Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

Great fruit-eating bats (Artibeus lituratus) range from Mexico to Southern Brazil.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Michoacan, Sinaloa, and Tamaulipas (Mexico) south to Southern Brazil, Northern Argentina, and Bolivia; Trinidad and Tobago; Southern Lesser Antilles; Trés Marías Isls (Simmons 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Great fruit-eating bats belong to the family Phyllostomidae, a family of "leaf-nosed bats", who have a "horn" projection from the nose. Great fruit-eating bats are one of the largest fruit eating canopy bats, with a long wingspan used to travel long distances in search of fruit among the canopies and trees. Great fruit-eating bats have an average body mass of 65.9 g, body width of 4.5 mm, and a single wing length of 23.0 mm. These bats have light to dark brown fur.

Average mass: 65.9 g.

Average wingspan: 23.0 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Great fruit-eating bats are mostly tree dwelling, roosting in tree cavities or on branches. Great fruit-eating bats have dispersed to urban areas, however, where they may roost in buildings. Great fruit-eating bats will roost above ground from 2.7 to 28 m in tree canopies and also inhabit caves.

Range elevation: 2.7 to 28 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: urban ; caves

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Found in forests and natural areas. Good seed disperser (Barquez et al. 1999)

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Great fruit-eating bat are frugivores; their diet consist of mainly fruits but they feed on nectar. Great fruit-eating bats demonstrates a group-foraging behavior, where scouts are assigned to locate a tree with fruit and then "report" back to the harem. The harem will later follow the scouts to the tree location for feeding. Great fruit-eating bats remove fruit from trees and take it back to a feeding area. The bats will fly around the fruit, take a bite, and perform a twisting movement to remove the fruit from the tree. Great fruit-eating bats will feed on fruit from several trees, switching from up to 2 to 5 fruit trees in one night.

Plant Foods: fruit; nectar

Primary Diet: herbivore (Frugivore , Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Great fruit-eating bats play a significant role in the ecosystem. Being a frugivore, the bats disperse seeds from fruit in their fecal matter. However, more research is needed to fully understand the plant species that make up the diet of great fruit-eating bats, in order to pinpoint the specific species of seeds they disperse. Great fruit-eating bats may also serve as a host for parasitic bat flies and mites.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great fruit-eating bats are thought to have developed harems as a social structure and to help protect against predation, with one male to every few females. Great fruit-eating bats are known to fall prey to birds, such as owls.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Great fruit-eating bats, like many other bats, use echolocation for orientation and locating food. Echolocation is the process of emitting sound waves and then analyzing the returning echoes to determine food location and nearby obstacles. Great fruit-eating bats are unique as they use scent in conjunction with echolocation to locate fruit. Little information is known about the specific calls of the great fruit-eating bats, but information about the calls of New World leaf-nosed bats, and relatives the, Jamaican fruit-eating bats is available.  Bats differ in intensity and frequency of their calls depending on their diet and environment.

Communication Channels: acoustic ; chemical

Perception Channels: tactile ; ultrasound ; echolocation ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Information is not yet available about the lifespan of great fruit-eating bats in the wild or in captivity.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Not much is known about the longevity of these animals, but one specimen lived 10.9 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Great fruit-eating bats are polygamous, with groups called harems consisting of one male and several females.

Mating System: polygynous

More research needed to fully understand the reproductive behavior and patterns of great fruit-eating bats.  Great fruit-eating bats vary reproductive patterns regionally. In northern neotropical regions, reproductive patterns are monoestrous, while in southern regions seasonal bimodal polyestry (two reproduction peaks annually during the wet season) is observed. The first peak occurs between June to October and the second from October to March. Some hypothesize that rainfall may also play a role in the reproductive patterns of great fruit-eating bats.

Breeding interval: Great fruit-eating bats reproduce twice annually in southern regions and once annually in northern regions.

Range number of offspring: 1 to 2.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Little information is available about the parental investment involved in caring for the young of great fruit-eating bats.

Parental Investment: pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Artibeus lituratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 674 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATACCTATTATTTGGTGCTTGAGCAGGTATGGTAGGTACTGCACTAAGTCTCCTTATTCGTGCAGAACTTGGCCAACCTGGGGCCCTATTAGGTGATGATCAAATCTATAACGTAATCGTAACAGCTCATGCCTTTGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGGGGATTCGGTAATTGATTAGTACCACTAATAATTGGCGCACCCGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTCCCACCTTCCTTCCTACTTTTACTTGCTTCCTCTACAGTTGAAGCTGGCGTTGGAACAGGTTGAACCGTATACCCACCACTAGCTGGAAATCTAGCACATGCTGGAGCTTCAGTTGACCTAGCTATTTTCTCTCTTCACCTAGCCGGAGTTTCGTCAATCCTTGGAGCTATTAATTTTATTACTACAATTATTAATATAAAACCACCTGCCCTCTCTCAATATCAAACACCTTTATTTGTCTGATCCGTTTTAATCACTGCCGTCCTATTACTCCTGTCTCTTCCTGTTTTAGCAGCAGGTATTACTATACTCCTAACAGACCGAAACCTTAATACTACATTCTTTGACCCAGCTGGAGGAGGAGACCCCATTTTATATCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Artibeus lituratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 652
Specimens with Barcodes: 785
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

There are no known threats to the population of this species. Great fruit-eating bats are listed as Least Concern on the IUCN Red List.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barquez, R., Perez, S., Miller, B. & Diaz, M.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Deforestation, but not a major threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Avoid deforestation. Found in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Little information is available about any negative impacts of this species to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great fruit-eating bats are one of the fruit-eating bat species that plays a significant role in the seed dispersal of plants in forests as well as in urban areas. Although this economic benefit is difficult to quantify.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Great fruit-eating bat

The great fruit-eating bat (Artibeus lituratus) is a bat species in the family Phyllostomidae from South and Central America. It is found from Mexico to Brazil and Argentina, as well as in Antigua and Barbuda, Barbados, Grenada, Martinique, Saint Lucia, Saint Vincent and the Grenadines and Trinidad and Tobago.

They are 10.5 g at birth and grow to 65 g as adults.[2]

References

  1. ^ Barquez, R., Perez, S., Miller, B. & Diaz, M. (2008). "Artibeus lituratus". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 16 April 2011. 
  2. ^ Longevity, ageing, and life history of Artibeus lituratus accessed 6 October 2010


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!