Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

Range Description

Michoacan, Sinaloa, and Tamaulipas (Mexico) south to Southern Brazil, Northern Argentina, and Bolivia; Trinidad and Tobago; Southern Lesser Antilles; Trés Marías Isls (Simmons 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found in forests and natural areas. Good seed disperser (Barquez et al. 1999)

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Not much is known about the longevity of these animals, but one specimen lived 10.9 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Artibeus lituratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 652
Specimens with Barcodes: 785
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Artibeus lituratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 674 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATACCTATTATTTGGTGCTTGAGCAGGTATGGTAGGTACTGCACTAAGTCTCCTTATTCGTGCAGAACTTGGCCAACCTGGGGCCCTATTAGGTGATGATCAAATCTATAACGTAATCGTAACAGCTCATGCCTTTGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGGGGATTCGGTAATTGATTAGTACCACTAATAATTGGCGCACCCGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTCCCACCTTCCTTCCTACTTTTACTTGCTTCCTCTACAGTTGAAGCTGGCGTTGGAACAGGTTGAACCGTATACCCACCACTAGCTGGAAATCTAGCACATGCTGGAGCTTCAGTTGACCTAGCTATTTTCTCTCTTCACCTAGCCGGAGTTTCGTCAATCCTTGGAGCTATTAATTTTATTACTACAATTATTAATATAAAACCACCTGCCCTCTCTCAATATCAAACACCTTTATTTGTCTGATCCGTTTTAATCACTGCCGTCCTATTACTCCTGTCTCTTCCTGTTTTAGCAGCAGGTATTACTATACTCCTAACAGACCGAAACCTTAATACTACATTCTTTGACCCAGCTGGAGGAGGAGACCCCATTTTATATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barquez, R., Perez, S., Miller, B. & Diaz, M.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Deforestation, but not a major threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Avoid deforestation. Found in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Great fruit-eating bat

The great fruit-eating bat (Artibeus lituratus) is a bat species in the family Phyllostomidae from South and Central America. It is found from Mexico to Brazil and Argentina, as well as in Antigua and Barbuda, Barbados, Grenada, Martinique, Saint Lucia, Saint Vincent and the Grenadines and Trinidad and Tobago.

They are 10.5 g at birth and grow to 65 g as adults.[2]

References

  1. ^ Barquez, R., Perez, S., Miller, B. & Diaz, M. (2008). "Artibeus lituratus". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 16 April 2011. 
  2. ^ Longevity, ageing, and life history of Artibeus lituratus accessed 6 October 2010


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!