Overview

Distribution

Range Description

This species is endemic to central and south-western Sri Lanka, and is typically found in the southern “wet zone” of the island, up to the central “intermediate zone” (Nekaris and Jayewardene 2004).

L. t. tardigradus
Found in south-western Sri Lanka, from Colombo (although no known population still exists in this city) in the north to Ranna on the south coast. The subspecies has recently been recorded at several locations in Sri Lanka: Maimbulakanda Nature Reserve in Gampaha District, Western Province; Oliyagankele Forest Reserve, Masmullah, Kakanadura, Dandeniya Proposed Forest Reserve, Matara District; Kanneliya, Polgahaivalakande, and Kottawa Forest Reserves and Pitigala forest patches, Galle District, Southern Province; and in Godakawela, Ratnapura District, and Sinharaja World Heritage site.

Loris tardigradus nycticeboides
Found in central Sri Lanka, where it is known from the Horton Plains, Nuwara Eliya District, Central Province. Extent of occurrence is less than 300 km2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Loris tardigradus (the slender loris) is a strepsirhine primate restricted to the island of Sri Lanka.

Biogeographic Regions: oriental (Native )

Other Geographic Terms: island endemic

  • Campbell, C., A. Fuentes, K. MacKinnon, S. Bearder, R. Stumpf. 2011. Primates in Perspective. Oxford: Oxford University Press.
  • Phillips, W. 1980. Manual of the Mammals of Sri Lanka. Battaramulla: Wildlife and Nature Protection Society of Sri Lanka.
  • Schulze, H., B. Meier. 1995. The subspecies of Loris tardigradus and their conservation status: a review. Pp. 193-210 in L Alterman, G Doyle, M Izard, eds. Creatures of the Dark: The Nocturnal Prosimians. New York: Plenum Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Loris tardigradus is a small (127 g - 256 g) primate with long, gracile limbs, a slender body, and no tail. Its face is characterized by prominent ears, a short rostrum, and large, forward-oriented eyes with hazel-brown irises. Distinctive patches of dark fur surround the eyes, and a white stripe runs from forehead to nose. The coloration of circumocular patches and the shape of the interocular stripe are used to distinguish subspecies. The rostrum is sharply pointed and ends in a moist, naked rhinarium. Slender loris ears (both L. tardigradus and L. lydekkerianus), are longer than those of slow lorises (genus Nycticebus), and the margins of the ears are usually hairless. Females have two pairs of mammae which are naked during lactation and covered with fur at all other times. Limbs are subequal as the legs are bulkier and slightly longer than the arms. The palms of the hands and the soles of the feet are usually naked. As in other strepsirhine primates, there is a toilet-claw on the second digit of both feet. Their hands are smaller than their feet, and the index finger is reduced. Digits close synchronously, with the hallux and pollex opposable to digits two through five. Like Nycticebus, and in contrast to Perodicticus, Loris species have a hairless brachial gland on the inside of the arms. This gland produces an exudate important in olfactory communication, which may also have an anti-predator function. The basal metabolic rate of Loris tardigradus is not known, but lorises in general have slower metabolisms than would be expected from their body size. Research indicates a BMR of 0.38 (ml O2/g * hr) for their close relative, L. lydekkerianus malabaricus.

Three subspecies of L. tardigradus are recognized and can be distinguished by size and pelage characteristics. Loris tardigradus tardigradus is the smallest slender loris, weighing from 128 g to 142 g and with a head-body length not exceeding 206 mm. Dorsal pelage is red to reddish-brown, darkest on the shoulders and paler on the lower back and pelvis. The fur of the lower back may be slightly frosted, but less so than Loris tardigradus grandis. A dark-colored dorsal stripe is sometimes present, but never as conspicuous as that of Loris lydekkerianus nordicus. Ventral fur is yellowish. Patches around the eyes are chestnut colored, and the interocular stripe rarely bifurcates above the eyes. Females are larger than males and have a brown color, with little or no red. Infants are gray dorsally and white ventrally. Subadult males have female-like coloration and gradually become more red. Loris tardigradus grandis is larger than L. t. tardigradus, has a less delicate appearance, and is more heavily furred, especially on the limbs. It weighs up to 227 g and has a head-body length between 209 mm and 256 mm. Dorsal fur is gray and ventral fur is white. Frosting is much more pronounced than in L. t. tardigradus. The circumocular patches are black or dark brown, and the interocular stripe bifurcates and merges into white fur surrounding the ears. Females are bigger, darker, and more frosted than males. Juveniles are brown and do not have frosting. Loris tardigradus nycticeboides is known only from a few specimens. Its mean weight is 140 g, and its head-body length ranges from 204 mm - 213 mm. The fur is considerably longer than that of the other subspecies, with ventral hairs as long as 30 mm. Dorsal pelage is brown and the ventral pelage is buff. Patches around the eyes are black, and the narrow interocular stripe bifurcates and continues around the eye patches. This subspecies is unique in that the ears are completely furred. The hands and feet are also notably hairier than those of the other subspecies.

Range mass: 127 to 227 g.

Range length: 185 to 256 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently

Average basal metabolic rate: 0.714 W.

  • Nowak, R. 1999. Walker's Primates of the World. Baltimore: Johns Hopkins University Press.
  • Alterman, L. 1995. Toxins and toothcombs: potential allospecific chemical defenses in Nycticebus and Perodicticus. Pp. 413-424 in L Alterman, G Doyle, M Izard, eds. Creatures of the Dark: The Nocturnal Prosimians. New York: Plenum Press.
  • Hagey, L., B. Fry, H. Fitch-Snyder. 2007. Talking defensively, a dual use for the brachial gland exudate of slow and pygmy lorises. Pp. 253-272 in S Gursky, K Nekaris, eds. Primate Anti-Predator Strategies (Developments in Primatology: Progress and Prospects). New York: Springer US.
  • Izard, M., D. Rasmussen. 1998. Scaling of growth and life history traits relative to body size, brain size, and metabolic rate in lorises and galagos (Lorisidae, Primates). American Journal of Physical Anthropology, 75/3: 357-367.
  • Macdonald, D. 2001. The New Encyclopedia of Mammals. Oxford: Oxford University Press.
  • McNab, B. 1984. Physiological convergence amongst ant-eating and termite-eating mammals. Journal of Zoology, 204/4: 485-510.
  • Müller, E., U. Nieschalk, B. Meier. 1985. Thermoregulation in the slender loris (Loris tardigradus). Folia Primatologica, 44/3-4: 216-226.
  • Napier, J., P. Napier. 1967. A Handbook of Living Primates: Morphology, Ecology and Behavior of Nonhuman Primates. New York: Academic Press.
  • Nekaris, K., N. Stevens. 2007. Not all lorises are slow: rapid arboreal locomotion in Loris tardigradus of southwestern Sri Lanka. American Journal of Primatology, 69/1: 112-120.
  • Schulze, H., B. Meier. 1995. Behavior of captive Loris tardigradus nordicus: a qualitative description, including some information about morphological bases of behavior. Pp. 221-250 in L Alterman, G Doyle, M Izard, eds. Creatures of the Dark: The Nocturnal Prosimians. New York: Plenum Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Loris tardigradus tardigradus is found in wet lowland forests (Schulze and Meier 1995), tropical rain, swampy coastal and evergreen forests, and wet zone lowland forest up to 470 m (Molur et al. 2003). Loris t. tardigradus has only been observed to eat animal prey. Although they will eat fruit in a captive setting, they will always choose animal prey first. In addition to insects (including moths, stick insects, dragonflies, beetles, cockroaches, grasshoppers), they relish lizards and geckos. At Masmullah Proposed Forest Reserve, lorises were found in high abundance in areas characterised by Humboldtia laurifolia, a tree that has a mutualistic relationship with ants, providing abundant food for lorises. Lorises occurred at densities of 0.08-0.55 animals/ha across 15 separate sites. Loris abundance was positively associated with vines and branches providing continuous passage, branches of small size (<5 cm) and trees providing a number of potential sleeping sites. Vicinity to human populations negatively impacts this species; it is not found in home gardens, and seems to require continuous canopy to move between forest patches.
Loris t. nycticeboides may possibly be more carnivorous than the lowland subspecies. As is this case with other primates at high altitudes, it also may occur at lower densities. The forest where it occurs has been classified as cloud forest, montane forest and evergreen forest at altitudes greater than 1,500 m (Schulze and Meier 1995), from 1,650 to 2,000 m (Molur et al. 2003). Of actual sightings, the highest was at 2,134 m and the lowest at 1,829 m altitude. Temperatures in its habitat have been recorded from 15.4°C (May/June) to -4°C (Dec/Jan) (Nekaris and Jayewardene 2003; Nekaris et al. 2005; Nekaris and Bearder 2006).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Three subspecies of L. tardigradus and one subspecies of its only congener, Loris lydekkerianus, maintain fairly discrete habitat niches in Sri Lanka. Loris tardigradus tardigradus is found in wet, lowland forests of the southwest. Loris tardigradus grandis occupies the central hills ranging from 731 m to 1036 m in elevation and is thought to interbreed with L. t. tardigradus at middle elevations in the extreme west of its range. Loris tardigradus nycticeboides is a rare montane form known only from its type locality in mist forests of the Horton Plains at elevations of greater than 1500 m. A subspecies of gray slender loris, Loris lydekkerianus nordicus, inhabits the lowland dry forests and scrub jungle of the north. Some authors consider grandis and nycticeboides to be subspecies of Loris lydekkerianus (see Groves, 1998). This account follows the taxonomic account in Campbell et al. (2011).

Range elevation: 0 to 2134 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

  • Groves, C. 1998. Systematics of tarsiers and lorises. Primates, 39/1: 13-27.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Slender lorises are primarily insectivorous, specializing to some extent on toxic and unsavory species. Particularly noxious insects are eaten with evident distaste, and insects which spray irritant chemicals are removed from their colonies and eaten some distance away, while the loris salivates gratuitously, shakes its head, and shuts its eyes. Evidence suggests that volatile chemicals ingested with insect food might be reused by lorises as a kind of olfactory camouflage. Foraging lorises are frequently observed wash themselves in urine before approaching toxic insects, perhaps in order to mask their own scent. The hunting style of slender lorises and other lorises is to approach silently and cautiously, then to make a sudden explosive grab with one or both hands. Predation behavior of slender lorises has been described as a fixed action pattern that begins with visual fixation of the prey, followed by laying back of the loris' ears, and concluding with the grasping motion, which is always completed regardless of whether or not the prey item is removed. In the wild, nearly 100% of the diet is proteinaceous and includes insects, tree frogs, geckos, small birds and eggs. They may occasionally forage on fruit when available. In captivity, slender lorises are fed green salads and plantains, and readily consume mice.

Animal Foods: birds; mammals; amphibians; reptiles; eggs; insects

Plant Foods: leaves; fruit; flowers

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

There is no information available regarding the ecological role of slender lorises. They prey heavily on insects, but they are not common anywhere and it is doubtful that they control populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There are few known predators of Loris tardigradus. They may occasionally be opportunistically taken by mammalian carnivores including felids and raptors. It has been reported that genets and civets prey on lorises, but in several interactions observed by researchers between lorises and civets (Viverricula indica majori, Paradoxurus zeylonensis) or cats (Felis viverrinas), lorises simply whistled until the potential predator moved away. It is not clear if the whistle functions as a warning to conspecifics, or as a pursuit deterrence signal to the predator. Loris tardigradus females and their infants react with alarm to the presence of venomous common kraits and moved to a sheltered location until the snake has passed. When captured by researchers, lorises perform a defensive behavior which resembles that of indian cobras, which are present throughout the geographic range of L. tardigradus. When captured, L. tardigradus raises its arms above its head and sways its slender body side to side.

The brachial glands of slow lorises (Nycticebus) secrete volatile chemicals which can be toxic to humans. It is not clear whether these compounds function as a poison or an alarm pheromone, but secretion of a pungent-smelling exudate from the brachial gland is a common result of fear in both slow and slender lorises. Alterman (1995) hypothesized that volatiles in the brachial gland do not become active until they are mixed with saliva, and performed preliminary tests suggesting that mammalian carnivores such as clouded leopards, binturongs, and sun bears respond with extreme aversion to brachial gland exudate when it is mixed with loris saliva, but not when it is presented alone. Other researchers identified proteins in the brachial exudate with regions of 70% sequence similarity to a known felid allergen. No studies have investigated the composition or function of brachial gland exudate in slender lorises, but L. tardigradus may be protected from predation by virtue of unpalatability.

Anti-predator Adaptations: mimic

  • Krane, S., Y. Itagaki, K. Nakanishi, P. Weldon. 2003. "Venom" of the slow loris: sequence similarity of prosimian skin gland protein and Fel d 1 cat allergen. Natturwissenschaften, 90: 60-62.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

There is no information available regarding communication and perception in slender lorises.

Slender lorises call to one other throughout the night, and on several occasions even directed vocalizations at potential predators. The known vocal repertoire of slender lorises consists whistles, chitters, zic calls, krik calls, growls, and screams. Whistle indicate excitement and aggression and consists of one to three distinct syllables, each ending with a descending frequency sweep. Utilized by males and females, whistles are always loud, and may be audible to humans from 100 m away. Evidence suggests that whistles are most prevalent in wild populations, possibly because long distance communications are unnecessary in captivity. In captivity, whistling in one cage provoked response vocalizations from groups caged nearby. Chitter are used as a defensive threat and are sometimes associated with staring or physical shoving. Primarily uttered by females, chitters are often used in response to a courtship pursuit by a male. Chitters consist of rapid clicks at frequencies up to 20 kHz. Zic calls consist of high frequency monosyllables that are used by an infant to attract the attention of its mother. Parked infants often zic-call, at which point the mother returns from foraging and collects the infant. Low intensity zic calls may be utilized when an infant dislikes grooming, but high intensity calls signify fear or pain. In captivity, adults other than the mother may comfort a zic-calling infant. Krik calls are a hiss-like, low frequency sound used by males to appease chittering females and are commonly used by males as a prelude to allogrooming. Females use krick calls to appease zic-calling infants. Sometimes male-female duets are performed using krik calls. Growl are an unvoiced threat vocalization that are used against predators, or by captured animals. Rarely uttered in intraspecific contexts, growls are most often used in connection with defensive body language. Screams are used in circumstances of prolonged threat and are associated with secretion of exudate from the brachial gland.

Like many mammals and most nocturnal primates, slender lorises make extensive use of scent markings to communicate information. Urine marking are made by rhythmic micturition (a stereotyped behavior in which the animal travels along a branch and deposits urine at intervals by rhythmically lowering its genitals to the substrate), anogenital dragging, and indirect application (urine applied to the substrate via the hands or feet of the urinating individual). Self-washing with urine is regularly observed in a variety of contexts, including before grooming infants prior to nightly parking, when preparing to catch noxious insects, prior to consuming noxious prey items, and in response to being stung by them. Urine marking is rarely observed in the vicinity of trees used for sleeping, but marks at localities within the range-overlap area shared by sleeping-group members were eagerly received and countermarked. Scent communication also plays a role in immediate social behavior. Anogentical sniffing (male to female) often precedes grooming, and grooming bouts frequently involve rubbing and licking of the brachial gland.

Slender lorises use a variety of communicative postures, actions, and facial expressions indicating aggression, submission, contentment, fear, sexual intention (male), sexual readiness (female), and other kinds of socially relevant information. Through allogrooming and huddling, touch plays an important role in establishing and maintaining group cohesion. It may also help orient them in the dark.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: duets ; pheromones ; scent marks

Perception Channels: visual ; acoustic

  • Nekaris, K., E. Pimley, K. Ablard. 2007. Predator defense by slender lorises and pottos. Pp. 222-240 in S Gursky, K Nekaris, eds. Primate Anti-Predator Strategies (Developments in Primatology: Progress and Prospects). New York: Springer US.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is no information available on the longevity of Loris tardigradus in the wild. One captive individual reportedly lived 15.5 years.

Range lifespan

Status: captivity:
15.5 (high) years.

Average lifespan

Status: captivity:
12.4 years.

Average lifespan

Sex: male

Status: captivity:
16.4 years.

Average lifespan

Sex: male

Status: captivity:
14.0 years.

Average lifespan

Status: captivity:
15.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.3 years (captivity) Observations: One captive specimen lived 19.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Little is known of the mating habits of Loris tardigradus in the wild. A number of behaviors described in L. lydekkerianus have not been confirmed in L. tardigradus, and much of the available data (for either taxon) comes from captive individuals. Both species are reported to form social associations in which the larger home ranges of one or more males overlap the smaller range of a single female. Loris tardigradus tardigradus has been observed to gather in semi-stable sleeping groups of one female, her offspring, and a single male; groups with multiple males are reported for L. lydekkerianus. In both taxa, the presence of a post-copulation vaginal plug of hardened semen has been reported. This, along with elaborate penile morphology, has been taken as evidence of sperm competition and a multi-male breeding system. Nekaris (2003) observed several wild male L. lydekkerianus rotating among three estrus females, with each male separately grooming each female at different times over the course of a single night. Nekaris (2003) proposes a multi-male, multi-female (i.e., promiscuous) mating system.

Observations of captive Loris lydekkerianus populations indicate no reproductive seasonality, but this may not be true in the wild. It has been suggested that Loris tardigradus breed biannually, peak birth times for L. lydekkerianus in India occur during April and May and from October to December. May-December birthing schedules have been reported in Sri Lanka as well. Short-term field studies found no evidence for seasonality in wild populations of either Loris speices and documented one instance of a female L. lydekkerianus in estrus while her close neighbors carried infants. Testis of both taxa switch frequently between the scrotal and inguinal (i.e., descended and undescended) conditions, and no pattern of male genital change has been discovered with respect to female estrus or time-of-year. Enlargement of male genitals appears to be affected by ambient temperature rather than sexual activity, with enlargement occurring during increased temperatures.

Courtship by male Loris tardigradus consists of a lengthy pursuit of the female, with threat vocalizations and appeasement vocalizations. It is not clear which role, threatener or appeaser, each gender assumes. Researchers have been unable to observe the entire courtship process, and no copulations have been witnessed. Mating behavior in L. tardigradus appears to be similar to that in L. lydekkerianus nordicus, which can last for five hours and is characterized by appeasement vocalizations and excited branch-shaking on the part of the male, and threat vocalizations by the female. In captive L. lydekkerianus, when the female is ready for copulation she communicates her acceptance by adopting a suspensory posture (i.e., hanging quadrupedally on the underside of a branch). Intromission lasts from two to sixteen minutes and is concluded by a threat vocalization from the female. Both genders lick their genitals after copulation. A single copulation of L. lydekkerianus has been documented in the wild, which was preceded by an hour-long courtship pursuit and occurred in a suspensory position under a horizontal branch. Males in other trees harassed the mating pair, and copulation was twice interrupted while the focal male chased away his rivals.

Gestation in Loris tardigradus lasts 166 to 175 days, and females give birth to a maximum of two litters per year that usually consists of single offspring. Occasionally, a female may give birth to twins. Females are known to reenter estrus while nursing a previous litter. Infants are altricial, clinging to their mothers continuously for the first four weeks of life. After four weeks, young are placed in a sheltered location during active nighttime periods. Weaning takes place around 185 days, by which time the juveniles have achieved adult size.

Breeding interval: Loris tardigradus breeds twice a year

Breeding season: None confirmed

Range number of offspring: 1 to 2.

Range gestation period: 167 to 174 days.

Average weaning age: 185 days.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 11 g.

Average number of offspring: 1.3.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
380 days.

Little information exists concerning reproduction in slender lorises. The entire process, from copulation to independence of offspring, takes at least 320 days, and females may become pregnant with a new litter before weaning previous young. Physiological costs of lactation are high, as females produce milk with unusually high fat and protein content compared to that of other strepsirhine primates. Sexually mature females make a substantial caloric investment in reproduction throughout the year, but more research is needed to quantify this investment and to explore its implications for feeding ecology, social systems, and patterns of parental care.

At birth, Loris tardigradus infants are helpless. They instinctively cling to their mother's fur and remain there day-and-night for at least four weeks. After four weeks, lorises "park" their young in dense tangles of branches during nighttime foraging activity. Research indicates that L. lydekkerianus, a close relative of L. tardigradus, mothers abandoned their offspring for the entire night, and that parked infants were sometimes played-with and groomed by males. Although the relationship of males to infants is unknown, individuals who babysat in this way belonged to the same sleeping group as the mother. This behavior is probably a form of affiliative paternal care. The assistance of males in nighttime parenting may give lactating mothers increased mobility when foraging, helping them to satisfy their high caloric expenses. In contrast, L. tardigradus infants are not visited by males, and females returned to parked young as frequently as once per hour during the night.

Rare cases of infanticide have been reported for captive Loris tardigradus. Such instances are always said to be accompanied by "environmental stress", and do not appear to be directed by males toward the offspring of other males. There are no reports of infanticide in wild populations of L. tardigradus.

Parental Investment: altricial ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female); post-independence association with parents; extended period of juvenile learning

  • Nowak, R. 1999. Walker's Primates of the World. Baltimore: Johns Hopkins University Press.
  • Campbell, C., A. Fuentes, K. MacKinnon, S. Bearder, R. Stumpf. 2011. Primates in Perspective. Oxford: Oxford University Press.
  • Dixson, A. 1995. Sexual selection and the evolution of copulatory behavior in nocturnal prosimians. Pp. 95-188 in L Alterman, G Doyle, M Izard, eds. Creatures of the Dark: The Nocturnal Prosimians. New York: Plenum Press.
  • Izard, M., D. Rasmussen. 1985. Reproduction in the slender loris (Loris tardigradus malabaricus). American Journal of Primatology, 8/2: 153-165.
  • Izard, M., D. Rasmussen. 1998. Scaling of growth and life history traits relative to body size, brain size, and metabolic rate in lorises and galagos (Lorisidae, Primates). American Journal of Physical Anthropology, 75/3: 357-367.
  • Macdonald, D. 2001. The New Encyclopedia of Mammals. Oxford: Oxford University Press.
  • Napier, J., P. Napier. 1967. A Handbook of Living Primates: Morphology, Ecology and Behavior of Nonhuman Primates. New York: Academic Press.
  • Nekaris, K. 2003. Observations of mating, birthing, and parental behavior in three subspecies of slender loris (Loris tardigradus and Loris lydekkerianus) in India and Sri Lanka. Folia Primatologica, 74: 312-336.
  • Schulze, H., B. Meier. 1995. Behavior of captive Loris tardigradus nordicus: a qualitative description, including some information about morphological bases of behavior. Pp. 221-250 in L Alterman, G Doyle, M Izard, eds. Creatures of the Dark: The Nocturnal Prosimians. New York: Plenum Press.
  • Tilden, C., O. Oftedal. 1997. Milk composition reflects patterns of maternal care in prosimian primates. American Journal of Primatology, 41/3: 195-211.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Loris tardigradus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2540-09|AB371094|Loris tardigradus| AATCGCTGGCTTTATTCAACAAACCACAAAGATATTGGCACCCTATACTTGGTGTTCGGTGCCTGAGCAGGCATGGTCGGAACAGCCCTT---AGCCTACTAATCCGAGCAGAATTAGGCCAGCCAGGGACTCTTCTGGGAGAT---GATCAAATCTACAATGTCATTGTCACAGCCCATGCTTTTGTCATAATCTTCTTTATAGTTATACCCATCATAATCGGAGGGTTTGGTAACTGATTAGTCCCTCTTATA---ATTGGTGCTCCTGACATAGCCTTTCCCCGAATAAATAACATAAGCTTCTGACTTCTACCCCCATCGTTTCTTCTACTCTTAGCCTCGTCCATAGTTGAATCAGGAGCTGGAACAGGATGAACCGTATATCCCCCACTGGCAGGAAACCTAGCCCACGCTGGAGCTTCAGTCGACCTT---ACTATTTTCTCACTTCACCTTGCAGGAGTATCATCAATCCTAGGCGCTATTAACTTCATTACAACTATCATTAACATAAAACCACCAGCCATGTCCCAATATCAAACTCCACTGTTTGTATGATCAGTAATAATTACAGCAGTCCTACTATTACTATCTCTACCTGTCTTAGCAGCT---GGTATCACTATGCTATTAACTGACCGCAACCTGAACACTACATTCTTTGACCCTGCGGGAGGAGGAGACCCAATCCTCTATCAACATCTATTCTGATTTTTCGGACACCCAGAAGTATATATTCTAATCTTACCAGGATTCGGTATGATTTCACACATTGTATCTTTCTACTCTGGCAAAAAA---GAGCCATTCGGGTATATAGGAATAGTATGGGCTATGATATCTATTGGTTTCCTTGGCTTTATTGTATGAGCTCACCATATATTTACAGTCGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Loris tardigradus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Nekaris, A.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Listed as Endangered because its population size is estimated to number fewer than 2,500 mature individuals, there is an observed continuing decline in the number of mature individuals, and no subpopulation contains more than 250 mature individuals.

History
  • 2004
    Endangered
  • 2000
    Vulnerable
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Loris tardigradus is considered endangered by the IUCN's Red List of Threatened Species and is listed under Appendix II under the Convention on International Trade in Endangered Species of Wild Fauna and Flora. Major threats to their persistence include habitat loss, hunting for the pet trade and for their meat, road kills, superstitious kills, and traditional medicine. In his Manual of Sri Lankan mammals, W.W.A. Phillips wrote that L. tardigradus, "is most difficult to discover unless the jungle in which it lives is being felled." Habitat destruction is a serious threat to all three L. tardigradus subspecies, and the survival of the species depends on the enforcement of their protections throughout 7 different nature preserves in Sri Lanka and the establishment of corridors between protected areas.

CITES: appendix ii

IUCN Red List of Threatened Species: endangered

  • 2010. "Appendices I, II, and III" (On-line). Convention on International Trade in Endangered Species of Wild Fauna and Flora. Accessed April 11, 2011 at http://www.cites.org/eng/app/appendices.shtml.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
All populations are thought to be in decline. Population estimates suggest that there are approximately 1,500 animals of L. t. tardigradus in 3,000 ha of extremely fragmented forests, and about 80 animals in Horton Plains of L. t. nycticeboides. According to Molur et al. (2003) the total population of L. t. nycticeboides is unknown, yet this species has declined by greater than 80% in the last 200 years and is predicted to decline by >20% in the next 10 years. L. t. tardigradus is predicted to decline by greater than 10% in the next 5 years (Molur et al. 2003). These declines are based on the 1:1 relationship between loss of critical habitat and population number. The country has lost 97% of its forest cover (Mill 1995; Myers et al. 2000), thus dramatically reducing the population.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The threats imposed by humans on Sri Lankan Loris include habitat loss, road kill, and hunting for the pet trade, traditional “medicine,” and superstitious killing. Also, lorises have been electrocuted on un-insulated power lines. Loris t. tardigradus exists in few isolated forest patches that are also under severe encroachment by humans. Recent population studies estimate low numbers in forest patches and it is evident that both subspecies are in decline (Nekaris 2003, 2006).

Molur et al. (2003) list the following threats for L. t. nycticeboides: “land and water pollution, habitat loss due to agriculture, dairy husbandry, and vegetable cultivation, as well as local and commercial trade for eyes and meat by tea plantation workers, and possible village level trade for folk medicine”. While for L. t. tardigradus major threats are: “deforestation due to urbanization, and local, domestic, and commercial trade for meat” (Molur et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix II, and is protected under the Fauna and Flora Protection Ordinance Act No. 2, 1937 and subsequent amendments including Act No. 49, 1993 at the species level (Molur et al. 2003).
L. t. tardigradus exists in Sinharaja World Heritage site and seven nature/forest preserves, as well as one proposed forest reserve, while at least one population of L. t. nycticeboides resides in Horton Plains National Park. Despite living in these areas, the survival of the species depends on reduction of habitat loss and the concurrent establishment of corridors between forest fragments. The eradication of local reliance on lorises for traditional “medicine” and use as superstitious scapegoats can only be achieved through education (Nekaris and Jayewardene 2004). Reliable population estimates and a monitoring program are needed for all Sri Lankan loris populations.
Molur et al. (2003) list the following necessary research actions for this species: genetic and taxonomic, life history, population surveying, epidemiology, trade, population genetics, limiting factors, behavior and ecology. Also listed are the following needed management actions: habitat management, wild population management, monitoring, public education, limiting factor management, work in local communities, and Population and Habitat Viability Assessment.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Loris bites may induce shock in humans and are often slow to heal. However, wild lorises are extremely shy of contact and do not attack humans unless provoked. No other adverse effects of Loris tardigradus on humans are known.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Slender lorises are illegally hunted exploited for traditional medicine and for the pet trade.

Positive Impacts: pet trade ; body parts are source of valuable material

  • Nekaris, A. 2010. "Loris tardigradus" (On-line). IUCN Red List of Threatened Species. Accessed April 11, 2011 at http://www.iucnredlist.org/apps/redlist/details/12375/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red slender loris

The red slender loris (Loris tardigradus) is a small, nocturnal prosimian native to the rainforests of Sri Lanka. This is #6 of the 10 focal species and #22 of the 100 EDGE mammal species worldwide considered the most Evolutionarily Distinct and Globally Endangered.[3] Two subspecies have been identified, L. t. tardigradus and L. t. nycticeboides.[1]

Contents

Taxonomy

Physical description

This small, slender primate is distinguished by large forward-facing eyes used for precise depth perception, long slender limbs, a well-developed index finger, the absence of tail, and large prominent ears, which are thin, rounded and hairless at the edges. The soft dense fur is reddish-brown color on the back, and the underside is whitish-grey with a sprinkling of silver hair. Its body length on average is 7–10 in (180–250 mm), with an average weight of a mere 3–13 oz (85–370 g). This loris has a four-way grip on each foot. The big toe opposes the other 4 toes for a pincer-like grip on branches and food. It has a dark face mask with central pale stripe, much like the slow lorises.

Behavior

The red slender loris is arboreal.
Skeleton of Red Slender Loris.

The Red Slender Loris favors lowland rainforests (up to 700 m in altitude), tropical rainforests and inter-monsoon forests of the south western wet-zone of Sri Lanka. Masmullah Proposed Forest Reserve harbors one of few remaining Red Slender Loris populations, and is considered a biodiversity hotspot. The most common plant species eaten was Humboldtia laurifolia, occurring at 676 trees/ha, with overall density at 1077 trees/ha. Humboldtia laurifolia is vulnerable and has a mutualistic relationship with ants, providing abundant food for lorises.[4] Reports from the 1960s suggest that it once also occurred in the coastal zone, however it is now thought to be extinct there.

The red slender loris differ from its close relative the gray slender loris in its frequent use of rapid arboreal locomotion. It forms small social groups, containing adults of both sexes as well as young animals. This species is among the most social of the nocturnal primates. During daylight hours the animals sleep in groups in branch tangles, or curled up on a branch with their heads between their legs. The groups also undertake mutual grooming and play at wrestling. The adults typically hunt separately during the night. They are primarily insectivorous but also eat bird eggs, berries, leaves, buds and occasionally invertebrates as well as geckos and lizards. To maximize protein and nutrient uptake they consume every part of their prey, including the scales and bones. They make nests out of leaves or find hollows of trees or a similar secure place to live in.

Reproduction

Females are dominant. The female reaches her sexual maturity at 10 months and is receptive to the male twice a year. This species mates while hanging upside down from branches; individuals in captivity will not breed if no suitable branch is available. The gestation period is 166–169 days after which the female will bear 1–2 young which feed from her for 6–7 months. The lifespan of this species is believed to be around 15–18 years in the wild.

Threats

This slender loris is an endangered species. Habitat destruction is a major threat. It is widely trapped and killed for use in supposed remedies for eye diseases and get killed by snakes, dogs, and some fish.[5] Other threats include: electrocution on live wires, road accidents and the pet trade.[6]

Conservation

The red slender loris was identified as one of the top-10 "focal species" in 2007 by the Evolutionarily Distinct and Globally Endangered (EDGE) project.[7]

One early success has been the rediscovery of the virtually unknown Horton Plains slender loris (Loris tardigradus nycticeboides). Originally documented in 1937, there have only been four known encounters in the past 72 years,[8] and for more than 60 years until 2002 the sub-species had been believed to be extinct.[9][10] The late 2009 rediscovery and capture by a team working under the Zoological Society of London's EDGE programme has resulted in the first detailed physical examination of the Horton Plains sub-species and the first-ever photographs of it.[9] The limited available evidence suggests there may be only about 100 animals still existing, which would make it among the top five most-threatened primates worldwide.[10]

References

  1. ^ a b Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 122. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ Nekaris, A. (2008). Loris tardigradus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 1 January 2009.
  3. ^ "Slender loris". EDGE. Archived from the original on 2007-07-01. http://web.archive.org/web/20070701144145/http://www.edgeofexistence.org/species/species_info.asp?id=22. Retrieved 2007-08-13. 
  4. ^ K. Anne-Isola Nekaris, Wasantha K. D. D. Liyanage, Saman N. Gamage (July 2005). "Influence of forest structure and composition on population density of the red slender loris Loris tardigradus tardigradus in Masmullah proposed forest reserve, Sri Lanka". Mammalia 69 (2): 201–210. doi:10.1515/mamm.2005.017. 
  5. ^ Benders-Hyde, Elisabeth (2002). "Slender Loris". http://www.blueplanetbiomes.org/slender_loris.htm. Retrieved 2007-07-24. 
  6. ^ K. A. I. Nekaris, J. Jayewardene (2004). "Survey of the slender loris (Primates, Lorisidae Gray, 1821: Loris tardigradus Linnaeus, 1758 and Loris lydekkerianus Cabrera, 1908) in Sri Lanka". Journal of Zoology 262 (4): 327–338. doi:10.1017/S0952836903004710. 
  7. ^ "Protection for 'weirdest' species". BBC. 2007-01-16. http://news.bbc.co.uk/2/hi/science/nature/6263331.stm. Retrieved 2007-05-22. 
  8. ^ http://www.spiegel.de/wissenschaft/natur/0,1518,707502,00.html Der Spiegel (German) article about the rediscovery
  9. ^ a b Krishan, Francis (19 July 2010). "Rare Sri Lankan primate gets 1st wide-eyed closeup". The Oregonian (from the Associated Press). http://www.oregonlive.com/newsflash/index.ssf?/base/international-34/127957441022880.xml&storylist=international. Retrieved 2010-07-23. 
  10. ^ a b Smith, Lewis (19 July 2010). "Found: Sri Lankan primate thought to be extinct for 60 years". The Guardian. http://www.guardian.co.uk/world/2010/jul/19/horton-plains-slender-loris-found. Retrieved 2010-07-23. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!