Overview

Distribution

Range Description

This species occurs in Brazil, Venezuela, Guyana, Suriname and French Guiana (Patton, 1987), and is known only from lowlands up to 500 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This rodent is nocturnal and mainly frugivorous but it also eats seeds and fungi (Eisenberg and Redford, 1999). This rodent is common in primary and secondary forest and also much degraded habitats. It is present in different patch sizes should be available from grey literature from Lovejoy's plots north of Manaus (F. Catzeflis pers. comm.). This species can survive in agricultural landscape if there is some forest cover; its reproduction is seasonal in French Guiana (F. Catzeflis pers. comm.).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: In the wild, these animals have been known to live up to 1.7 years. Captives have been kept for 3.5 years (Ronald Nowak 1999), though more detailed studies are necessary before maximum longevity can be correctly estimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Proechimys cayennensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Proechimys guyannensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 109 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNTATATCTTTTATTTGGTGCTTGAGCCGGAATAGTTGGAACTGCCCTAAGTTTATTAATTCGTACAGAATTAGGCCAACCAGGAGCATTATTAGGAGATGACCAAATTTATAATGTAATCGTAACCGCCCATGCATTTGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGGGGTTTTGGAAATTGATTAATTCCTTTAATAATCGGAGCCCCCGATATAGCGTTTCCACGAATAAATAATATAAGCTTTTGACTTCTACCTCCATCATTCCTACTTCTCCTTGCCTCATCCATAGTAGAAGCTGGAGCCGGAACAGGCTGAACGGTTTATCCTCCATTAGCTGGAAATCTAGCCCATGCAGGAGCTTCTGTTGATTTAACAATCTTTTCACTTCATCTGGCAGGAGTATCCTCAATTTTAGGAGCCATCAATTTCATTACTACTATTATTAATATAAAACCCCCAGCTTTAACACAATACCAAACACCTTTATTTGTTTGATCAGTTTTAATCACAGCCGTTCTTCTTCTTCTTTCACTACCAGTTCTAGCTGCTGGAATTACAATACTATTAACAGATCGTAATTTAAATACAACCTTCTTCGATCCAGCTGGCGGAGGAGACCCAATTCTCTATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Proechimys guyannensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 115
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Catzeflis, F. & Patton, J.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, occurrence in several protected areas, tolerance of a broad range of habitats, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This rodent is common in natural and degraded habitats (F. Catzeflis pers. comm.).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In the past clear cutting was a threat in the Guianas; mining may have threatened the species in the Brazilian portion of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is found in several protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Guyenne spiny rat

The Guyenne Spiny-rat, Proechimys guyannensis, or Cayenne Spiny Rat, is a spiny rat species from South America. It is found in Brazil, Colombia, French Guyana, Guyana, Surinam and Venezuela.

Notes

  1. ^ Catzeflis, F. & Patton, J. (2008). Proechimys guyannensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 6 January 2009.

References

  • Infonatura
  • Woods, C. A. and C. W. Kilpatrick. 2005. Hystricognathi. pp 1538–1600 in Mammal Species of the World a Taxonomic and Geographic Reference 3rd ed. D. E. Wilson and D. M. Reeder eds. Smithsonian Institution Press, Washington D.C.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!