Overview

Distribution

Range Description

This species occurs in Indonesia (Sumatra, Batam and Galang in the Riau Archipelago, and Pulau Tebingtinggi and Bunguran in the North Natuna Islands), Malaysia (on the Peninsula and the island of Pulau Tioman), southern peninsular Thailand (from the Isthmus of Kra southward), and Singapore (Groves 2001; M. Shekelle pers. comm.)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Nycticebus coucang inhabits the rainforests of southeast Asia, Assam, Burma, Thailand, Indo-China, certain Malayan states and East Indian Islands.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Nycticebus coucang is a small primate, measuring between 300 and 380 mm for head and body. Individuals typically weigh less than 2 kg.

Slow lorises have a vestigial tail. The second digit on their hands is reduced in size, and the big toe on the hind foot is set well apart from the other toes, demonstrating great gripping power. As in all lorisoids, slow lorises have a long, curved claw on the second toe which sticks up and is used to scratch the skin. Lorises have more vertebrae in their backs, giving them a greater tree-climbing advantage since they can twist around above and below branches with wide range and extension of movement.

Slow lorises are covered with short, thick, woolly fur, which is found in a wide variety of colors and patterns. Generally, the color above is from light brownish gray to deep reddish brown, sometimes with a hoary effect produced by the tips of individual hairs. The color beneath ranges from white to buffy to grayish. There is usually a dark mid-line along the neck and back, and a light streak between the orbital rings.

This species produces a toxin from brachial glands on its arms, and a toothcomb on the lower jaw may help the loris transfer the toxin (see other comments).

Range mass: 2 (high) kg.

Average mass: 0 kg.

Range length: 300 to 380 mm.

Average basal metabolic rate: 1.504 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species occurs in primary and secondary lowland forest, gardens, and plantations (Timm and Birney 1992). It is seen more often in edge habitat of forest, possibly because the edge has more supports that may increase foraging efficiency (Johns 1986), but this also may be due to sampling bias, as they are more easily seen on forest edges (Nekaris et al. in press). It is frugivorous, but will also eat insects, leaves, and bird eggs (Johns 1986). One long-term study has shown that they consume mainly nectar gum and sap, with fruit and arthropods forming small proportion of diet. Nectar from the flowers of the burtram palm (Eugeissona tristus) seems to be a key resource (Wiens and Zitzmann 2003).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Slow lorises are arboreal primates, occupying the canopies of Malayan rainforest. They are almost never observed out of the treetops, although when they are on the ground, they move with a wavering trot.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Slow lorises are nocturnal predators and feed mainly on insects, bird eggs, and young birds or sleeping birds and mammals. They will readily eat fruits and other parts of plants, however. They move slowly toward their prey so as not to frighten it away, but once they are within striking range, lorises move quickly to subdue their prey. The grip of the slow loris's hind feet is so strong that it often gathers food hanging upside down using its front hands to capture and hold prey.

Animal Foods: birds; mammals; eggs; insects

Plant Foods: fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As part of their general omnivory, these animals may help to structure local food webs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Lorises may protect themselves and their young using a toxin (see Other Comments). Predators include cats, sun bears, and Paradoxurus (palm civets).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Slow lorises have communication systems typical of prosimians. They use scent cues to communicate and to mark territories. They use vocalizations, including calls and whistles, to attract mates. Tactile communication in grooming and aggression are common. The role of visual signals in this species' communication has not been identified, but body postures and facial expressions are likely to be communicative.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Nycticebus coucang may live as long as 26 years in captivity, and lifespans of 20 years are not uncommon.

Range lifespan

Status: captivity:
26 (high) years.

Average lifespan

Status: captivity:
20 years.

Average lifespan

Sex: female

Status: captivity:
26.5 years.

Average lifespan

Sex: female

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.8 years (captivity) Observations: One captive specimen lived 25.8 years (Richard Weigl 2005). There is also one report of a 26.5 year old animal (Hakeem et al. 1996), which has not been confirmed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Although not well documented, the mating system of this species appears to be monogamous. Slow lorises are often found in family groups, and males, who are highly territorial, are not tollerant of one another.

Mating System: monogamous

Research indicates that slow lorises breed throughout the year. Generally, a female will have one offspring after a gestation of 191 days. Young weigh on average 52.4 g at birth, and are weaned at about 189 days old. Males become intolerant of offspring as they reach 18 months of age, and force the young to disperse. Females are capable of breeding at about 18 months of age, and males are at about 17 months.

Breeding interval: Females may breed twice per year.

Breeding season: These animals breed throughout the year.

Average number of offspring: 1.

Range gestation period: 184 to 197 days.

Average gestation period: 191 days.

Range weaning age: 175 to 213 days.

Average weaning age: 189.5 days.

Average time to independence: 18 months.

Average age at sexual or reproductive maturity (female): 18 months.

Range age at sexual or reproductive maturity (male): 17 (low) months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 48.2 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
578 days.

The young will attach itself to its mothers fur (anywhere on the mother's body, depending on how the mother is travelling). The young then remain passengers until they are nearly as large as the mother. The role of the male in parental care has not been described.

Parental Investment: pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nycticebus coucang

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0095-06|AJ309867|Nycticebus coucang| AACCGCTGGCTCTATTCTACCAATCACAAGGACATTGGCACTTTATACTTAGTGTTCGGTGCCTGAGCGGGGATAGTGGGAACCGCCCTA---AGTTTGCTAATCCGAGCAGAGCTAGGTCAGCCAGGTACTCTGCTGGGCGAT---GATCAAATTTATAACGTTATTGTAACAGCCCATGCATTCGTTATAATCTTTTTTATAGTTATACCAATCATAATCGGGGGCTTCGGGAACTGATTAGTACCCCTAATA---ATTGGAGCCCCCGACATAGCTTTCCCACGAATAAATAATATAAGTTTCTGACTTTTACCACCGTCTTTCCTTCTTCTCCTAGCCTCATCTATAGTTGAGGCCGGAGCCGGCACTGGATGAACTGTGTACCCACCTCTAGCAGGTAATCTGGCCCATGCAGGAGCCTCAGTTGATCTT---ACCATCTTCTCCCTTCACTTAGCAGGGGTATCCTCTATTTTAGGGGCTATTAATTTCATTACTACCGCCATTAACATAAAACCCCCTGCTATGTCTCAATACCAAACCCCACTGTTTGTCTGATCAGTCATGATCACCGCTGTATTACTACTACTATCTCTTCCAGTTCTCGCAGCA---GGTATCACTATGCTGCTAACAGACCGTAACCTAAACACCACATTCTTTGATCCGGCAGGAGGAGGAGACCCAATTTTATATCAACACTTATTTTGATTTTTCGGCCATCCTGAAGTCTACATTCTAATCCTACCTGGATTCGGCATAATCTCACATATCGTATCCTTTTACTCAGGAAAAAAA---GAACCATTTGGGTATATGGGCATGGTTTGGGCTATAATGTCCATTGGTTTCCTGGGCTTCATTGTGTGGGCCCACCATATATTCACAGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nycticebus coucang

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Nekaris, A. & Streicher, U.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
Listed as Vulnerable as there has probably a more than 30% reduction in population over three generations (approximately 21-24 years) based on harvesting for the pet trade and extensive habitat loss.

History
  • 2000
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although slow lorises occupy a fairly broad geographic range, they are not common in these areas and are often out-competed by arboreal monkeys in areas where different species overlap. Since their secretive and nocturnal lifestyles make them difficult to observe, accurate population estimates in many areas are difficult to obtain. Other members of the genus are considered vulnerable or threatened by various agencies, and it is likely that with more research on N. coucang it may join these.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Surveys in Sumatra have found this species to occur at very low densities. Its presence is patchy through Peninsular Malaysia. Several short-term studies indicated that it usually occurs at low densities: Pasoh Forestry Research Centre, Peninsular Malaysia (0.01-0.02 animals/km); Petalang Jaya, Malaysia (0.40 animals/km); Genting Sempah, Malaysia (3 captures after 30,000 trap nights) (Barret 1981; Rudd and Stevens 1992; Nekaris et al. in press). It was described as uncommon in Panang Island, where one was shot after 11 nights (Liat et al 1971). But at sites where long-term studies were chosen found forests where they occur at particularly high densities (Sungai Tekam Forestry Concession, Malaysia, 0.3-0.8 animals/km in logged primary forest, 0.5-1.2 animals/km in unlogged primary forest; Manjung District, Perak, Malaysia, 1.6-4.0 animals/km in unlogged primary forest and 0.4-1.0 animals/km in logged swamp forest and secondary savanna). In general, though, slow lorises of all taxa appear to occur at very low densities (Nekaris et al. in press).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The species is collected for use as pets, and the animals are sold throughout Southeast Asia (Nekaris and Bearder 2007; Nekaris and Nijman 2007). The teeth are often pulled, resulting in infection and/or death. If animals survive, lack of teeth makes reintroduction impossible. Well-meaning rescue centres haphazardly reintroduce lorises into local forests without knowledge of their taxonomy or social needs. Sumatran populations are particularly impacted by the pet trade. There is little information available on other threats to this species. It is relatively adaptable to anthropogenic habitats, and so it might less affected by forest loss than some other primate species. Nevertheless, forest loss has been so severe in the region that it is likely to have had some negative impacts. Animals are shot as crop pests and for other reasons (Bennett et al. 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in several protected areas throughout its range. Studies on Sumatra are urgently needed to confirm conservation status. The species is protected by law in Malaysia, Thailand and Indonesia, and has been recently transfer from Appendix II to Appendix I of CITES (Nekaris and Nijman 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Nycticebus coucang has no negative impact on human populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Legends about the use of slow lorises in cures and as luck charms (see Other Comments below) established some economic importance of lorises to humans, especially natives. In addition, their fur has been used in garments in the recent past.

Positive Impacts: body parts are source of valuable material; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sunda slow loris

The Sunda slow loris (Nycticebus coucang) or greater slow loris is a strepsirrhine primate and a species of slow loris native to Indonesia, western Malaysia, southern Thailand and Singapore. It measures 27 to 38 cm (11 to 15 in) from head to tail and weighs between 599 and 685 g (21.1 and 24.2 oz). Like other slow lorises, it has a wet nose (rhinarium), a round head, small ears hidden in thick fur, a flat face, large eyes, small ears and a vestigial tail.

The Sunda slow loris is nocturnal and arboreal, typically occurring in evergreen forests. It prefers rainforests with continuous dense canopies and has an extremely low metabolic rate compared to other mammals of its size. Its diet consists of sap, floral nectar, fruit and arthropods. It will feed on exudates such as gum and sap by licking wounds in trees. The species is generally solitary; one study showed only 8% of its active time was spent near other individuals. Social behavior makes up a very small part of the activity budget, though it has monogamous mating system with the offspring living with the parents. It sleeps during the day, rolled up in a ball in hidden parts of trees above the ground, often on branches, twigs, palm fronds, or lianas. The species is polyoestrous, usually giving birth to a single offspring after a gestation period of 192 days. The young disperses between 16 and 27 months, generally when it is sexually mature.

The species is listed as "Vulnerable" on the IUCN Red List. It is threatened with extinction due to a growing demand in the exotic pet trade, and has become one of the most abundant primate species on sale at Indonesian pet markets. Its teeth are often pulled out before being sold as pets which can result in infection and/or death, this process makes reintroduction to the wild impossible. It also suffers from habitat loss, which has been severe in the areas in which it is found.

Contents

Etymology

The common name, Sunda slow loris, refers to the Sunda Islands, a group of islands in the western part of the Malay archipelago where it is found.[7] Another common name for the species is the Greater Slow Loris.[2] The specific name, coucang, derives from kukang, its common name in Indonesia.[7] It is commonly known as malu-malu, meaning "shy" in Indonesian, and also as bukang or Kalamasan.[7][8] It is sometimes called Kuskus, because local people do not distinguish between the slow loris and Cuscus, a group of Australasian possums.[8] In Malaysia they are sometimes known as kongkang or kera duku; kera is Malay for monkey while duku is the fruit-bearing tree, Lansium domesticum.[8] In Thailand, it is called ling lom (ลิงลม), which translates as "wind monkey".[8]

Taxonomy and phylogeny

The Sunda slow loris was first described in 1785 by the Dutch physician and naturalist Pieter Boddaert under the name Tardigradus coucang.[9][10] However, its discovery dates to 1770, when the Dutchman Arnout Vosmaer (1720–1799) described a specimen of it as a type of sloth. Vosmaer gave it the French name "le paresseuz pentadactyle du Bengale" ("the five-fingered sloth of Bengal"), but Boddaert later argued that it was more closely aligned with the lorises of Ceylon (now Sri Lanka) and Bengal.[11]

Between 1800 and 1907, several other slow loris species were described, but in 1952 the primatologist William Charles Osman Hill consolidated all the slow lorises in one species, N. coucang, in his influential book Primates: Comparative Anatomy and Taxonomy.[12] In 1971 Colin Groves recognized the pygmy slow loris (N. pygmaeus) as a separate species,[13] and divided N. coucang into four subspecies,[14] while in 2001 Groves opined there were three species (N. coucang, N. pygmaeus, and N. bengalensis), and that N. coucang had three subspecies (Nycticebus coucang coucang, N. c. menagensis, and N. c. javanicus).[15] These subspecies were promoted in 2010 to species status—the Javan slow loris (N. javanicus) and Bornean slow loris (N. menagensis)—leaving the Sunda slow loris without subspecies.[16] Species differentiation was based largely on differences in morphology, such as size, fur color, and head markings.[17]

When Étienne Geoffroy Saint-Hilaire defined the genus Nycticebus in 1812, he made the Sunda slow loris the type species.[18] This was questioned in 1921 by British zoologist Oldfield Thomas, who noted that there was some confusion over the specimen used as the type specimen. Instead, he suggested that the type specimen was actually the Bengal slow loris (N. bengalensis).[9][19][20] There was also some confusion during the 1800s when Boddaert's Tardigradus coucang was mistaken for Carl Linnaeus' Lemur tardigradus, which was described in the 10th edition of Systema Naturæ (1758) and referred to a slender loris. However, this was clarified in 1902 by mammalogists Witmer Stone and James A. G. Rehn.[21]

The species has 50 chromosomes (2n=50), and it genome size is 3.58 pg.[22] Of its chromosomes, 22 are metacentric, 26 are submetacentric, and none are acrocentric. Its X chromosome is submetacentric, and its Y chromosome is metacentric.[23]

To help clarify species and subspecies boundaries, and to establish whether morphology-based classifications were consistent with evolutionary relationships, the phylogenetic relationships within the genus Nycticebus have been investigated using DNA sequences derived from the mitochondrial markers D-loop and cytochrome b. Although most of the recognized lineages of Nycticebus (including the pygmy slow loris (N. pygmaeus), Bornean slow loris (N. menagensis) and the Javan slow loris (N. javanicus)) were shown to be genetically distinct, the analysis suggested that DNA sequences from some individuals of Sunda slow loris (N. coucang) and Bengal slow loris (N. bengalensis) apparently share a closer evolutionary relationship with each other than with members of their own species. The authors suggest that this result may be explained by introgressive hybridization, as the tested individuals of these two taxa originated from a region of sympatry in southern Thailand; the precise origin of one of the N. coucang individuals was not known.[24] This hypothesis was corroborated by a 2007 study that compared the variations in mitochondrial DNA sequences between N. bengalensis and N. coucang, and suggested that there has been gene flow between the two species.[25]

Anatomy and physiology

The Sunda slow loris has dark rings around its large eyes,[26] a white nose with a whitish strip that extends to the forehead and a dark stripe that stretches from the back of the head along the spine.[27][28] Its soft, thick, woolly fur ranges from light brown to deep reddish brown, with a lighter underside.[7][28] The species is distinct from the Bengal slow loris due to the dark inverse teardrop markings around the eyes which meet the dark dorsal stripe on the back of the head.[29] It tends to have a much more distinct white stripe between the eyes, more distinct dark coloring around the eyes, and a browner coat than the Bengal slow loris which is larger, grayer, and shows less contrast.[29] The Sunda slow loris has less white facial coloring than the much smaller pygmy slow loris.[29] Local color variations are known to occur.[7]

A Sunda slow loris climbs, upside down, along a tree branch
The Sunda slow loris generally holds branches with at least three limbs at one time.

It measures between 27 and 38 centimetres (11 and 15 in) and weighs 599 and 685 grams (21.1 and 24.2 oz).[30][31][32][33] Unlike the Bengal slow loris, the Sunda slow loris does not show sexual dimorphism by weight.[32] The vestigial tail,[34] hidden beneath the fur, is reduced to a stump.[33] It has a toothcomb, six forward-facing teeth on the bottom jaw, which includes the lower incisors and the canine teeth. The structure is generally used for grooming in other strepsirhine primates, but lorises also use it to scrape off gum when foraging.[35] It has a shortened second digit, and the hands have a strong grip.[33] Like other lorises, it excretes a strong-smelling liquid from glands beneath its arms which is used in communication.[36]

One major distinguishing feature between all loris species is locomotion: the Sunda slow loris moves slowly through trees on all four limbs, typically with three limbs attached to a support at a time.[30][37] Its movement has been described as unique; similar to crawling, or as if it was climbing in every direction, the Sunda slow loris changes direction or moves between branches with little noise or change in speed.[38] In captivity, about a quarter of its time is spent moving quadrupedally, a quarter suspended or hanging, a quarter climbing, and a quarter clasping multiple branches (bridging).[39] It may hang below a branch by one or both feet for long periods of time.[40]

Behavior and ecology

Like other slow lorises, the Sunda slow loris is an arboreal and nocturnal primate, resting by day in the forks of trees, or in thick vegetation and feeding on fruit and insects by night. Unlike other loris species, it remains in trees most of its life: while the Bengal slow loris will often sleep on the ground, the Sunda slow loris sleeps in a ball in branches or foliage.[27] It usually sleeps alone but has been observed to sleep with several conspecifics (individuals of the same species), including other adults.[37] Adults live in overlapping ranges of 0.004 to 0.25 km2 (0.0015 to 0.097 sq mi).[37][41]

Despite its slow metabolism rate, the Sunda slow loris has a high-energy diet. Its slow lifestyle may be due to the energy costs of detoxifying certain secondary plant compounds in many genera of food plants their diets. The largest amount of time is spent eating phloem sap (34.9%), floral nectar and nectar-producing plant parts (31.7%), and fruits (22.5%). It also consumes gums and arthropods such as spiders and insects.[37] Gum is taken by licking wounds on trees.[42] They are also known to feed on molluscs, including the giant land snail Achatina fulica,[43] and birds' eggs.[44]

All slow loris species produce a toxin in glands on the insides of their elbows. This is spread across their bodies and those of their offspring using the toothcomb while grooming.[45] When threatened with predators, the Sunda slow loris can bite, roll into a ball exposing its toxic saliva-covered fur, or roll up and drop from the trees.[46] However, the primary method of predator avoidance is crypsis, whereby it hides.[41][47] The Asiatic Reticulated Python, the Changeable Hawk-eagle and the Bornean Orangutan have been recorded as predators of the Sunda slow loris.[36][47][48]

Social systems

The Sunda slow loris may fit into the monogamous single male/single female social system,[41][49] though are mainly known to be solitary.[37] One study showed only 8% of the species' active time was spent near other individuals.[27] Where home ranges overlap, spatial groups are formed. These groups consist of one male, one female and up to three younger individuals.[37] The interactions between these individuals are largely friendly; they include allogrooming, following, pant-growling, and click-calling, although social behaviors only make up around 3% of the activity budget.[41] When it comes into contact with conspecifics from other home ranges there is usually no reaction as home ranges are not defended.[41] In captivity however, it can be aggressive with other individuals. Males have shown antagonistic behaviors such as attacks, pursuits, threats, assertion, fighting, and subordination.[40] The fighting often results in serious injury.[40] Despite this, they are known to be generally sociable in captivity,[40] with allogrooming being the most common social behavior.[50]

Communication

There are eight distinct call types made by Sunda slow loris adults, which can be divided into two categories:[51] contact and contact-seeking calls such as whistles and short keckers (a social play and attention-seeking call), and aggressive and defensive calls such as long keckers, screams, snarls and grunts.[51] Because they rely on crypsis to avoid predators, they do not make alarm calls.[41] Infants emits clicks and squeaks when disturbed.[52] During estrus, females make whistle calls when in visual contact with a male.[51][52] When exploring new environments and during handling, it makes ultrasonic vocalisations out of the human hearing range.[51]

Olfactory communication is very important in this species. It has roles in alerting others of the identity, physical state and position of the individual.[36][46][53] It is also important in reproduction.[27] Like other slow lorises, the Sunda slow loris has glands on its elbows that exude oils. The gland is licked to spread scent and is thought to have evolved for communication, but it is toxic to humans. If the person is allergic to the animal they can go into shock and could even die.[36][54] It also has glands on its anus and can signal conspecifics by perineal rubbing which deposits urine.[36][46][53] When it locates the scent of another slow loris it may rub its face on the substrate where the scent was found.[53] The Sunda slow loris may grin or bare its teeth. When stressed, infants may grin, while adults bear their teeth to show aggression or fear, but also during play.[53]

Reproduction

A Sunda slow loris hangs from a branch with two legs
Females hang from branches during copulation.

Reproduction is one of the few times the Sunda slow loris aggregates with conspecifics, as it is largely solitary. One study recorded that the most slow lorises ever seen together was six; this appeared to be a female in estrus and five males following her.[43] This may suggest a more promiscuous mating system, where females mate with more than one male.[37] Despite this, its testis size is small compared with similar sized promsimians, which is indicative of monogamy.[37] In the wild the mating system of the Sunda slow loris is thought to vary between populations.[41]

Sexual maturity is reached between the ages of 18 and 24 months in females, and can be reached by 17 months in males.[55] It is polyestrous, having many periods of sexual receptivity during a year.[56] In captivity however, there is a clear birth peak between March and May.[55] It has been observed that reproductive patterns of captive prosimians in the northern hemisphere are altered.[56] The estrus cycle lasts 29–45 days, with most copulations occurring on the same day.[55]

Females in estrus are followed by males, with copulation initiated by the female.[56] The female will hang from a branch and may vocalise. The male will hold the female and the branch and copulate with her.[56][57] Urine-marking and vocalising are also used by the female to solicit mating.[57] The male may create a mating plug following copulation.[55]

The gestation period averages 192.2 days, after which one young is born, although twinning has been observed.[55] Both males and females will disperse in the wild, this occurs between 16 and 27 months.[41]

Distribution and habitat

The Sunda slow loris is found in continuous canopy tropical rainforests.[49][58] It is adaptable and will also live in other types of habitat.[27] It is found in Indonesia, on the islands of Sumatra, Batam and Galang in the Riau Archipelago, and Pulau Tebingtinggi and Bunguran in the northern Natuna Islands; in Malaysia on the Malay Peninsula and Pulau Tioman; in the southern peninsular of Thailand; and Singapore.[7][27][28][32]

The Sunda slow loris is sympatric (shares its range) with the Bengal slow loris in Thailand and hybridisation has occurred.[25]

Conservation

According to the 2008 International Union for Conservation of Nature (IUCN) Red List assessment, the Sunda slow loris was evaluated as "Vulnerable".[2] In June 2007 it was transferred from CITES Appendix II to Appendix I, indicating a true concern about the state of internation trade in this species, an act now forbidden by international law.[59] It is also protected by Indonesian law, though the law does not seem to be strictly enforced.[60] Its population size is unknown and further studies need to be carried out to confirm their conservation status.[2]

A young Sunda slow loris having its teeth clipped
Removing or clipping slow loris teeth can lead to infection and death.

The Sunda slow loris is greatly threatened by the pet trade, and is sold as an exotic pet throughout southeast Asia.[49][61] The slow lorises are the most commonly traded protected primates in southeast Asia.[29][61] When sold as a pet it often will have its teeth pulled out to prevent injury to the owner.[7] This may cause dental infections which have up to a 90% death rate.[59] Once it has lost its teeth, reintroduction to the wild is impossible.[2] Due to a very high mortality rate in captivity due to stress, improper nutrition and infection, the pet trade is inflated by replacements.[7][59] With a greater purchasing power, the increasing human populations in the species' range could have an even more serious impact.[7]

The Sunda slow loris is further threatened by gathering for illegal traditional medicine. The fur is reported to heal wounds, the flesh to cure epilepsy, eyes are used in love potions, and the meat is reported to cure asthma and stomach problems.[7] It is also killed as a crop pest.[2] Severe habitat loss and degradation over large areas of its range have caused large population declines,[7] even though the species is more adaptable to anthropogenic habitats than other primates in the region. The resulting fragmentation has restricted species dispersal as it depends on continuous canopy cover to move from tree to tree.[2]

Footnotes

  1. ^ In 1917, Robinson used the name buku, introduced by Martin in 1838, for a form of slow loris;[4] however, the name buku as originally applied did not refer to a slow loris.[5]

References

  1. ^ a b Groves 2005, p. 122.
  2. ^ a b c d e f g Nekaris, A. & Streicher, U. (2008). "Nycticebus coucang". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/39759. Retrieved 30 January 2011. 
  3. ^ UNEP-WCMC. "CITES species database: Nycticebus coucang". UNEP-WCMC Species Database. http://www.unep-wcmc.org/isdb/CITES/Taxonomy/tax-species-result.cfm/isdb/CITES/Taxonomy/tax-species-result.cfm?Genus=Nycticebus&Species=coucang&source=animals&displaylanguage=eng. Retrieved 3 February 2011. 
  4. ^ Robinson, H.C. (1917). "On three new races of Malayan mammals" (PDF). Journal of the Federated Malay States Museums 7: 101–105. http://www.sabrizain.org/malaya/library/fmsjournal07.pdf. 
  5. ^ Groves 1971, p. 50.
  6. ^ Chasen 1940, pp. 88–89.
  7. ^ a b c d e f g h i j k Management Authority of Cambodia (3–15 June 2007). "Notification to Parties: Consideration of Proposals for Amendment of Appendices I and II" (PDF). Netherlands: CITES. p. 31. Archived from the original on 30 January 2011. http://www.webcitation.org/5vacXUYZJ. Retrieved 9 January 2011. 
  8. ^ a b c d Schulze, H. (2004). "Vernacular names: English, French, German, others (countries of origin)". Lorises and pottos: species, subspecies, local populations. Conservation database for lorises. http://www.loris-conservation.org/database/population_database/tables/03-Names.pdf. Retrieved 30 January 2011. 
  9. ^ a b Elliot 1913, p. 21.
  10. ^ Osman Hill 1953, p. 46.
  11. ^ Osman Hill 1953, p. 45.
  12. ^ Osman Hill 1952, pp. 156–163.
  13. ^ Groves 1971, p. 45.
  14. ^ Groves 1971, pp. 48–49.
  15. ^ Groves 2001, p. 99.
  16. ^ Nekaris, K.A.I.; Munds, R. (2010). "Chapter 22: Using facial markings to unmask diversity: the slow lorises (Primates: Lorisidae: Nycticebus spp.) of Indonesia". In Gursky-Doyen, S.; Supriatna, J. Indonesian Primates. New York: Springer. pp. 383–396. doi:10.1007/978-1-4419-1560-3_22. ISBN 978-1-4419-1559-7.  edit
  17. ^ Chen et al. 2006, pp. 1187–1200.
  18. ^ Saint-Hilaire 1812, p. 163.
  19. ^ Thomas 1922, p. 433.
  20. ^ Osman Hill 1953, pp. 45–46.
  21. ^ Stone & Rehn 1902, pp. 136–139.
  22. ^ Ankel-Simons 2007, p. 591.
  23. ^ Ankel-Simons 2007, p. 543.
  24. ^ Chen, J.-H.; Pan, D.; Groves, C.; Wang, Y.-X.; Narushima, E.; Fitch-Snyder, H.; Crow, P.; Thanh, V.N. et al (2006). "Molecular phylogeny of Nycticebus inferred from mitochondrial genes". International Journal of Primatology 27 (4): 1187–1200. doi:10.1007/s10764-006-9032-5.  edit
  25. ^ a b Pan, D.; Chen, J. H.; Groves, C.; Wang, Y. X.; Narushima, E.; Fitch-Snyder, H.; Crow, P.; Jinggong, X. et al (2007). "Mitochondrial control region and population genetic patterns of Nycticebus bengalensis and N. pygmaeus". International Journal of Primatology 28 (4): 791–799. doi:10.1007/s10764-007-9157-1.  edit
  26. ^ Choudhury, A.U. (1992). "The slow loris (Nycticebus coucang) in north-east India". Prim. Rep. 34: 77–83. 
  27. ^ a b c d e f Gron, K.J. (2009). "Primate Factsheets: Slow loris (Nycticebus) Taxonomy, Morphology, & Ecology Taxonomy, Morphology, & Ecology". Primate Info Net. http://pin.primate.wisc.edu/factsheets/entry/slow_loris. Retrieved 13 February 2011. 
  28. ^ a b c Groves 2001.
  29. ^ a b c d Schulze & Groves 2004, pp. 33–36.
  30. ^ a b Rigel, E.P. (2004). Analysis of Lorisidae taxonomy using postcranial skeletal material (M.A. thesis). Georgia State University. 
  31. ^ Streicher, U. (2007). "Morphological data of pygmy lorises (Nycticebus pygmaeus)". Vietnamese Journal of Primatology 1 (1): 67–74. 
  32. ^ a b c Nekaris, K. A. I.; Blackham, G. V.; Nijman, V. (2008). "Conservation implications of low encounter rates of five nocturnal primate species (Nycticebus spp.) in Asia". Biodiversity and Conservation 17 (4): 733–747. doi:10.1007/s10531-007-9308-x.  edit
  33. ^ a b c Ankel-Simons 2007.
  34. ^ Nowak 1991.
  35. ^ Martin 1979, pp. 45–47.
  36. ^ a b c d e Hagey, Fry & Fitch-Snyder 2007, pp. 253–272.
  37. ^ a b c d e f g h Wiens, F. (2002) (PDF). Behavior and ecology of wild slow lorises (Nycticebus coucang): social organization, infant care system, and diet (PhD thesis). University of Bayreuth. http://opus.ub.uni-bayreuth.de/volltexte/2002/3/pdf/Diss.pdf. Retrieved 1 March 2011. 
  38. ^ Ishida, Jouffroy & Nakano 1986, pp. 209–220.
  39. ^ Gebo, D. L. (1987). "Locomotor diversity in prosimian primates". American Journal of Primatology 13: 271–281. doi:10.1002/ajp.1350130305.  edit
  40. ^ a b c d Ehrlich, A.; Musicant, A. (1977). "Social and individual behaviors in captive slow lorises". Behaviour 60 (3–4): 195–219. doi:10.1163/156853977X00207.  edit
  41. ^ a b c d e f g h Wiens, F.; Zitzmann, A. (2003). "Social dependence of infant slow lorises to learn diet". International Journal of Primatology 24 (5): 1007–1021. 
  42. ^ Streicher, U. (2004). Aspects of ecology and conservation of the pygmy loris (Nycticebus pygmaeus) in Vietnam (PhD thesis). Ludwig-Maximilians-Universität München. http://www.loris-conservation.org/database/Coauthors/Uli/Streicher_2004.pdf. Retrieved 1 March 2011. 
  43. ^ a b Elliot, O.; Elliot, M. (1967). "Field Notes on the Slow Loris in Malaya". Journal of Mammalogy 48 (3): 497–498. doi:10.2307/1377803. JSTOR 1377803.  edit
  44. ^ Rowe 1996.
  45. ^ Alterman 1995.
  46. ^ a b c Tenaza, R.; Fitch, H. (1984). "The slow loris". Zoonooz 57 (4): 10–12. 
  47. ^ a b Wiens, F.; Zitzmann, A. (1999). "Predation on a Wild Slow Nycticebus coucang) by a Reticulated Python (Python reticulatus)". Folia Primatologica 70: 362. doi:10.1159/000021719.  edit
  48. ^ Utami, S. S.; Van Hooff, J.A.R.A.M. (1997). "Meat-eating by adult female Sumatran orangutans (Pongo pygmæus abelii)". American Journal of Primatology 43 (2): 159–165. doi:10.1002/(SICI)1098-2345(1997)43:2<159::AID-AJP5>3.0.CO;2-W. PMID 9327098.  edit
  49. ^ a b c Nekaris & Bearder 2007, pp. 28–33.
  50. ^ Newell, T.G. (1971). "Social encounters in two prosimian species: Galago crassicaudatus and Nycticebus coucang". Psychon Sci 24 (3): 128–130. 
  51. ^ a b c d Zimmermann, E. (1985). "Vocalizations and Associated Behaviours in Adult Slow Nycticebus coucang)". Folia Primatologica 44: 52. doi:10.1159/000156197.  edit
  52. ^ a b Daschbach, N. (1983). "Cage-size effects on locomotor, grooming and agonistic behaviours of the slow loris, Nycticebus coucang (Primates, Lorisidae)". Applied Animal Ethology 9: 317. doi:10.1016/0304-3762(83)90011-1.  edit
  53. ^ a b c d Rasmussen, D.T. (1986). Life history and behavior of slow lorises and slender lorises: implications for the lorisine-galagine divergence (PhD thesis). Duke University. OCLC 15673814. 
  54. ^ Wilde, H. (1972). "Anaphylactic shock following bite by a "slow loris," Nycticebus coucang". American Journal of Tropical Medicine and Hygiene 21 (5): 592–594. 
  55. ^ a b c d e Izard, M.K.; Weisenseel, K.A.; Ange, R.L (1988). "Reproduction in the slow loris (Nycticebus coucang)". American Journal of Primatology 16: 331–339. doi:10.1002/ajp.1350160405. 
  56. ^ a b c d Fitch-Snyder, H.; Jurke, M. (2003). "Reproductive patterns in pygmy lorises (Nycticebus pygmaeus): Behavioral and physiological correlates of gonadal activity". Zoo Biology 22 (1): 15–32. doi:10.1002/zoo.10072.  edit
  57. ^ a b Zimmermann, E. (1989). "Reproduction, physical growth and behavioral development in slow loris (Nycticebus coucang, Lorisidae)". Human Evolution 4: 171–179. doi:10.1007/BF02435445.  edit
  58. ^ Roonwal & Mohnot 1977, pp. 57–61.
  59. ^ a b c Sanchez, K.L. (2008). "Indonesia's Slow Lorises Suffer in Trade" (PDF). IPPL News (International Primate Protection League) 35 (2): 10. ISSN 1040-3027. http://www.ippl.org/newsletter/2000s/105_v35_n2_2008-09.pdf#page=10. Retrieved 13 February 2011. 
  60. ^ Nekaris, K.A.I.; Jaffe, S. (2007). "Unexpected diversity of slow lorises (Nycticebus spp.) within the Javan pet trade: implications for slow loris taxonomy" (PDF). Contributions to Zoology 76 (3): 187–196. http://dpc.uba.uva.nl/cgi/t/text/get-pdf?c=ctz;idno=7603a04. 
  61. ^ a b Nekaris, K.A.I.; Nijman, V. (2007). "CITES Proposal Highlights Rarity of Asian Nocturnal Primates (Lorisidae: Nycticebus)" (PDF). Folia Primatologica 78: 211–214. doi:10.1159/000102316. Archived from the original on 11 January 2011. http://www.webcitation.org/5ve9g2CbZ.  edit

Literature cited

  • Alterman, L. (1995). "Toxins and toothcombs: Potential allospecific chemical defenses in Nycticebus and Perodicticus". In Alterman, L.; Doyle, G.A.; Izard. M.K. Creatures of the Dark: The Nocturnal Prosimians. New York: Plenum Press. ISBN 978-0-306-45183-6. OCLC 33441731. 
  • Groves, C.P. (1971). "Systematics of the genus Nycticebus". Proceedings of the 3rd International Congress of Primatology, Zurich 1970. 1. Basel: Karger. pp. 44–53. 
  • Hagey, L.R.; Fry, B.G.; Fitch-Snyder, H. (2007). "Talking defensively, a dual use for the brachial gland exudate of slow and pygmy lorises". In Gursky, S.L.; Nekaris, K.A.I.. Primate Anti-Predator Strategies. Developments in Primatology: Progress and Prospects. Springer. doi:10.1007/978-0-387-34810-0. ISBN 978-0-387-34807-0. 
  • Ishida, H.; Jouffroy, F.K.; Nakano, Y. (1986). "Comparative dynamics of pronograde and upside down horizontal quadrupedalism in the slow loris (Nycticebus coucang)". In Jouffroy, F.K.; Stack, M.H.; Niemitz, C.;. Gravity, posture and locomotion in primates. Florence, Italy: Il Sedicesimo. ISBN 978-88-85342-01-9. OCLC 27036881. 
  • Martin, R.D. (1979). "Phylogenetic aspects of prosimian behavior". In Doyle, G.A.; Martin, R.D.. The Study of Prosimian Behavior. New York: Academic Press. ISBN 978-0-12-222150-7. OCLC 3912930. 
  • Nekaris, A.; Bearder, S.K. (2007). "The Lorisiform primates of Asia and mainland Africa". In Campbell, C.J.; Fuentes, A.; MacKinnon, K.C.; Panger, M.; Bearder, S.K.. Primates in perspective. New York: Oxford University Press. ISBN 978-0-19-517133-4. OCLC 60664435. 
  • Nowak, R. (1991). Walker’s Mammals of the World. Volume 1 (5th ed.). Maryland, Baltimore: Johns Hopkins University Press. ISBN 978-0-8018-3970-2. OCLC 24141759. 
  • Osman Hill, W.C. (1952). Primates: Comparative Anatomy and Taxonomy. Strepsirhini. Edinburgh, Scotland: Edinburgh University Press. 
  • Roonwal, M.; Mohnot, S. (1977). "Slow loris". Primates of South Asia: ecology, sociobiology, and behavior. Cambridge, Massachusetts: Harvard University Press. ISBN 978-0-674-70485-5. OCLC 2388247. 
  • Schulze, H.; Groves, C. (2004). "Asian Lorises: taxonomic problems caused by illegal trade". In Nadler, T.; Streicher, U.; Hà, T.L.. Conservation of Primates in Vietnam. Hanoi, Vietnam: Frankfurt Zoological Society. OCLC 60527537. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!