Overview

Distribution

Range Description

This species has a wide distribution that stretches east from the Manique River in Beni, Bolivia, and north into Brazil where Ferrari et al. (2000) confirmed the presence of titis with a greyish pleage in southern Rondônia. It is possible that its range extends as far north as the Serra dos Pacaás Novos. It is found in Bolivia south to the forests around the city of Santa Cruz.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bolivian titi monkeys, Callicebus donacophilus, are primarily found in eastern Bolivia in the upper basins of the Mamore River and the Rio Grande. They may also be found in the extreme southwestern parts of the Brazilian states of Mato Grasso and Rondônia.

Biogeographic Regions: neotropical (Native )

  • Ferrari, S., S. Iwanga, M. Messias, E. Ramos, P. Ramos, E. da Cruz Neto, P. Coutinho. 2000. Titi monkeys (Callicebus spp., Atelidae: Platyrrhini) in the Brazilian state of Rondônia. Primates, 41(2): 229-234.
  • Hershkovitz, P. 1990. Titis, new world monkeys of the genus Callicebus (Cebidae, Platyrrhini): a preliminary taxonomic review. Fieldiana Zoology, 55: 1-109.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Bolivian titis are small, New World monkeys , averaging about 320 mm in length. Males are only slightly larger than females, weighing on average 991 g while females weigh 909 g. Titis have long tails that are not prehensile. They have very little prognathism and long skulls. Titi monkeys have long hind limbs with an intermembral index of 75.

The chest and belly of Bolivian titi monkeys is completely orange to brown-orange while the dorsal side and extremities range from grey to orange agouti in color. The tail may include black or grey coloring, and they have white tufts on their ears.

The dental formula of Bolivian titis, as with other titi monkeys, is 2.1.3.3/2.1.3.3. Compared to other platyrrhines, the canines of titi monkeys are relatively short and their molars are fairly simple.

Bolivian titi monkeys can be distinguished from closly related speices including Callicebus olallae, Callicebus brunneus, and Callicebus modestus by their well-developed malar stripe and lack of distinct sideburns.

Average mass: Males 991 g; Females 909 g.

Average length: 320 mm.

Sexual Dimorphism: sexes alike

  • Fleagle, J. 1999. Primate Adaptation and Evolution. San Diego: Academic Press.
  • van Roosmalen, M., T. van Roosmalen, R. Mittermeier. 2002. A taxonomic review of the titi monkeys, genus Callicebus Thomas, 1903, with the description of two new species, Callicebus bernhardi and Callicebus stephennashi, from Brazilian Amazonia. Neotropical Primates, 10: (suppl.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Although C. donacophilus is found in tropical humid forests, it seems to be restricted to the slightly drier forests of southern Amazonia and is apparently absent from the more humid forests of northern Beni Department (Wallace and Mercado 2007). It also appears reasonably tolerant of habitat disturbance (R. Wallace pers. comm. 2007).

The diet of titi monkeys comprises mainly fruit pulp, leaves, insects and seeds. They form small, pair-bonded, territorial groups and are considered monogamous. They have small home (1.5-30 km) and day ranges (0.5-1.5 km). A study on the behavioural ecology and calling behaviour of C. donacophilus is underway at two sites in forest patches in and on the outskirts of Santa Cruz (K. Dingess pers. comm. to R. Wallace, 2007).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Bolivian titi monkeys inhabit riparian zones and gallery forests near swampy grasslands and other open areas.

Habitat Regions: tropical

Terrestrial Biomes: forest ; rainforest

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Bolivian titi monkeys are primarily frugivorous, and it is estimated that their diet consists of over 70% fruit. They also eat leaves, seeds, and insects. Much of the day is spent resting in order to digest their mostly herbivorous diet.

Animal Foods: insects

Plant Foods: leaves; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Frugivore ); omnivore

  • Wright, P. 1989. The nocturnal primate niche in the new world. Journal of Human Evolution, 18(7): 635-58.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Titi monkeys, including Bolivian titis, can coexist with many other New World monkeys including marmosets, tamarins, squirrel monkeys, capuchins, owl monkeys, howler monkeys, woolly monkeys, and spider monkeys. However, some of these larger species often chase titi monkeys away from fruit trees and other sources of food. Because titi monkeys prefer to remain isolated within their social group, they attempt to avoid contact with other primates.

Because they are frugivores, Bolivian titi monkeys may play a small role in seed dispersal.

The main parasites found in neotropical primates, including Bolivian titi monkeys, are trypanosomes (Trypanosoma cruzi, Trypanosoma rangeli, Trypanosoma minasense, and Trypanosoma devei), which are a prevalent cause of infection.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Ziccardi, M., R. Lourenço-de-Oliveira, R. Lainson, M. do Carmo de Oliveira Brígido, J. Augusto Pereira Carneiro Muniz. 2000. Trypanosomes of Non-human Primates from the National Centre of Primates, Ananindeua, State of Pará, Brazil. Memórias do Instituto Oswaldo Cruz, 95(2): 157-159. Accessed May 03, 2011 at http://memorias.ioc.fiocruz.br/952/3890.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Many species of raptors prey on titi monkeys, like Bolivian titi monkeys, including Guianan crested eagles and ornate hawk eagles. Other predators include felids such as jaguars as well as various arboreal snakes. Predation on infants by tufted capuchins has also been observed. Bolivian titis are have a cryptic coloration, helping them to blend in with their surroundings and avoid predation.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Titi monkeys, including Bolivian titis, utilize a variety of vocalizations in order to communicate. These vocalizations are complex and numerous, though they are generally classified into two groups: the higher pitched squeaks, trills, chirps, and grunts; and the lower pitched chirrups, moans, pants, honks, bellows, pumps, and screams. Higher pitched sounds tend to be employed when they are agitated or encounter violence. Lower pitched, louder sounds are often used in intra-group signaling as well as contacting other social groups over a long range. Certain chirrup sounds are believed to reveal information about the age and sex of the calling monkey and can be used to locate group members. Moans can be heard during copulation and greeting.

Titis perform a characteristic bout of vocalizations at the outer boundary of their relatively small range to define and reinforce the boundaries of their home range. This generally occurs in the morning soon after awakening. A male emits loud calls, moans, grunts, and other vocalizations in order to establish the boundaries. If a neighboring group draws near, the groups participate in what is known as "duetting", with both groups calling. As the groups draw together, the intensity of this duetting increases and both males and females participate. If two groups directly confront each other, more physical communication is exhibited included tail-lashing, piloerection, chasing, and further calling.

Titi monkeys also use physical communication, including grooming and tail entwining. Male and female mates show a strong preference for grooming and entwining with each other rather than with other members of their group.

Communication Channels: tactile ; acoustic

Other Communication Modes: duets

Perception Channels: visual ; acoustic

  • Moynihan, M. 1966. Communication in the titi monkey, Callicebus. Journal of Zoology, 150: 77-127.
  • Müller, A., G. Anzenberger. 2002. Duetting in the Titi Monkey Callicebus cupreus: Structure, Pair Specificity and Development of Duets. Folia Primatologica, 73: 1-12.
  • Robinson, J. 1979. Vocal regulation of use of space by groups of titi monkeys Callicebus moloch. Behavioral Ecology and Sociobiology, 5: 1-15.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest Bolivian titi in captivity reached 24.8 years of age. Little information is available regarding the lifespan of this species in the wild. Other members of the genus Callicebus, such as Callicebus moloch, live an average of 25 years.

Average lifespan

Status: captivity:
25 years.

  • de Magalhaes, J., A. Budovsky, G. Lehmann, J. Costa, Y. Li, V. Fraifeld, G. Church. 2009. The Human Ageing Genomic Resources: online databases and tools for biogerontologists.. Aging Cell, 8(1): 65-72. Accessed May 03, 2011 at http://genomics.senescence.info/species/entry.php?species=Callicebus_donacophilus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (captivity) Observations: One wild born specimen was alive after 24.8 years in captivity, making it at least 25 years old (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Like all titi monkeys, Bolivian titis are monogamous. A strong bond is formed between male and female partners, which generally mate for life. They remain in close proximity to one another for almost all of their activities and often rest together with hands clasped and tails interwoven in a characteristic manner known as “twining.” They also have been observed grasping feet, nuzzling, and lip-smacking. When apart, they display physical signs of anxiety and distress. Titi monkeys also exhibit “jealous” behavior when approached by a stranger, especially the male, who mounts and tightly grasps his mate in the presence of another individual to prevent “extramarital” relations.

Mating System: monogamous

In captivity, Bolivian titi monkeys breed throughout the year. In the wild, a breeding season is predicted, perhaps in the spring preceding the rainy season in Bolivia. In captivity, female titi monkeys give birth approximately one year after finding a mate. After a gestation period of about 18 weeks, females give birth to a single offspring, though twins are uncommon. Although female Bolivian titi monkeys reach sexual maturity at 2 years of age, the mean age of first birth is 4 years.

Average number of offspring: 1.

Average gestation period: 18 weeks.

Range age at sexual or reproductive maturity (female): 2 (low) years.

Average age at sexual or reproductive maturity (female): 4 years.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Male Bolivian titi monkeys play a dominant role in the care of their young. Although females nurse their offspring, males are the principal carriers and protectors of their young. During the first week of life, mother Bolivian titi monkeys carry their infants only 20% of the time, and after the first month, maternal contact is scarce. Infants experience more stress and elevated heart rates when separated from their father than from their mother, with few exceptions. Bollivian titi monkeys experience a stronger bond with their mate than with their offspring.

Parental Investment: male parental care ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male)

  • Anzenberger, G., S. Mendoza, W. Mason. 1986. Comparative studies of social behavior in Callicebus and Saimiri: behavioral and physiological responses of established pairs to unfamiliar pairs. American Journal of Primatology, 11: 37-51.
  • Gron, K. 2007. "Primate Factsheets: Dusky titi (Callicebus moloch) Taxonomy, Morphology, & Ecology" (On-line). Accessed April 18, 2011 at http://pin.primate.wisc.edu/factsheets/entry/dusky_titi/taxon.
  • Mendoza, S., W. Mason. 1986. Contrasting responses to intruders and to involuntary separation by monogamous and polygynous new world monkeys. Physiology and Behavior, 38: 795-801.
  • Mendoza, S., D. Reeder, W. Mason. 2002. Nature of Proximate Mechanisms Underlying Primate Social Systems: Simplicity and Redundancy. Evolutionary Anthropology, 11: 112-116.
  • Valeggia, C., S. Mendoza, E. Fernandez-Duque, W. Mason, B. Lasley. 1999. Reproductive biology of female titi monkeys (Callicebus moloch) in captivity. American Journal of Primatology, 47: 183-195.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Callicebus donacophilus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA2265-09|FJ785423|Callicebus donacophilus| AATCGCTGACTATTTTCAACCAACCATAAAGACATCGGAACGCTCTACCTTCTATTCGGCGCCTGAGCAGGGGCAGTCGGAACCGCCCTA---AGCCTCCTAATTCGAGCGGAACTAGGGCAACCTGGGAGTCTAATAGAAGAT---GATCACGTCTACAACGTTATTGTAACCTCTCACGCATTTATTATAATCTTCTTTATAGTTATGCCAATCATAATTGGGGGTTTTGGAAACTGACTAGTGCCCCTTATA---ATTGGTGCGCCTGATATAGCATTTCCCCGAATAAACAATATAAGCTTCTGACTCCTCCCCCCGTCACTCCTCCTGCTACTTGCATCATCAACTCTAGAGGCCGGCGCAGGAACTGGCTGAACAGTTTACCCGCCCCTGGCCGGAAATATGTCTCATCCAGGAGCCTCAGTAGACTTA---ACTATCTTCTCGCTACACCTGGCAGGTGTCTCCTCCATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATAAAACCCCCAGCTATAACCCAATACCAAACTCCTCTTTTTGTATGATCAGTTCTCATCACAGCAGTTCTTCTTCTCCTTTCTCTCCCTGTCCTAGCTGCT---GGAATTACTATACTACTAACAGATCGCAATCTTAATACTACCTTCTTCGACCCAGCCGGTGGGGGTGACCCAATTTTATATCAGCACCTATTTTGATTCTTTGGGCACCCTGAAGTGTATATTCTCATTCTACCCGGCTTCGGAATAATTTCCCACATCGTAACATACTACTCCAATAAAAAA---GAACCATTTGGGTACATAGGAATAGTATGAGCTATAATATCTATTGGCTTTCTAGGATTTATTGTATGGGCACACCATATATTTACAGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Callicebus donacophilus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Veiga, L.M., Wallace, R.B. & Ferrari, S.F.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
This species is considered Least Concern because of its adaptability and relatively wide range, and because there is no evidence of a decline that would warrant listing in a threatened category.

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although populations are declining, Bolivian titi monkeys are listed by the IUCN as a species of least concern. They have a relatively wide range and a slowly declining population. Bolivian titi monkeys have proven fairly adaptable, and they have a low number of natural predators. Their main threat is attributed to habitat loss due to agriculture. Bolivian titi monkeys are one of three primate species that survive within and around the borders of cities and rural human establishments in this region.

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

  • Veiga, L., R. Wallace, S. Ferrari. 2008. "Callicebus donacophilus" (On-line). In: IUCN 2010. IUCN Red List of Threatened Species. Version 2010.4. Accessed April 25, 2011 at http://www.iucnredlist.org/apps/redlist/details/41548/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Unpublished data from San Miguelito ranch in Santa Cruz provides relative abundance indices of between 0.04 and 0.18 groups (0.12-0.54 individuals) encountered per 10 km of line transect (Wallace and Mercado 2007; WCS, unpubl.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Agricultural activities have resulted in considerable habitat loss around the city of Santa Cruz. Nevertheless, it is one of three primate species that survives within the confines of the city and has been observed on the outskirts of several rural communities (R. Wallace pers. comm. 2007.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Present in Beni Biosphere Reserve and Amboro National Park in Bolivia (Wallace and Mercado 2007; Martinez and Wallace in press). More information is required regarding the species' eastern distribution, and limits with C. pallescens in the south.
It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Bolivian titi monkeys on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Bolivian titi monkeys may play a part in drawing tourists to forested areas of Bolivia.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-eared titi

The white-eared titi (Callicebus donacophilus), also known as the Bolivian titi or Bolivian gray titi, is a species of titi, a type of New World monkey, from eastern Bolivia and a small area of Brazil.[1][3] The species has a range that extends east from the Manique River in Beni Department, Bolivia to southern Rondônia in Brazil. Its southern range includes forests around the city of Santa Cruz de la Sierra.

It is a medium-sized monkey with a grey back, orange underside and distinctive white ear tufts. It has an omnivorous diet, eating fruits, other plant materials and invertebrates. It is predated upon primarily by raptors, though felids and other monkey species have been known to attack the species. It is a monogamous species and lives in small groups of two to seven individuals consisting of the pair and their offspring. The species maintains a home range of 1.5 to 3 kilometres (0.93 to 1.9 mi) and has a complex vocal repertoire to maintain their territory. It is also known for its characteristic entwining of tails when groups are sitting together. White-eared titis live for more than 25 years.

The white-eared titi population has a declining trend. The decline is believed to be caused by human-induced habitat loss and degradation, hunting, and capture to be kept as pets. In 2008, the International Union for Conservation of Nature (IUCN) classified the species as Least Concern.

Contents

Taxonomy

The white-eared titi belongs to the New World monkey family Pitheciidae, which contains the titis (Callicebus), saki monkeys (Pithecia), bearded sakis (Chiropotes), and uakaris (Cacajao). It is a member of the subfamily Callicebinae, of which the only extant genus is Callicebus, containing all of the titi monkeys.

Although the exact position of species within the Callicebus genus is debated,[4] the white-eared titi has been placed within the subgenus Callicebus[1] in the C. donacophilus group with the Rio Beni titi (C. modestus), Rio Mayo titi (C. oenanthe), Ollala Brothers' titi (C. olallae), and white-coated titi (C. pallescens).[4] The white-coated titi has sometimes been considered a subspecies of the white-eared titi,[5] but they are treated as separate species in the latest edition of Mammal Species of the World.[1]

Anatomy and physiology

The white-eared titi is a medium-sized primate with grey to orange pelage. The species does not exhibit sexual dimorphism; the male's head and body length averages 311 millimetres (12.2 in) while females average 340 millimetres (13 in).[5] The white-eared titi's tail is longer than the head and body combined.[5] It typically has thick fur, with a dorsal side and limbs that vary in colour from grey agouti to orange agouti, with an orange underside and white ear tufts.[6]

A pair of white-eared titis entwining tails.

Body weight is variable, ranging from around 800 to 1,200 grams (1.8 to 2.6 lb), with the female generally a little lighter.[6] It has the dental formula Upper: 2:1:3:3, lower: 2:1:3:3, total: 36, meaning that on each side of the jaw it has two incisors, one canine tooth, three premolars, and three molar teeth.[7] In captivity, the white-eared titi has been known to live for over 25 years.[8]

Locomotion

The white-eared titi is arboreal, spending most of its time in the lower levels of the forest. It often leaps small distances between trees due to the discontinuous nature of the lower levels; these leaps are not more than several body lengths.[9] The titi monkey is also known to enter the main canopy[9][10] and may travel along the ground, though the later is rare.[11][12] When travelling on the ground it is said to use a "bounding movement"[6] whereby it leaps more than 1 metre (3.3 ft) off the ground.[11][12] During normal movement through its environment it walks, clambers and leaps, it also bounds and climbs.[10] The titi monkey prefers branches which are less than 5 centimetres (2.0 in) in diametre and its tail never touches the support it is on.[10][13]

Behaviour

Social structure

The white-eared titi is cryptic, diurnal and known to live in small family groups.[12][14] It is a monogamous species that is thought to mate for life and lives in groups of 2 to 7 individuals consisting of a pair of adults and their offspring.[15][16][17][18] Multi-male groups have also been recorded.[19] Between the ages of two to four years, offspring will disperse from the natal group, with females leaving earlier than the males.[18][20]

There is a strong bond between the adult monogamous pair, they stay close and carry out activities together.[21][22][23][24] The pair will often huddle, intertwine tails, groom each other and hold hands. They have also been seen to foot grasp, lip-smack, nuzzle, gently grasp one another and sit pressed together. When confronted with a intruders they will respond with combative behaviour together, with males showing increased agitation to other males.[25][21][23][26][27] When separated, the pair show a significant amount of distress and agitation.[25]

Vocalisation

Titi monkeys are characterised by their vocal communication, and have a complex repertoire of calls. The calls can be divided into two categories: high-pitched quiet calls and low-pitched loud calls.[28][29] Vocalisations are often combined and repeated to form sequences that are used in the case of distress, conflict, play, bonding, and to strengthen territory.[6] The high-pitched quiet calls are mostly used when disturbed, but may also be used before or after group calling, while foraging, or to find other members of the group.[30][28] The loud low-pitched calls are mostly used in long distance group calling to ensure adequate spacing between the home ranges of different family groups.[6] These vocalisations are known as duets, and generally involve the male and female. If a neighbouring group is within earshot of these calls they will respond with their own duetting.[28]

References

  1. ^ a b c d Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 143. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100329. 
  2. ^ "Callicebus donacophilus". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=572965. Retrieved 28 November 2006. 
  3. ^ a b Veiga, L. M., Wallace, R. B. & Ferrari, S. F. (2008). Callicebus donacophilus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 3 January 2009.
  4. ^ a b van Roosmalen, M. G. M., van Roosmalen, T. and Mittermeier, R. A. (June 2002). "A Taxonomic Review of the Titi Monkeys, Genus Callicebus Thomas, 1903, With the Description of Two New Species, Callicebus bernhardi and Callicebus stephennashi, from Brazilian Amazonia". Neotropical Primates 10: 1–52. 
  5. ^ a b c Hershkovitz P. (1990). "Titis, new world monkeys of the genus Callicebus (Cebidae, Platyrrhini): a preliminary taxonomic review". Fieldiana Zoology 55: 1–109. 
  6. ^ a b c d e Gron, K. J. (2007-12-19). "Primate Factsheets: Dusky titi (Callicebus moloch) Taxonomy, Morphology, & Ecology". Primate Info Net. http://pin.primate.wisc.edu/factsheets/entry/dusky_titi/taxon. Retrieved 2010-04-10. 
  7. ^ Ankel-Simons, Friderun (2000). Primate anatomy. Academic Press. 
  8. ^ Weigl, R. (2005). Longevity of mammals in captivity; from the living collections of the world. Stuttgart: E. Schweizerbartsche. pp. 214. 
  9. ^ a b Lawler, R. R., Ford, S. M., Wright, P. C. & Easley, S. P. (2006). "The locomotor behavior of Callicebus brunneus and Callicebus torquatus". Folia Primatologica 77 (3): 228–39. doi:10.1159/000091232. 
  10. ^ a b c Youlatos, D. (1999). "Comparative locomotion of six sympatric primates in Ecuador". Annales Des Sciences Naturelles 20 (4): 161–168. 
  11. ^ a b Erwin, J., Maple, T. L. & Mitchell, G., ed. (1979). "Titi and squirrel monkeys in a novel environment". Captivity and behavior: Primates in breeding colonies, laboratories, and zoos.. New York: Van Nostrand Reinhold. pp. 172–216. 
  12. ^ a b c Kinzey, W. G. (1981). "The titi monkeys, genus Callicebus: I. description of the species". In Coimbra-Filho, A. F. & Mittermeier, R. A.. Ecology and behavior of neotropical primates, Vol. 1. Rio de Janeiro: Academia Brasileira de Ciências. pp. 241–276. 
  13. ^ Welker, C., Jantschke, B. & Klaiber-Schuh, A. (1998). "Behavioural data on the titi monkey Callicebus cupreus and the owl monkey Aotus azarae boliviensis. A contribution to the discussion on the correct systematic classification of these species. Part I: introduction and behavioural differences". Primate Report 51: 3–18. 
  14. ^ Eisenberg, J. F. & Redford, K. H. (1999). Mammals of the Neotropics, Vol. 3: The Central Neotropics.. Chicago: University of Chicago Press. 
  15. ^ Wright, P. C. (1984). "Ecological correlates of monogamy in Aotus and Callicebus". In Else, J. G. & Lee, P. C.. Primate ecology and conservation. Cambridge: Cambridge University Press. pp. 159–167. 
  16. ^ Mason, W. A. & Mendoza, S. P. (1993). Contrasting life modes in cebidae: titi monkeys (Callicebus) and squirrel monkeys (Saimiri). AAZPA Reg Conf Proceed (1993). pp. 715–722. 
  17. ^ Kinzey, W. G. (1997). "Synopsis of the new world primates: Callicebus". In Kinzey, W. G.. New world primates: ecology, evolution, and behavior. New York: Aldine De Gruyter. pp. 213–221. 
  18. ^ a b Bossuyt, F. (2002). Natal dispersal of titi monkeys (Callicebus moloch) at Cocha Cashu, Manu national park, Peru. 34. American Journal of Physical Anthropology. pp. 47. 
  19. ^ Bicca-Marques, J. C., Garber, P. A. & Azevedo-Lopes, M. A. O. (2002). Evidence of three resident adult male group members in a species of monogamous primate, the red titi monkey (Callicebus cupreus). 66. Mammalia. pp. 138–142. 
  20. ^ Wright, P. C. (1985). The costs and benefits of nocturnality for Aotus trivirgatus (the night monkey). PhD dissertation. City University of New York. pp. 315. 
  21. ^ a b Mason, W. A. (1966). "Social organization of the South American monkey, Callicebus moloch: a preliminary report". Tulane Stud Zool 13: 23–28. 
  22. ^ Cubicciotti, D. D. & Mason, W. A. (1978). "Comparative studies of social behavior in Callicebus and Saimiri: heterosexual jealousy behavior.". Behav Ecol Sociobiol 3: 311–322. doi:10.1007/BF00296316. 
  23. ^ a b Anzenberger, G., Mendoza, S. P. & Mason, W. A. (1986). "Comparative studies of social behavior in Callicebus and Saimiri: behavioral and physiological responses of established pairs to unfamiliar pairs". American Journal of Primatology 11 (1): 37–51. doi:10.1002/ajp.1350110105. 
  24. ^ Mendoza, S. P., Reeder, D. M. & Mason, W. A. (2002). "Nature of proximate mechanisms underlying primate social systems: simplicity and redundancy". Evolutionary Anthropology 11 (1): 112–116. doi:10.1002/evan.10071. 
  25. ^ a b Mendoza, S. P. & Mason, W. A. (1986). "Contrasting responses to intruders and to involuntary separation by monogamous and polygynous new world monkeys". Physiological Behavior 38 (6): 795–801. doi:10.1016/0031-9384(86)90045-4. 
  26. ^ Mason, W. A. (1968). "Use of space by Callicebus". In Jay, P. C.. Primates: studies in adaptation and variability. New York: Holt, Rinehart and Winston. pp. 200–216. 
  27. ^ Fernandez-Duque, E., Mason, W. A. & Mendoza, S. P. (1997). "Effects of duration of separation on responses to mates and strangers in the monogamous titi monkey (Callicebus moloch)". American Journal of Primatology 43 (3): 225–237. doi:10.1002/(SICI)1098-2345(1997)43:3<225::AID-AJP3>3.0.CO;2-Z. PMID 9359966. 
  28. ^ a b c Robinson, J. G. (1977). "Vocal regulation of spacing in the titi monkey (Callicebus moloch)". University of North Carolina-Chapel Hill PhD dissertation. 
  29. ^ Robinson, J. G. (1979). "An analysis of the organization of vocal communication in the titi monkey Callicebus moloch". Zeitschrift Fur Tierzuchtung und Zuchtungsbiologie 49: 381–405. 
  30. ^ Moynihan, M. (1966). "Communication in the titi monkey, Callicebus". Journal of Zoology 150: 77–127. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!