Overview

Brief Summary

Biology

Within their large camps, little red flying foxes roost in close proximity and in tight clusters, often causing large limbs of rainforest trees to snap off under the sheer weight of so many bats on a single branch (8)! During the breeding season between November and January (the Australian late spring, early summer) males establish territories within these roosts, from which they actively defend a harem of two to five females from other males (3) (4). After mating, females establish small groups consisting exclusively of females, which are maintained until young are born five months later in April to May (3). Females carry their young during flight for the first four to six weeks of life, after which the infant is left at the roost while they forage at night. At two months, young will move and fly around between the trees within the camp (4). Sexual maturity is typically reached between 18 months and 2 years of age (3). This nectar specialist primarily feeds on the nectar and pollen of eucalyptus blossoms (4) (7), although the diet also includes flowers, fruit, growing shoots, bark, sap and insects and fruit orchards are occasionally raided when food is scarce, much to the irritation of farmers (2) (4). Little red flying foxes may fly over 80 km a night visiting different trees (7) and, like other flying foxes, use their excellent sense of sight and smell to find their food (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

As its common name suggests, the little red fox has a conspicuously reddish tinge to its fur and is one of the smallest of the Pteropus species (4) (6). The fur on the head is often grey and the leathery wings are reddish-brown and appear semi-translucent in flight (4) (7). This species is an efficient climber, using its jointed thumbs and its feet to clamber with great agility about the branches of a tree (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is widespread in western, eastern, and northern Australia (including Boigu and Thursday Islands in the Torres Strait), and is also known from a single collection of four skulls from Western Province, Papua New Guinea (Bonaccorso 1998; Helgen 2004; Birt et al. 2008). Vagrants occur to the south of the main range, including to Kangaroo Island. It ranges from sea level to 300 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Little red flying foxes (Pteropus scapulatus) are primarily found in Australia and have the largest distribution of any other member of the genus Pteropus within Australia. Occasionally, these bats have been seen as far away as Papua New Guinea. There has also been one sighting of an individual in New Zealand. Although little red flying foxes occur throughout Australia, they are particularly abundant in northern Australia.

Biogeographic Regions: australian (Native ); oceanic islands (Native )

  • Daniel, J. 1975. First record of an Australian fruit bat (Megachiroptera: Pteropodidae) reaching New Zealand. New Zealand Journal of Zoology, 2: 227-231.
  • Hall, S. 1987. Identification, distribution and taxonomy of Australian flying foxes (Chiroptera: Pteropodidae). Aust. Mamm, 10: 75-79.
  • Waithman, J. 1979. A report on a collection of mammals from southwest Papua, 1972- 1973. Aust. Zool, 20: 213-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found throughout Australia in Queensland, the Northern Territory, Western Australia, New South Wales and Victoria, but particularly abundant in the north (2) (3). Occasionally individuals have been seen as far away as Papua New Guinea, and there has also been one sighting of an individual in New Zealand (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Little red flying foxes are medium-sized bats. The average wingspan of P. scapulatus males varies from .9 to 1.2 m. Weights of these males can can reach 550 g. There is no relevant literature available pertaining to body length and basal metabolic rate of P. scapulatus. However the body length of black flying foxes (Pteropus alecto) is known to range from 240 to 260 mm.

After winter solstice, the testicular size and body weight of males increase.

Range mass: 550 g (high) g.

Range wingspan: 0.9 to 1.2 mm.

Average wingspan: 1.0 mm.

Sexual Dimorphism: male larger

Average basal metabolic rate: 1.353 W.

  • O’Brien, M. 1993. Seasonal reproduction in flying foxes, reviewed in the context of other tropical mammals. Journal of Reproduction and Fertility, 5: 499-521.
  • McGuckin, A., W. Blackshaw. 1991. Seasonal changes in testicular size, plasma testosterone concentration and body weight in captive flying foxes (Pteropus poliocephalus and Pteropus scapulatus). Journal of Reproduction and Fertility, 92: 339-346.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in sclerophyll woodland, paperbark, bamboo, mangroves, and occasionally in orchards. Also found in ornamental trees (M. Pennay pers. comm.). Roosting sites can contain over a million individuals (Birt et al. 2008). It is a very nomadic species (Birt et al. 2008). Females give birth to a single young (Bonaccorso 1998).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Little red flying foxes occur throughout coastal regions as well as arid landscapes of inland Australia. Limited knowledge from recent studies suggests that these bats often congregate at camps in riparian habitat, such as fresh/saltwater mangroves, bamboo, and closed forests. Selection of such congregation sites may be determined by seasonal variation, as well as by other factors; such as human hunting, natural catastrophe regimes, and climatic fluctuations.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest

Wetlands: swamp

Other Habitat Features: agricultural ; riparian

  • Tidemann, C., M. Vardon, A. Loughland, P. Brocklehurst. 1999. Dry season camps of flying foxes (Pteropus spp.) in Kakadu world heritage area, north Australia. Journal of Zoology London, 247: 155-163.
  • Sinclair, E., N. Webb, C. Tideman. 1996. Variation in the little red flying-fox, Pteropus scapulatus (Chiroptera: Pteropodidae): implications for management. Biiol. Conser., 76: 45-50.
  • Webb, N., C. Tidemann. 1999. Hybridization between black (Pteropus alecto) and grey-headed (P. poliocephalus) flying-foxes (Megachiroptera: Pteropodidae). Aust. Mamm, 18: 19-26.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

During the day, colonies known as 'camps' can sometimes have as many as one million bats. The little red flying fox roosts in the trees of a broad range of habitats including eucalypt forests, woodland, paperbark swamps, mangroves and bamboo thickets (4). This species is nomadic, venturing from coastal to rainforest to dry inland areas (8), following the seasonally varying flowering and fruiting cycles of different trees (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Little red flying foxes are known to primarily feed on blossoms of eucalyptus trees. However, it is currently uncertain what the importance of eucalyptus foliage is in their diet. It has been suggested that Pteropus species obtain high amounts of calcium from calcium-rich vegetation such as eucalyptus. There is some suggestion that P. scapulatus follows the foraging resources of eucalyptus blooms throughout the landscape. No other information pertaining to the foraging habits of little red flying foxes is currently available.

Plant Foods: fruit; nectar; flowers

Primary Diet: herbivore (Folivore , Frugivore )

  • Barclay, R. 2002. Do plants pollinated by flying fox bats (Megachiroptera) provide and extra calcium reward in their nectar?. Biotropica, 34/1: 168-171.
  • Marshall, G. 1985. Old World phytophagus bats (Megachiroptera) and their food plants: a survey. Zool. J. Linn, 83: 351-369.
  • Richards, C. 1995. A review of ecological interactions of fruit bats in Australian ecosystems. Symp. Zool. Soc. of Lond, 67: 79-92.
  • Funakoshi, K., H. Watanabe, T. Kunisaki. 1993. Feeding ecology of the northern Ryuku fruit bat, Pteropus dasymallus dasymallus, in a warm-temperate region. Journal of Zoology London, 230: 221-230.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Little red flying foxes are important for the pollination and seed dispersal of native flora within Australia.

Ecosystem Impact: disperses seeds; pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Limited information is available on the predators of Pteropus species. In many states throughout Australia, P. scapulatus is considered a pest, and  is subject to large-scale hunting and poisoning by humans.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Species within Pteropus are frugivores and do not echolocate. No information on the communication of P. scapulatus is available; however, generally Pteropus species are known to communicate with loud vocalizations. While roosting, vocalizations are emitted by adults and juveniles at frequencies that are audible to the human ear. Communication by such vocalizations occurs during agonistic behaviors, escaping agonistic behaviors, and by females when males attempt to copulate with them. Vocalizations by juveniles help mothers identify their young after foraging.

In addition to vocal communication, tactile communication is important between mates and between mothers and their offspring.

Chemical communication is important in some species of Pteropus, especially in helping males mark territories during breeding season. Although this behavior has not been reported for this species, it is possible that similar scent cues are used.

The role of visual signals, such as body postures, has not been investigated.

Communication Channels: tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

No information is available on the life span of this species. However, other members of the genus are reported to have lived as long as 30 years in captivity. As flying mammals typically have lifespans longer than expected based solely upon their body size, it is likely that P. scapulatus has a similarly long lifespan.

Average lifespan

Status: captivity:
15.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.8 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Females and males congregate in large camps, especially during the 2-month mating season and during the 5 months of lactation. As many as 1 million individuals are known to congregate at a single camp.

Studies suggest that most females are associated with males in harem groups during the mating season. After mating, females establish small groups consisting exclusively of females. These small female groups are maintained until young are born.

Mating System: polygynous

The breeding season of P. scapulatus occurs between the Australian spring months of November and December. It and appears to be regulated by circannual endogenous rhythms. Young are born 5 months later in April to May. Many species in the genus Pteropus undergo delayed implantation, so it is possible that the actual time of development is not as long as the gestation period indicates. Lactation in this genus lasts between 3 and 6 months, although data are not available on its duration for P. scapulatus. Sexual maturity is typically reached between 18 months and 2 years of age.

Breeding interval: These bats breed once yearly.

Breeding season: Breeding occurs in November and December.

Average number of offspring: 1.

Range gestation period: 4 to 5 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; delayed implantation

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
540 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
540 days.

Young bats are not able to fly from birth, and so may be called altricial. In some Pteropus species, the mother carries her young with her for a few months. There are no data on this behavior P. scapulatus. Lactating Pteropus females raise their young close to adult size before they are weaned. Females must contribute close to all of the calcium that is required to the developing skeletal system of the offspring. As a consequence, females often suffer from osteoporosis. Females with osteoporosis have a greater chance of breaking bones necessary for flight. Without the ability to fly, there is a high probability that females with broken limbs will die from starvation.

There are no data available on the role of males in parental care.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • O’Brien, M. 1993. Seasonal reproduction in flying foxes, reviewed in the context of other tropical mammals. Journal of Reproduction and Fertility, 5: 499-521.
  • O’Brien, M., F. Nankervis. 1994. Coital behavior of male Pteropus scapulatus (little red flying foxes) in captivity. Physiological and Behavior, 56: 471-477.
  • O’Brien, M. 1996. Comparative Morphology of the Pituary Gland in Australian Flying Foxes (Megachiroptera: Genus Pteropus). Journal of Reproduction and Fertility, 244(1): 70-77.
  • Nelson, S. 2001. Nutritional landscape ecology of Pteropus tonganus in American Samoa. Bat Research News, 42/4: 172.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pteropus scapulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0552-06|NC_002619|Pteropus scapulatus| AATCGTTGACTCTTTTCAACCAACCACAAAGATATTGGTACTTTATATCTACTATTCGGCGCTTGAGCCGGTATAGTCGGGACCGCCCTA---AGCCTGTTAATCCGGGCGGAACTGGGCCAACCAGGGACCCTCCTAGGCGAC---GACCAAATTTACAACGTAATCGTAACAGCCCATGCATTTGTAATAATCTTCTTTATGGTTATGCCAATCATAATCGGAGGCTTCGGGAACTGACTTGTACCACTAATG---ATTGGAGCCCCAGATATGGCATTCCCCCGAATAAACAATATAAGCTTTTGACTTCTACCTCCATCATTCCTACTGCTACTAGCCTCATCAACGGTAGAAGCTGGCGCTGGAACAGGATGAACAGTGTATCCACCTCTAGCGGGCAATCTAGCACATGCCGGGGCCTCAGTAGACCTA---GCAATTTTCTCACTCCATTTGGCTGGTATTTCATCAATCCTAGGCGCCATTAATTTCATTACTACCATTATCAATATAAAACCTCCGGCTTTATCACAGTATCAAACCCCCCTATTCGTCTGATCCGTCCTAATTACAGCTGTCCTGCTTCTTCTATCCCTGCCAGTACTAGCCGCC---GGAATCACAATACTGCTAACAGACCGTAATCTAAACACAACATTCTTCGACCCCGCAGGAGGAGGGGACCCCATTCTATATCAACATCTATTTTGATTCTTCGGACACCCAGAAGTATATATTCTTATTCTCCCAGGATTCGGAATAATTTCACATATTGTCACCTATTATTCTGGTAAAAAA---GAACCATTTGGATATATAGGCATAGTATGAGCCATAATATCAATCGGATTCCTCGGCTTTATCGTATGGGCCCACCACATATTTACTGTAGGTATGG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pteropus scapulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hall, L. & McKenzie, N.

Reviewer/s
Lamoreux, J. (Global Mammal Assessment Team), Racey, P.A., Medellín, R. & Hutson, A.M. (Chiroptera Red List Authority)

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, large population, and because it is not believed to be declining.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Pteropus scapulatus is considered common, and is legally protected in Australia. This species does not qualify for endangered, threatened, or vulnerable status and is considered a taxon of least concern.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a common species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species. It is locally threatened in parts of its range by clearance of suitable forest habitat. The species occasionally damages fruit crops, although it is not a serious pest (Birt et al. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Like other Australian flying foxes, the little red flying fox is vulnerable to loss of suitable feeding and roosting sites due to clearance of native vegetation by forestry operations and for agriculture and urban development (10). In many states across Australia, flying foxes are considered orchard pests and in the past have been subjected to large-scale hunting and poisoning by farmers (3). An additional threat claiming the lives of hundreds of little red flying foxes and other wildlife is ensnaring on barbed wire fences, which are almost institutionalised in beef and dairy farming. At sunrise, returning bats often fly low to the ground to reduce wind resistance and many do not see the barbed wire fences until it is too late. The barbs puncture the delicate membrane of the bats' wings, and the frantic victims' struggles only cause further entanglement, while attempts to chew the wire to free themselves often mean the animal gets caught further by its mouth. The wings become torn, the fine wing bones smashed and, frequently, the upper palate is punctured or completely fractured. Unless rescued by humans, death is swift, and at least 40% of those recovered in time are too badly damaged to be released back into the wild (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix II of CITES. It is present in some protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Since most of the bats are snared on the top strand of the barbed wire fence, it has been advocated that the top strand should be replaced with smooth, galvanised wire as an obvious solution to the problem (7). Fortunately, the little red flying fox remains common in Australia, where it is legally protected, and is not considered endangered (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In regions of fruit production, this species is considered a pest because of its tendency to feed upon agricultural crops.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Pteropus scapulatus contributes to the pollination of plants that are important for humans, including trees used for lumber, food, and medicine.

Positive Impacts: pollinates crops

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Little Red Flying Fox

The Little Red Flying Fox (Pteropus scapulatus) is a species of megabat native to northern and eastern Australia.[2] With a weight of 280–530 grams (9.9–19 oz) it is the smallest flying fox in mainland Australia (the others being the Black, Spectacled and Grey-headed flying foxes). It has the widest range of all the species, going much further inland than the larger fruit bats. Its diet primarily consists of nectar and pollen of eucalypt blossoms, the pollination of which it is largely responsible. The Little Red Flying Fox is nomadic, and can be found in large groups of up to a million individuals. This species births 6 months later than the other mainland flying-fox species, giving birth in April - May [3].

Contents

Public Perception

Hanging in a close group

This species of flying fox hangs in a different way to other mainland species. The larger species tend to hang an arm length apart; however, the Little Reds tend to clump together so that the bats may hang in groups of 20 or more animals on an individual branch. This is shown on a small scale in the image on this page. For this reason the animals are associated with significant canopy and branch damage in camps where they reside. They also tend to appear in very large numbers (20,000 or more) and the 'foot print' of a camp can expand rapidly for the several weeks or months they remain at a site. Their large numbers and the damage they cause to a camp site mean they are not very popular animals.

Negative public perception of the species has intensified with the discovery of three recently emerged zoonotic viruses that are potentially fatal to humans: Hendra virus, Australian bat lyssavirus and Menangle virus.[4]

Conservation

The animals are nomadic and difficult to track as they tend not to live in urban areas. There is no accurate method in use currently of estimating the species to determine if the species is holding its own or in decline. The species is very likely to be affected by the same factors that have seen the Grey-headed flying-fox and Spectacled flying-fox listed as threatened, that is the destruction of foraging areas and roosting habitat [5].

Footnotes

  1. ^ Hall, L. & McKenzie, N. (2008). "Pteropus scapulatus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/18758. Retrieved 31 December 2011. 
  2. ^ Simmons, Nancy B. (16 November 2005). "Order Chiroptera". In Wilson, Don E.; Reeder, DeeAnn. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 344. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=13800366. 
  3. ^ "Little red flying-fox" accessed 3 July 2011
  4. ^ Speare, Rick et al (1997), p. 117.
  5. ^ "Little red flying-fox" accessed 3 July 2011

References

  • Speare, Rick, et al. (1997). "Australian bat lyssavirus infection in three fruit bats from north Queensland." Comm Dis Intell 1997; 21:117-120. Downloadable pdf at: [1]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!