Overview

Distribution

Gulf of St. Lawrence (unspecified region), southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway), lower North Shore, Laurentian Channel (bathyal zone)(=Esquiman Channel); western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

European waters (ERMS scope), Gulf of Maine, North West Atlantic, Oostende, Polish Exclusive Economic Zone, Romanian Exclusive economic Zone, Ukrainian Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Female: Shell semi-round in shape and covers only the brood chamber, leaving all appendages free. Head is tilted forward. Swimming antennae are biramous; one ramus is three-segmented with 6 setae (formula 1,1,4), the other ramus is 4-segmented also with 6 setae (formula 0,1,1,4). Postabdomen is not as short as in other species of Podon, with long sharp claws, which are covered with small setae. Caudal setae short, do not reach the end of the abdominal claws.
Male: Shell more elongate than in female. Head larger, than in female. The distal segment of leg 1 carries a claw and 2 long setae. The postabdomen is directed toward the back (down in female). Length up to 1 mm.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Ershova, Elizaveta

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length up to 1 mm.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Ershova, Elizaveta

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body transparent, with a gray-yellow or greenish tint.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Ershova, Elizaveta

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

epipelagic, glacial and superficial
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 518 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0 - 58
  Temperature range (°C): -1.388 - 13.494
  Nitrate (umol/L): 0.306 - 10.334
  Salinity (PPS): 18.224 - 32.706
  Oxygen (ml/l): 6.492 - 8.662
  Phosphate (umol/l): 0.081 - 1.462
  Silicate (umol/l): 6.395 - 30.437

Graphical representation

Depth range (m): 0 - 58

Temperature range (°C): -1.388 - 13.494

Nitrate (umol/L): 0.306 - 10.334

Salinity (PPS): 18.224 - 32.706

Oxygen (ml/l): 6.492 - 8.662

Phosphate (umol/l): 0.081 - 1.462

Silicate (umol/l): 6.395 - 30.437
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Neritic species. Is often found in large numbers in surface waters.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Ershova, Elizaveta

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Podon leuckartii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGAATACTCATTCGGGCTGAGTTAGGACAAGCAGGAAGCTTGTTAGGAGAT---GATCAGTTATATAATGTCATTGTTACAGCACACGCTTTTATTATAATTTTCTTTATAGTTATACCCATTATAATTGGAGGGTTCGGAAATTGACTTGTACCTTTAATA---TTAGGGGCACCGGATATAGCGTTCCCTCGACTTAATAATCTAAGTTTTTGATTTCTACCCCCAGCTTTAACGCTCCTTCTCGCAGGAGGGATAGTAGAAAATGGAGCAGGTACTGGATGAACTGTGTACCCGCCGCTATCTGCAGGTATCGCTCATGCCGGAGCATCTGTTGATTTAAGA---ATTTTTGCTCTTCATTTGGCTGGAATCTCTTCGATTCTAGGAGCAATTAATTTTATTACAACTATTGTAAATATACGATCACACGGAATAACACTCGACCGGATTCCCTTATTTGTTTGATCAGTAGGAATCACCGCTCTTTTACTTCTTCTTAGTCTACCTGTATTAGCAGGT---GCCATTACTATACTTTTAACAGATCGTAACCTAAATACTTCATTTTTCGATCCGGCTGGAGGTGGAGATCCGATCCTTTACCAACACTTGTTCTGATTTTTTGGTCACCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Podon leuckartii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Podon leuckarti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNGGTATTTGAGCAGGTATAGTAGGTACCGCATTAAGAATACTCATTCGGGCTGAATTAGGACAAGCAGGAAGCTTATTAGGAGATGATCAATTATATAATGTCATTGTTACAGCACACGCTTTTATTATAATTTTCTTTATAGTTATACCCATTATAATTGGAGGGTTCGGAAACTGACTCGTACCTTTAATATTAGGGGCACCAGATATAGCATTCCCTCGACTTAATAATCTAAGTTTTTGATTTCTACCCCCAGCTTTAACGCTCCTTCTCGCAGGAGGAATGGTAGAAAATGGAGCAGGTACTGGATGAACTGTGTACCCGCCACTATCTGCAGGTATCGCTCATGCCGGAGCATCTGTTGATTTAAGAATTTTTGCTCTTCATTTGGCTGGAATCTCTTCGATTCTAGGAGCAATTAATTTTATTACAACTATTGTAAATATACGATCACACGGAATAACACTTGACCGAATTCCCTTATTTGTTTGATCAGTAGGAATTACCGCTCTTTTACTTCTTCTTAGTCTACCTGTGTTAGCAGGTGCCATTACTATACTTTTAACAGATCGTAACCTAAATACTTCGTTTTTCGATCCGGCTGGAGGTGGAGATCCAATCCTTTACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Podon leuckarti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!