Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Carcinus aestuarii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 44
Specimens with Barcodes: 44
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Carcinus aestuarii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGGACTTCTTTAAGGCTCATTATTCGAGCCGAATTAGGACAACCGGGAACCTTAATTGGTAACGATCAAATTTATAATGTTGTTGTAACTGCCCATGCTTTTGTAATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTCGGCAATTGACTTGTGCCTTTAATATTAGGAGGACCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTCTGACTACTTCCTCCATCTTTAACTTTACTTCTAATAAGAGGAATGGTAGAAAGGGGAGTTGGGACCGGGTGAACAGTCTATCCTCCCCTAGCCGGAGCTATTGCCCATGCCGGTGCTTCAGTTGACTTAGGGATTTTTTCTTTACATCTCGCTGGAGTTTCTTCTATTTTAGGAGCTGTAAATTTCATAACAACTATTATTAATATACGTTCTTTTGGCATGACAATAGATCAAATACCTTTATTCGTGTGAGCTGTTTTTATTACTGCAATCCTTTTATTATTATCATTACCTGTGTTAGCCGGAGCCATTACGATACTTTTAACTGACCGAAATCTAAATACTTCGTTTTTCGATCCCGCGGGAGGAGGAGACCCGGTTTTATACCAACATCTGTTCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Carcinus aestuarii

Carcinus aestuarii is a littoral crab, native to the Mediterranean Sea. It bears some similarities to Carcinus maenas and was sometimes considered to be a subspecies thereof, rather than a species in its own right, but a molecular biological study using the COI gene found the difference between the two taxa to be substantial, supporting their status as separate species.[2] The two taxa can be visually distinguished by the front of the carapace, between the eyes, which is short and toothed in C. maenas but longer and smoother in C. aestuarii. Also, the gonopods of C. aestuarii are straight and parallel, whereas those of C. maenas are curved.[3]

Whereas C. maenas has invaded many shorelines throughout the world, C. aestuarii has only been implicated in one invasion; the coastline of Japan has been invaded by either C. aestuarii or a hybrid of C. aestuarii and C. maenas.[4]

References [edit]

  1. ^ Peter K. L. Ng, Danièle Guinot & Peter J. F. Davie (2008). "Systema Brachyurorum: Part I. An annotated checklist of extant Brachyuran crabs of the world" (PDF). Raffles Bulletin of Zoology 17: 1–286. 
  2. ^ J. Roman & S. R. Palumbi (2004). "A global invader at home: population structure of the green crab, Carcinus maenas, in Europe" (PDF). Molecular Ecology 13 (10): 2891–2898. doi:10.1111/j.1365-294X.2004.02255.x. PMID 15367106. 
  3. ^ S. B. Yamada & L. Hauck (2001). "Field identification of the European green crab species: Carcinus maenas and Carcinus aestuarii". Journal of Shellfish Research 20 (3): 905–909. 
  4. ^ T. J. Carlton & A. N. Cohen (2003). "Episodic global dispersal in shallow water marine organisms: the case history of the European shore crabs Carcinus maenas and C. aestuarii". Journal of Biogeography 30 (12): 1809–1820. doi:10.1111/j.1365-2699.2003.00962.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!