Overview

Distribution

Range Description

This species occurs in scattered localities in eastern Amazonia, from the Guianan region of eastern Venezuela and French Guiana to the Carajas region of Pará State south of the Rio Amazonas, Montanhas de Tumucumaque National Park in Amapa State, and the left (east) bank of the Rio Negro near Manaus in central Amazonia, Amazonas State (Patton et al., 2000); also in Peru (Pacheco et al. 1995). Its elevation range is below 500 m asl. altitude (J. Patton pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
During a survey of the Jurua River, Brazil, many specimens were trapped in terra firme forests (28 of 57), they were also collected in locally inundated forest, secondary upland forest and abandoned gardens and were especially common in the latter (Patton et al., 2000). In the same survey, out of sampling months August to March, pregnant females were collected only in February and March. All litters comprised two young. Data are too limited to determine whether breeding is largely confined to the wet season or also extends through the dry period. Voss et al. (2001) also presents capture data for three different habitat plots in French Guiana, where the species is found equally in both secondary and primary forest (Voss et al. 2001).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Proechimys cuvieri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 233 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTATATCTTTTATTTGGTGCCTGAGCTGGAATAGTAGGAACTGCCCTAAGTCTACTAATTCGTGCAGAACTAGGGCAACCAGGCGCACTATTAGGGGATGATCAAATTTATAATGTAATTGTAACCGCTCATGCATTTGTTATAATCTTCTTTATAGTAATACCAATTATAATTGGAGGGTTCGGGAATTGACTAATTCCCTTAATAATTGGAGCCCCTGATATAGCATTTCCACGAATAAATAACATAAGCTTCTGACTTCTACCTCCGTCATTCCTACTTCTTCTTGCCTCATCTATAGTAGAAGCCGGAGCCGGGACAGGTTGAACGGTTTATCCTCCATTAGCCGGAAACTTAGCCCATGCAGGAGCCTCCGTTGATTTAACAATCTTCTCACTTCATTTAGCAGGAGTATCCTCAATTTTAGGGGCTATTAACTTCATTACAACTATCATTAATATAAAACCACCAGCTCTAACACAATACCAAACACCTCTCTTTGTCTGATCAGTTTTAATTACAGCCGTACTTCTTCTTCTTTCATTACCAGTTCTAGCTGCCGGAATTACAATATTATTAACAGACCGCAACTTAAACACAACTTTCTTCGATCCAGCCGGCGGAGGAGATCCTATTCTTTATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Proechimys cuvieri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 243
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Catzeflis, F. & Patton, J.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, it occurs in a number of protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This rodent is abundant in primary forest but absent in secondary forest in French Guiana (F. Catzeflis pers. comm.). It is found in secondary forest in Rio Jurua in western Amazonia (Patton et al., 2000). It is a very abundant species in Tumucumaque National Parque (C. Silva pers. comm.).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species at this time.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in Tumucumaque National Park (C. Silva pers. comm.) and several other protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cuvier's spiny rat

Cuvier's Spiny-rat, Proechimys cuvieri, is a spiny rat species from South America. It is found in Brazil, French Guyana, Guyana, Peru and Suriname.

References

  1. ^ Catzeflis, F. & Patton, J. (2008). Proechimys cuvieri. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 6 January 2009.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!