Articles on this page are available in 1 other language: Chinese (Simplified) (1) (learn more)

Overview

Brief Summary

Biology

Under favourable conditions, female lesser short-nosed fruit bats give birth to one pup twice each year, once between mid January and mid April, and again between mid June and early October. Pregnancy lasts between five and six months and the birth of the pups does not necessarily occur in time with flowering or fruiting (6). Females carry their pup in flight for the first few months of life, until it has learnt to fly with confidence (2). The young become sexually mature at seven months, and females will give birth to their first pup at just over 12 months old (6). Lesser short-nosed fruit bats become active shortly after sunset and fly directly to fruiting trees up to 2 km away (7) to feed on small fruits, including mangoes (6) and figs, as well as on nectar (8). They fly around the trees several times before settling on the fruit (7), where they use claws on the first and second digits of the hands, as well as their strong feet, to cling on to bunches of fruit whilst feeding. As fruit bats do not echolocate, they must find their food using their large eyes and strong sense of smell. During the day, they return to their roosts under shaded trees, tree-ferns and near the entrances of caves (8). This species is a particularly important seed-disperser; it is a seasonal specialist, and over an annual fruiting cycle can consume the fruits of 54 species, the leaves of 14 species and the flower parts of four species (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

With an appearance typical of a fruit bat, the lesser short-nosed fruit bat is a beautiful example. Its dog-like face with large, appealing eyes and white edging on the ears give this bat a magical quality. When roosting, the bat wraps its black wings tightly around its body like a cloak, leaving only the head visible. The white finger bones stand out against the black wing membranes, adding to the striking effect. The fur is short and greyish brown to yellowish brown on the back and paler on the underside. Adult males have a dark orange-red collar and females a more yellow-orange collar. Juveniles lack this collar and tend to be uniformly grey (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Summary

"
Habit

Arboreal, solitary and in small colonies.

Habitat

Urban areas, forests.

Niche

Palm-foliage. Up to 2000m.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This widespread species ranges from South Asia, through parts of southern China to parts of Southeast Asia. In South Asia, this species is presently known from Bangladesh (Sylhet division) (Sarker and Sarker 2005; Srinivasulu and Srinivasulu 2005), India (Andaman and Nicobar Islands, Gujarat, Karnataka, Kerala, Madhya Pradesh, Maharashtra, Meghalaya, Orissa, Uttar Pradesh and West Bengal) and Sri Lanka (North Central, Uva and Western provinces) (Srinivasulu et al. in press; Molur et al. 2002). In southern China, it has been recorded from Guangdong, with possible records from Xizang (Medog) and southern Yunnan (Wang 2002; Smith and Xie 2008). In continental Southeast Asia, it is known from southern Myanmar, Thailand, Lao PDR, Viet Nam (identity of records from northern Viet Nam need verification), Cambodia (known only from Phnom Phen [G. Csorba pers. comm.]), and Peninsular Malaysia. In Insular Southeast Asia, it is known from the islands of Sumatra and Java (Indonesia), Borneo (Indonesia and Malaysia only), the island of Sulawesi (Indonesia), the island of Timor (East Timor and Indonesia), the Talaud Islands (Indonesia) and Ternate Island (Indonesia). It might be present on the island of Palawan in the Philippines, but this requires confirmation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"
Global distribution

Sri Lanka, India, Malaysia, Phillippines, Borneo, Sumatra, Sulawesi and Talaud Islands and adjacent small islands

Known presence in Protected Areas

India Nagarahole National Park, Kalakkad-Mundanthurai Tiger Reserve Sri Lanka Hakgalla National Park

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Cynopterus brachyotis is distributed in Sri Lanka, the Andaman and Nicobar Islands, southern Burma, Thailand, southern China, Indochina, Malay Peninsula, Sumatra, Java, Kangean Islands, Borneo, Bali, Sulawesi, and the Philippines.

Biogeographic Regions: oriental (Native ); oceanic islands (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This species of fruit bat is found across Southerna dn Southeast Asia, from Sri Lanka to Indonesia and the Philippines. It has many subspecies that vary in size and colouration: Cynopterus brachyotis altitudinis (Cameron Highlands of Peninsular Malaysia) (3); Cynopterus brachyotis brachyotis (Borneo, Lombok, Peninsular Malaysia, the Philippines, Sulawesi) (4); Cynopterus brachyotis brachysoma (Andaman Islands) (4); Cynopterus brachyotis ceylonensis (Sri Lanka) (4); Cynopterus brachyotis concolor (Enganno Island) (3); Cynopterus brachyotis hoffeti (Vietnam) (3); Cynopterus brachyotis insularum (Kangean Island) (3); Cynopterus brachyotis javanicus (Java) (3); Cynopterus brachyotis minutus (Nias Islands) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Arboreal, solitary and in small colonies."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Cynopterus brachyotis has a fox-like face, large dark eyes, short brown hair, and dark, spotted wings.

The length of the head and body in this genus is 70 to 127 mm. The tail adds an additional 6 to 15 mm to the overall length. The forearms of these bats are from 55 to 92 mm long, giving them a wingspan ranging from 305 to 457 mm. Adults weigh about 30 to 100 grams.

Cynopterus brachyotis is distinguishable from C. sphynx in that the ears of C. brachyotis are, on average, smaller than those of C. sphynx.

Range mass: 30 to 100 g.

Range length: 70 to 127 mm.

Range wingspan: 305 to 457 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Average basal metabolic rate: 0.262 W.

  • Andersen, K. 1912. Catalogue of the Chiroptera in the Collection of the British Museum: second edition. New York: Johnson Reprint Corporation.
  • Schultes, D. 2003. "The Malaysian Fruit Bat" (On-line). Animals at the Fort Worth Zoo. Accessed December 15, 2001 at http://www.whozoo.org/students/dansch/fruitbat.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species can be found from habitats ranging from orchards, gardens to forested tracts. It roosts in palms especially seed clusters of palms either solitary or in small groups of a few individuals in rural and urban landscapes and in forested areas. Bears a single young after a gestation period of 105-120 days (Bates and Harrison 1997). In South Asia, the species is believed to be more restricted to higher elevations when compared to C. sphinx, making it specifically a hill forest species.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"
Habitat

Urban areas, forests.

Niche

Palm-foliage. Up to 2000m.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cynopterus brachyotis is phytophilic (plant-loving). It can be found in tropical rainforests sleeping under modified palm leaves, as well as orchid leaves.

Habitat Regions: tropical

Terrestrial Biomes: rainforest

  • Crichton, E., P. Krutzsch. 2000. Reproductive Biology of Bats. San Diego, CA: Academic Press.
  • Richarz, K., A. Limbrunner. 1993. The World of Bats. Neptune City, NJ: TFH Publications, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The lesser short-nosed fruit bat occurs in many different habitats, from pristine primary rainforests, to oil palm plantations, gardens and mangroves (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Cynopterus brachyotis is frugivorous. These bats feed on fruit, mostly mangoes, but also any fruit that is aromatic and available. They are thought to consume mainly the juices of the fruits and to expel the pulp.

Plant Foods: fruit

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Many fruits (bananas, avocadoes, dates, mangoes, peaches, tequila) rely on C. brachyotis for seed dispersal. These bats may also play a role in plant pollination.

Ecosystem Impact: disperses seeds; pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Ability to fly has kept C. brachyotis relatively free from terrestrial carnivores. However, in some cultures, humans consider them a delicacy.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Cynopterus brachyotis communicates using tactile, visual, and acoustic stimuli. They use their acute sense of smell to find food and rely on their keen vision to navigate.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Gestation time unknown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Cynopterus brachyotis lives about 20 to 30 years.

Range lifespan

Status: wild:
20 to 30 years.

Average lifespan

Status: captivity:
10.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.1 years (captivity) Observations: One specimen was still alive after 10.1 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The mating system of these animals has not been described. However, based on the association of one male with multiple females, it is most likely polygynous.

Mating System: polygynous

In the Malay Peninsula, breeding is apparently aseasonal, and C. brachyotis may be found pregnant throughout the year. In Thailand breeding is also aseasonal; pregnancies peak from March to June, as well as in January and September. Gestation is thought to last about 120 days, after which the female gives birth to a single young.

Although data are not available for this species, C. sphinx is reported to weigh 11 grams at birth. Neonates are carried by the mother, and are weaned at 40 to 45 days of age. Female C. sphinx reach sexual maturity at 5 to 6 months of age, with males maturing much later, at 15 to 20 months of age. It is likely that C. brachyotis is similar in these parameters.

Reproduction in C. brachyotis is timed so that lactation corresponds with the peak of the rainy season--which is the fruiting season.

Breeding interval: It is not known how often these animals breed.

Breeding season: These bats breed aseasonally.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Average gestation period: 120 days.

Average weaning age: 45 days.

Range age at sexual or reproductive maturity (female): 5 to 6 months.

Range age at sexual or reproductive maturity (male): 15 to 20 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Average number of offspring: 1.

Young can cling to the mother from birth, but must be carried for over a month. Both the male and female care for the young. Males have mammary glands that are equal in size to the females’ (greater than 8% of total body mass), so males are thought to play an active role in lactation and feeding young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Crichton, E., P. Krutzsch. 2000. Reproductive Biology of Bats. San Diego, CA: Academic Press.
  • Nowak, R. 1997. "Cynopterus" (On-line). Walker's Mammals of the World Online. Accessed November 16, 2001 at http://www.press.jhu.edu/books/walker_gone.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cynopterus brachyotis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTGTACCTTCTATTCGGCGCTTGAGCTGGAATAGTTGGCACCGCCCTTAGTCTACTGATTCGAGCAGAACTTGGCCAACCAGGTGCACTATTAGGGGACGACCAAATTTATAATGTTATCGTAACAGCCCACGCATTTGTAATAATCTTCTTCATGGTAATACCTATTATAATTGGAGGGTTTGGAAATTGACTGATTCCTCTAATAATTGGCGCTCCGGACATAGCTTTCCCTCGAATAAACAATATGAGTTTCTGACTCCTCCCTCCCTCTTTCCTACTCCTGCTGGCCTCCTCAACAGTAGAGGCCGGCGCCGGAACCGGGTGAACAGTTTATCCCCCTCTAGCTGGTAATTTAGCCCACGCAGGAGCCTCAGTGGACCTGGCAATCTTCTCTCTACACCTGGCCGGAGTCTCATCCATTTTGGGGGCCATCAACTTTATTACAACAATCATCAATATAAAACCACCAGCTCTATCCCAGTATCAAACCCCCTTATTTGTTTGATCAGTTCTAATCACTGCTGTATTACTTCTCCTCTCCCTTCCAGTTCTAGCCGCTGGCATCACAATACTACTTACAGATCGAAATCTGAACACTACTTTTTTTGACCCTGCCGGAGGAGGAGACCCAATTCTATATCAACACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cynopterus brachyotis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 71
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Csorba, G., Bumrungsri, S., Francis, C., Bates, P., Gumal, M., Kingston, T., Molur, S. & Srinivasulu, C.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Cox, N. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern because, although it is seldom recorded, it has a relatively wide distribution, is tolerant of a broad range of habitats, has a presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cynopterus brachyotis is not especially threatened.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Lower Risk – least concern (LR/lc) on the IUCN Red List 2004 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In northeast India, the population is stable and it is common but not as abundant as Cynopterus sphinx (Tarapada Bhattacharyya pers. comm. June 2005), while in southern India it is rare (C. Srinvasulu pers. comm. September, 2007). In Southeast Asia, it is generally locally abundant and most common in disturbed and residential areas, however, is locally rare in Peninsular Malaysia and Thailand (Campbell et al. 2004).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not known
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species as a whole. In South Asia, this species is locally threatened by deforestation, generally resulting from logging operations and the conversion of land to agricultural and other uses (Molur et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Habitat loss, timber, deforestation. Threats well understood, reversible but have not ceased."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The current decline in many populations of the lesser short-nosed fruit bat is due to deforestation of primary and secondary forests for timber and palm oil plantations. Loss of habitat is a threat to the vast majority of Southeast Asian bat species, as even protected areas of forest are felled to create land for crops, plantations, and villages. Fruit bats are also commonly persecuted by fruit farmers for the damage they do to their yield, although the importance of fruit bats in pollinating crops is often underestimated (1) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Other than further taxonomic studies, no conservation actions are currently needed for the species as a whole. It is present in many protected areas throughout its range. In South Asia, this species like most other fruit bats in India is considered a vermin under Schedule V of the Indian Wildlife (Protection) Act. The species has been recorded from protected areas in India like Nagarhole National Park in Karnataka and Kalakkad-Mundunthurai Tiger Reserve in Tamil Nadu, and in Hakgalla National Park in Sri Lanka.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Deforestation of primary forest for oil palm plantations, including within protected areas, is an issue of major concern and one that relies on both governmental action and consumer concern. Some large retailers have agreed, in collaboration with the WWF, to source products containing palm oil from plantations that are not on deforested land (8). Many scientific and charitable groups contribute to bat monitoring and local education programmes that can help to reduce persecution and raise awareness of the natural assets of the land (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Because of their frugivorous inclination, these bats can cause some crop damage.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Outside of the limited use of these bats as food, there is no direct economic benefit of this species for humans. However, because they are so important in dispersing seeds and pollinating plants, humans who rely on the plants these bats affect are indebted to the bats as well.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Risk Statement

Habitat status

Decrease in area and quality of habitat due to felling of trees.

Data quality

General field study; observed.

Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lesser short-nosed fruit bat

The lesser short-nosed fruit bat (Cynopterus brachyotis) is a species of megabat within the family Pteropodidae.[2] It is a small bat that lives in South and Southeast Asia and Indonesia (Borneo). It weighs between 21 and 32 grams (0.74 and 1.13 oz). It occurs in many types of habitat, but most frequently in disturbed forest, including lower montane forest and tropical lowland rainforest, plus gardens, mangroves, and vegetation on beaches.[3]

Description[edit]

Lesser short-nosed fruit bats are generally brown to yellowish brown with a brighter collar. Adult males have dark orange collars whereas adult females have yellowish collars. An indistinct collar is observed in some immature bats. The edges of the ears and the wing bones are usually white. Individuals have two pairs of lower incisors, a fox-like face and large dark eyes.[4] The forearm length is 55–65 mm (2.1–2.6 in), tail length is 8–10 mm (0.3–0.4 in), and ear length is 14–16 mm (0.5–0.6 in).[3]

There are nine subspecies of lesser short-nosed fruit bat.[5] Corbet and Hill listed 19 alternate names of C. brachyotis, which include: Pachysoma brachyotis, P. duvaucelii, P. brevicaudatum, P. luzoniense, C. grandidieri, C. marginatus var. scherzeri, C. marginatus var. ceylonensis, C. marginatus var. philippensis, C. marginatus var. cuminggii, C. marginatus var. andamanensis, C. brachyoma, C. montanoi, C. minutus, C. minor, C. babi, C. archipelagus and C. nusatenggara. Kitchener and Maharadatunkamsi considered luzoniensis and minutus as separate species while Hill and Thonglongya[6] transferred angulatus to C. sphinx.

The lifespan of the lesser short-nosed fruit bat is approximately 20 to 30 years.[7]

The bat is known as හීන් තල වවුලා (heen thala wawula) in Sinhala.

Similar species[edit]

The greater short-nosed fruit bat is similar to the lesser short-nosed fruit bat but has generally longer forearms, longer ears and a much longer skull. P. lucasi has only one pair of lower incisors, a lack of white edges to the ears and a usually greyer color. C. horsfieldi is larger, with heavily cusped molars. M. ecaudatus usually has a more upturned nose, lacks a bright collar and tail, and has only one pair of lower incisors.[3]

Diet[edit]

Lesser short-nosed fruit bats are frugivorous. They prefer aromatic fruit, especially mangoes.[7] The bats feed mainly on small fruits by sucking out the juices and soft pulp. They also eat nectar and pollen.[3]

Reproduction[edit]

The mating system of lesser short-nosed fruit bats is polygynous.[4] In the Philippines, most populations give birth twice a year and pregnant females have been found in almost all months. The period of gestation is approximately 3.5 to 4 months. The mother nurses the young with milk for about six to eight weeks. It takes about a year for the male to become sexually mature, and most females become pregnant at approximately six to eight months of age. Medway observed that breeding was non-seasonal in Peninsular Malaysia and that a single young was produced and carried by the female during the early stage of its life. Breeding is also non-seasonal in Thailand.[8] Most pregnancies occur from March to June with peaks in January and September.[9] Lactation corresponds with the peak of the rainy season as well as the fruiting season. Both sexes take care of the young. Males play an active role in lactation and feeding the young. They have mammary glands that are same size as the those of the female and exceed 8% of their overall body mass.[7]

Behavior[edit]

Lesser short-nosed fruit bats resting on a clothesline after being released. The white spots on the tops of their heads are hair that was bleached for a "mark-recapture" estimate of the local population size.

Lesser short-nosed fruit bats prefer to roost in small groups in trees, under leaves, and in caves. Young males may roost alone. It is common for one male to roost with up to four females. Females may gather in groups of up to 20.[10] To feed, the bats bite off the center part of palm fruit clusters, leaving a hollow for hanging, which is also the method they use to construct a shelter. Males may spend more than two months chewing the veins of leaves and palm fronds until they fall to form a shelter.[4] Individuals use tactile, visual, and acoustic stimuli to communicate. They forage with their acute sense of smell and navigate with their keen vision.[7]

Distribution and habitat[edit]

A newborn

The lesser short-nosed fruit bat[11] type specimens were collected from the Dewei River in Borneo on September 12, 1836, and at Naga Cave near Jammut on the Teweh River, Borneo.

They are widely distributed in Sri Lanka, southwest and northeast India, Bangladesh, Andaman and Nicobar Islands, southern China, southern Burma, Indochina, Thailand, the Malay Peninsula, Sumatra, Java, Bali, Sulawesi, the Philippines and also on the Lesser Sunda Islands. They are found from sea level up to 1600 m in Borneo.[8][12][13][14][15] The nominate subspecies,[3] C. b. brachyotis, is distributed in Borneo, Lombok, Peninsular Malaysia, the Philippines and Sulawesi. It is found widespread from sea level to 1,600 meters in altitude. C. b. altitudinis is confined to the highlands of Peninsular Malaysia, from the Cameron Highlands to Gunung Bunga Buah. C. b. brachysoma is found on the Andaman Islands; C. b. cylonensis in Sri Lanka; C. b. concolor in Enggano; C. b. hoffetti in Vietnam; C. b. insularum on the Kangean Islands; C. b. javanicus on Java; and C. b. minutus on Nias.[5]

Ecological and economic importance[edit]

Lesser short-nosed fruit bats are free of terrestrial predation because of their ability to fly. Some human cultures consume them as a delicacy.[4] They play important roles in plant pollination. Plants such as bananas, avocados, dates, mangoes, peaches, and Agave tequilana depend on them for seed dispersal. The bats are considered to be crop pests since they consume and damage fruit.[16]

Conservation status[edit]

Lesser short-nosed fruit bats are designated a least-concern species by the International Commission on Zoological Nomenclature (ICZN) because the population is widely distributed, stable and still abundant. Possible threats may be habitat loss due to development, dams, and deforestation. The animals are being hunted for medical purposes, as reported in ICZN 2006.[17]

References[edit]

  1. ^ Csorba, G., Bumrungsri, S., Francis, C., Bates, P., Gumal, M., Kingston, T., Molur, S. & Srinivasulu, C. (2008). "Cynopterus brachyotis". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved 2013-10-15. 
  2. ^ Simmons, N. B. (2005). "Order Chiroptera". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 316. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ a b c d e Payne, J., C. M. Francis, and K. Phillips. (1985). A Field Guide to The Mammals Of Borneo. Malaysia: The Sabah Society. p.173.
  4. ^ a b c d Nowak, R. (1997). Cynopterus. (On-line). Walker's Mammals of the World Online. Accessed January 09, 2009.
  5. ^ a b Mickleburg, S. P., A. M. Hutson, and P. A. Racey. 1992. Old world fruit bats: an action plan for their conservation. IUCN/FFPS/ZSL/WWF/JWPT/NWF/Sultanate of Oman.
  6. ^ Hill JE, Thonglongya K. 1972. Bats from Thailand and Cambodia. Bulletin British Museum of Natural History (Zoology) 22:171–196.
  7. ^ a b c d Crichton, E. and P. Krutzsch. (2000). Reproductive Biology of Bats. San Diego, CA: Academic Press.
  8. ^ a b Lekagul B. and J. A. McNeely. 1977. Mammals of Thailand. Sahankarnbhat, Bangkok.
  9. ^ Nowak, R.(1999). Walker’s Mammals of the World (6th Ed.).Vol. 1. Baltimore and London: The Johns University Press. pp.286–287.
  10. ^ Richarz, K. and A. Limbrunner. (1993). The World of Bats. Neptune City, NJ: TFH Publications, Inc.
  11. ^ animaldiversity.ummz.umich.edu
  12. ^ Medway, L. 1978. The Wild Mammals of Malaya (Peninsular Malaysia) and Singapore. Oxford University Press, Kuala Lumpur.
  13. ^ Bergmans, W. and F. G. Rozendaal. 1988. Notes on collections of fruit bats from Sulawasi and some off-lying islands (Mammalia, Megachiroptera). Zoologische Verhandelingen 248:1–74.
  14. ^ Corbet, G. B. and J. E. Hill. 1992. The Mammals of the Indomalayan Region: A Systematic Review. Oxford University Press.
  15. ^ Peterson, A. T. and L. R. Heaney. 1993. Genetic differentiation in Philippines bats of the genera Cynopterus and Haplonycteris. Biological Journal of the Linnean Society 49:203–218.
  16. ^ Schultes, D. 2003. The Malaysian Fruit Bat. (On-line). Animals at the Fort Worth Zoo. Accessed January 09, 2009.
  17. ^ Duan'erQuanfu. Cynopterus brachyotis, Lesser Short-nosed Fruit Bat. Accessed January 09, 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!