolation and characterization". PNAS 101 (20): 7542–7547. doi:10.1073/pnas.0402517101. PMC 419642. PMID 15136743. 
  12. ^ Aminetzach, Yael T.; Srouji, John R.; Kong, Chung Yin &; Hoekstra, Hopi E. (2009). "Convergent Evolution of Novel Protein Function in Shrew and Lizard Venom". Current Biology 19 (22): 1925–31. doi:10.1016/j.cub.2009.09.022. PMID 19879144. 
  13. ^ Spit from poisonous shrew could help with cancer Canadian Press via CTV News, Monday Feb. 21, 2005
  14. ^ a b Martin, Irwin G. (1983). "Daily Activity of Short-tailed Shrews (Blarina brevicauda) in Simulated Natural Conditions". American Midland Naturalist 109 (1): 136–144. doi:10.2307/2425523. JSTOR 2425523. 
  15. ^ a b Merritt, Joseph F. (1986). "Winter Survival Adaptations of the Short-tailed Shrew (Blarina brevicauda) in an Appalachian Montane Forest". Journal of Mammalogy 67 (3): 450–464. doi:10.2307/1381276. JSTOR 1381276. 
  16. ^ a b c d e f g h i j George et al. 1986
  17. ^ Getz et al. 1992
  18. ^ a b c Getz et al. 2004
  19. ^ Martin, Irwin G. (1981). "Tolerance of Conspecifics by Short-Tailed Shrews (Blarina brevicauda) in Simulated Natural Conditions". American Midland Naturalist 106 (1): 206–208. doi:10.2307/2425153. JSTOR 2425153. 
  20. ^ a b c Tomasi 1979
  21. ^ Getz et al. 2008
  22. ^ Genoud et al. 1990; George et al. 1986
  23. ^ Stephenson et al. 1995; George et al. 1986
  24. ^ Martin, Irwin G. (1980). "An Ethogram of Captive Blarina brevicauda". American Midland Naturalist 104 (2): 290–294. doi:10.2307/2424868. JSTOR 2424868. 
  25. ^ Stephenson et al. 1995
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: B. CAROLINENSIS SHERMANI may be an isolated subspecies of B. BREVICAUDA or a distinct species (George et al. 1986). Blarina brevicauda was regarded as conspecific with Carolinensis and B. HYLOPHAGA by Hall (1981). Blarina B. TELMALESTES was regarded as a distinct species by Hall (1981) but not by Jones et al. (1986) or in most other recent accounts.

Blarina brevicauda and B. HYLOPHAGA may hybridize in narrow contact zones, but genetic exchange appears to be limited (Benedict 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!