Overview

Brief Summary

Biology

Barbastelle bats emerge at early dusk. They hunt low over water or at tree-top level with fast agile flight (2). They hunt small insects such as flies and moths on the wing (2) but can also glean spiders and insects from plants (3). They only take delicate small prey items, as the mouth has a narrow gape and the teeth are relatively weak (2). In their second year, females become sexually mature, and mating occurs in autumn. The females gather in maternity roosts or nurseries and give birth to one, or rarely two offspring. During this time, males form small groups and live away from the nurseries (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This rare medium-sized bat has a short nose, small eyes and wide ears with a triangular shaped tragus. It has long silky fur, dark brown to black in colour with whitish tips giving the bat a frosted appearance (2). The wings are broad with grey-brown or black-brown membranes, and the tail membrane is extremely large (2). The scientific name Barbastella derives from the Latin for 'star beard' (4) (5); and refers to the delicate beard of frosted white hairs radiating out from the lower lip (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Barbastella barbastellus is distributed over most of Europe. It is also present in the southern half of Britain as well as islands of the Mediterranean, Morocco, and the Canary Islands.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Barbastella barbastellus is largely restricted to central and southern Europe, although its range extends into the Caucasus, Anatolia, Morocco (North Africa) and the Canary Islands (La Gomera and Tenerife only). It occurs to 1,800 m in the Alps (Spitzenberger 2002), 1,900 m in the Caucasus and 2,260 m in the Pyrenees (Mitchell-Jones et al. 1999, K. Tsytsulina pers. comm. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The barbastelle bat is widespread but rare throughout Europe (2) from England east to the Caucasus Mountains (2). In the UK it is restricted to southern England and Wales (7). Only one maternity roost and under 30 hibernation sites are known (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Western Barbastelle is medium sized and has long black pelage with white or yellow tips. The underside of the body is somewhat paler. Fur covers parts of the uropatagium and the wings, and the tail is nearly as long as the body. It is distinguishable among other European bats by its short wide ears that face forward and connect across the brow. The female is significantly larger than the male; combined ranges of measurement are as follows: head and body, 45-60 mm; wingspan, 245-300; tail length, 36-52. (Nowak 1999, Rydell and Bogdanowicz 1997)

Range mass: 6 to 10 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Western Barbastelles typically occupy forested upland areas. During the summer months they are found roosting in domestic dwellings and hollow trees. Their winter hibernation habitat usually consists of fissures in underground structures such as caves and mines with low ambient temperatures and dry air. (Rydell and Bogdanowicz 1997)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Forages in mature woodland, woodland edge (and agricultural edge). Feeds on small moths. Summer roosts: usually older mature woodland with maternity sites in trees (occasionally older buildings). Depends on a large number of old trees to roost in a large part of its range, because individuals change their roosts very frequently and colonies need a large number of roost sites for this reason. Winter: Hibernation may start in trees, but later underground sites are preferred. Usually in smaller numbers (up to 50) in natural caves, but in regions where these are missing in large groups in mines and bunkers. Underground habitats maybe of any type, but usually very cold sites. Recorded in old mines in winter in the Caucasus (K. Tsytsulina pers. comm. 2005). Movements up to 290 km in Austria (Kepka 1960).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mainly a broadleaved woodland species, this bat roosts in old buildings and trees in summer and hibernates in hollow trees, in tunnels (8) or underground. In some areas woodlands close to water may be important (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Moths account for a majority of its diet (73-94% by weight in Germany and Switzerland), and there is an absence of dung beetles or other hard-bodied insects. Evidence suggests a gleaning or aerial-hawking method of hunting, with feeding usually taking place 4-5m above ground. (Rydell et al. 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
21.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23 years (wild) Observations: They stop growing after about 2 months.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Females become sexually mature during their first year of life and give birth to usually one and sometimes two offspring. There is sexual segregation in the summer with fertile females forming colonies of 5-30 females. Mating seems to occur in the late summer and early autumn, but winter mating has been reported in parts of their range. Young are born from May to early August and reach full size in 8-9 weeks. (Rydell and Bogdanowicz 1997, Nowak 1999)

Range number of offspring: 1 to 2.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average number of offspring: 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Barbastella barbastellus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGTATCTTCTATTTGGCGCTTGGGCCGGAATAGTGGGCACTGCCCTAAGTCTATTAATCCGCGCCGAGTTAGGCCAGCCAGGGGCCCTGTTGGGAGACGACCAGATCTACAATGTGATCGTAACTGCCCATGCATTTGTAATAATTTTCTTCATAGTAATACCTATTATAATTGGGGGCTTCGGAAATTGGTTAGTGCCATTGATAATTGGGGCTCCTGATATGGCTTTTCCCCGGATAAATAATATAAGCTTCTGACTACTCCCCCCCTCTTTCCTACTACTATTGGCATCTTCCATGGTGGAGGCAGGGGCAGGCACAGGGTGGACAGTCTATCCGCCATTGGCAGGAAATCTCGCCCATGCGGGGGCCTCTGTTGACCTAGCCATTTTCTCTCTACACCTGGCGGGTGTATCTTCAATTCTAGGAGCAATTAATTTTATTACTACTATTATTAATATAAAACCTCCCGCTCTGTCTCAATACCAGACACCACTATTTGTTTGGTCCGTCCTAATCACAGCAGTCCTCCTCCTACTATCACTTCCCGTTCTGGCTGCCGGAATTACGATATTACTAACGGATCGAAATCTAAATACGACTTTCTTTGACCCTGCAGGAGGGGGGGACCCTATTCTATATCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Barbastella barbastellus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Barbastella barbastellus populations throughout Europe have been declining and it is now listed as vulnerable worldwide. It is disappearing in Western Europe due to the loss of hollow trees, habitat disruption and pollution. It is found only rarely throughout most of its habitat. (Nowak 1999, Stebbings and Griffith 1986)

US Federal List: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hutson, A.M., Aulagnier, S. & Spitzenberger, F.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Although this species has a large range, it is generally rare, occurring in low density and numbers. It is mainly sedentary. The population is fragmented and linked to particular kinds of old forest habitats, which are declining. The species does not easily colonise new areas. Declines are widely reported in most of its range with a few exceptions in recent years. The status of this species is linked to forestry practices and the decline in the number of old trees (one colony may use up to 30 old trees with holes each summer season). Has specific habitat and diet requirements. Listed as Near Threatened (approaching A4c), as it is suspected that population declines will approach 30% over a 15 year period including both the past and the future.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The 2000 IUCN Red List classifies this species as Vulnerable (VU-A2c). European populations are listed under Annex II of The Bonn Convention (1), Annex II of the Bern Convention, and Annexes II and IV of the EC Habitats and Species Directive. In the UK it is protected under Schedule 5 of the Wildlife and Countryside Act 1981, and Schedule 2 of the Conservation Regulations 1994 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A rare or infrequent species. Summer colonies, usually c. 30. Winter clusters usually small (often solitary), but can reach 500 and, rarely, up to 1,000 in France, Poland and over 7,000 in Slovakia (Schober 2004). Extinct in the Netherlands since 1984. Last recorded in Norway in 1949, and possibly extinct there (van der Kooij in litt. 2006). Decreases widely reported. Considered threatened in many range states. Very small numbers in large part of the range with large temporary aggregations in areas without natural caves. Populations increasing in the last 5 years in Germany now that insecticide use has been reduced (D. Kock pers. comm. 2005). Relatively frequent in woodlands in western part of Caucasus and without reported decline; rare in Ukraine (S. Kruskop pers. comm. 2005). In Africa, population size and trends are unknown.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Loss of old mature woodland and ancient trees with loose bark or wood crevices (reforested areas are not suitable for this species); disturbance and loss of underground habitats, disturbance and loss of roost sites in older buildings. In Germany, habitat loss and fragmentation (caused by inter alia infrastructure development, forestry, and the renovation or demolition of old buildings used as roost sites), and disturbance (e.g. from cave tourism) are major threats (Schulenberg 2005); accidental mortality (roadkill) is also a problem (Rudolph et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The UK population is estimated to number around 5000 individuals, the overall trend in numbers is not known (3). The threats to the barbastelle bat are not fully understood (3), however it is very sensitive to disturbance (2). Factors such as the loss and fragmentation of the preferred ancient broadleaved woodland habitat and loss of roost sites will be likely to have strong negative effects on the population. Furthermore, insect prey availability may have been greatly reduced by fertiliser use and intensive grazing leading to a loss of habitat complexity and associated diversity (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is protected by national legislation in most range states. There are also international legal obligations for its protection through the Bonn Convention (Eurobats) and Bern Convention where these apply. It is included in Annex II (and IV) of EU Habitats and Species Directive, and hence requires special measures for conservation including designation of Special Areas for Conservation. Some habitat protection through Natura 2000. Research is underway to establish conservation requirements for this species. Recommendations include adopting forestry practices that maintain old trees in sufficient numbers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The barbastelle bat is a priority species under English Nature's Species Recovery Programme and has a Species Action Plan that aims to enhance the current population by improving the age structure of woodlands to maximise roosting and foraging sites. Some of the hibernation sites occur in SSSIs or have been protected by grilling. The National Bat Monitoring Programme aims to determine base-line data on this species, and in Norfolk, Surrey and Devon, ongoing research aims to find roosts and determine more detailed habitat requirements of the barbastelle bat (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Western Barbastelles consume large quantities of insects which may benefit humans in the surrounding areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Barbastelle

The barbastelle (Barbastella barbastellus), also known as the western barbastelle, is a European bat. It has a short nose, small eyes and wide ears.

It is rare throughout its range. In Britain, only a few breeding roosts are known; Paston Great Barn in Norfolk, parts of Exmoor and the Quantock Hills in Devon and Somerset (see Tarr Steps), the Mottisfont woodland in Hampshire and Ebernoe Common in West Sussex.The UK distribution can be found on the National Biodiversity Network website here.[1] In Norway, it was considered extinct, having only been sighted in 1896, 1911, 1913 and 1949. However, it was again found in 2004 and 2008.[2]

Habitat[edit]

They roost in splits or behind loose bark of trees all year, normally in ancient or old growth deciduous woods that have a substantial understorey. Damaged or dead trees are the ideal habitat. They move between the roosts with great frequency.

Protection[edit]

They are protected under the European Habitats Directive. In the UK their rarity means that Woodlands containing the species may be considered for notification as a Site of Special Scientific Interest and may attract a grant under Natural Englands Environmental Stewardship scheme.

Echolocation[edit]

The barbastelle has two main call types used for echolocation. The frequency parameters of call type 1 lie between 30–38 kHz, have most energy at 33 kHz and have an average duration of 2.5 ms.[3] The frequency parameters of call type 2 lie between 29–47 kHz, have most energy at 38 kHz and have an average duration of 4.1 ms.[3][4]

References[edit]

  1. ^ Barbastella barbastellus, Joint Nature Conservation Committee, retrieved on September 1, 2008.
  2. ^ NTB (22 April 2008). "Hemmelighetskremmeri om «utdødd» flaggermus" (in Norwegian). Retrieved 2008-04-22. 
  3. ^ a b Parsons, S.; Jones, G. (September 2000). "Acoustic identification of twelve species of echolocating bat by discriminant function analysis and artificial neural networks". The Journal of Experimental Biology 203 (Pt 17): 2641–2656. PMID 10934005.  open access publication - free to read
  4. ^ Obrist, Martin K.; Boesch, Ruedi; Flückiger, Peter F. (2004). "Variability in echolocation call design of 26 Swiss bat species: Consequences, limits and options for automated field identification with a synergetic pattern recognition approach". Mammalia 68 (4): 307–322. doi:10.1515/mamm.2004.030. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!