Overview

Distribution

Range Description

This species is found in Thailand, Cambodia, Malaysia, Borneo, Java, Sumatra, Lesser Sunda Islands, and adjacent small islands in Indonesia. It has also been recorded from Bali, Lombok, Simelue and Nias (I. Maryanto pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in many habitats in Indonesia but only pristine forests in Thailand. In Malaysia it has been found in agricultural areas, suburban parks, fruit orchards and secondary forest as well as good forest (Campbell and Kunst, 2006). They have a harem social structure, and are highly gregarious when roosting in caves, but are found in smaller groups when roosting in forests. It makes tent roosts.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cynopterus horsfieldii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTTCTGTTTGGCGCTTGAGCTGGAATAGTTGGCACCGCCCTCAGTCTACTAATTCGAGCGGAACTTGGCCAACCAGGTGCGCTATTAGGAGATGACCAAATTTATAATGTTATCGTAACAGCCCACGCATTTGTAATGATTTTCTTCATGGTAATGCCCATTATAATTGGAGGCTTTGGAAATTGACTGATTCCCCTAATAATTGGTGCCCCAGACATAGCCTTTCCCCGAATAAACAACATGAGTTTCTGACTCCTCCCTCCCTCATTCCTACTTCTACTTGCCTCCTCAACAGTAGAAGCCGGCGCCGGGACCGGATGAACAGTCTACCCCCCTCTAGCTGGCAATTTAGCCCACGCAGGAGCCTCAGTGGACCTGGCGATCTTTTCTCTACACCTAGCCGGAGTTTCATCCATTCTAGGGGCCATTAATTTTATTACAACAATCATCAACATAAAACCACCAGCTCTGTCCCAATATCAAACCCCCTTATTCGTCTGATCAGTCCTAATTACCGCTGTACTACTCCTCCTATCCCTCCCAGTCCTAGCTGCCGGCATTACGATACTACTTACAGATCGAAATCTGAATACTACCTTCTTTGACCCTGCTGGAGGAGGAGACCCAATTCTATATCAACACCTCNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cynopterus horsfieldii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Bates, P., Francis, C., Gumal, M. & Bumrungsri, S.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority), Chanson, J. & Chiozza, F. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern as it is a common and widespread species, it is tolerant of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a more threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common in Indonesia (I. Maryanto pers. comm.), but locally rare in northern and western Thailand (S. Bumrungsri pers. comm.).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species throughout its range. Deforestation is a threat in Thailand, but elsewhere this species adapts to disturbed habitats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Isolated populations from Thailand need to be examined taxonomically (S. Bumrungsri pers. comm.). It is found in a number of protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Horsfield's fruit bat

Horsfield's fruit bat (Cynopterus horsfieldii) is a species of megabat native to South East Asia. It is named for Thomas Horsfield, an American naturalist who presented the type specimen to the British Museum.

Contents

Description

Horsfield's fruit bat is a medium-sized megabat, intermediate in size between flying foxes and pygmy fruit bats. Adults weigh around 55 to 60 grams (1.9 to 2.1 oz), and have light grey to brown fur, with a reddish brown or orange mantle around the shoulders. In some males the mantle extends across the chest, and the fur is often brighter in colour than in females. The rim of the ears and the skin overlying the metacarpals and phalanges within the wing are white. Juveniles have a more bland coat pattern, with uniformly dull buff or grey fur.[2]

The bats have a short, broad snout, ending in a pair of almost tubular nostrils. Both the eyes and ears are large, although the latter have a simpler structure than in most other bats, and lack a tragus.[2] The wings have a low aspect ratio and high wing loading, typical of many megabats, and indicating a relatively slow flight speed and moderate manoeuvrability.[3]

Distribution and habitat

Horsfield's fruit bat is found in Thailand, Indonesia, Malaysia, and Brunei. Within this region, it inhabits a broad range of lowland habitats, from dense primary rain forest to agricultural land and suburban gardens.[1]

There are four recognised subspecies:

Biology and behaviour

Horsfield's fruit bats eat the fruit of strangler figs, Elaeocarpus, and Payena, and the flowers of bitter beans. They have been reported to pluck fruit from trees and carry it to roosts elsewhere in order to feed. During the dry season, hen fruit is in short supply, they instead feeds on pollen, which they take from a wide variety of different plants.[2]

They live in small groups, consisting of a single adult male and up to five females and their young. Although these groups are maintained year round, individual females often move between different groups, and may spend some time nesting alone between leaving one group and joining another. They roost in trees and cave mouths, reportedly favouring banana trees. They often modify their roosting sites by constructing tents from the leaves, partly cutting through them to make an inverted "V" shape.[4]

They breed throughout the year, but most commonly give birth at two times of the year: between February and March and between July and August. They have been reported to live for at least 31 months.[2]

References

  1. ^ a b Bates, P., Francis, C., Gumal, M. & Bumrungsri, S. (2008). "Cynopterus horsfieldii". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. 
  2. ^ a b c d Campbell, P. & Kunz, T.H. (2006). "Cynopterus horsfieldii". Mammalian Species: Number 802: pp. 1–5. doi:10.1644/802.1. 
  3. ^ Hodgkison, R., et al. (2004). "Habitat structure, wing morphology, and the vertical stratification of Malaysian fruit bats (Megachiroptera: Pteropodidae)". Journal of Tropical Ecology 20 (6): 667–673. doi:10.1017/S0266467404001737. 
  4. ^ Campbell, P., et al. (2006). "Comparative roosting ecology of Cynopterus (Chiroptera: Pteropodidae) fruit bats in peninsular Malaysia". Biotropica 38 (6): 725–734. doi:10.1111/j.1744-7429.2006.00203.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!