Overview

Brief Summary

Biology

The ruffed lemurs are arboreal forest dwellers, getting around by walking or running on larger branches and leaping from tree to tree (5). They enjoy a rich diet of fruit, nectar, seeds and leaves, obtaining the nectar by using their long snouts and tongues to reach deep inside the flowers. They are active mainly in the early morning and late afternoon (6), though nocturnal behaviour has been observed. Indeed the word 'lemur' means a 'night wandering ghost' referring to their stealthy, noiseless movement through the forest by night. When alarmed by predators, however, these primates are far from quiet, emitting an elaborate system of loud barks through the forest to alert other group members (3). These lemurs are social animals, with group sizes typically varying from 2-5 individuals, but occasionally numbering up to 30; their home ranges vary in size accordingly (6). Within the group the strongest bonds form between females, whilst those between males are much weaker. Interestingly, females are dominant to males, forming the core of the group and defending the territories, a system common only to Malagasy lemurs (3). Grouping patterns also change with the seasons, with females forming larger groups during the wet season and dispersing during the dry season in search of food. Social bonds in groups are established and reinforced by grooming, but whereas most other primates groom with their fingers, prosimians such as the ruffed lemur cannot manipulate their fingers and instead have developed an usual fascinating behaviour; their 6 bottom teeth project away from the jaw to form a comb which these primates use to groom their fur and the fur of other group members (3). The ruffed lemur reproduces seasonally with mating occurring between May and July, and the offspring are born in September and October (6). Unlike other lemurs, the ruffed lemurs give birth in well-concealed nests constructed of twigs and leaves, held 10 – 20 meters above the ground. Twins are the norm and after only four months the young are independent and as mobile and active as adults. However, infant mortality is high with about 65% of offspring failing to reach 3 months of age, dying from accidental falls and related injuries (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The ruffed lemur is the largest of the lemur family, and is divided into two very distinctive subspecies; the black-and-white ruffed lemur (V. variegata) and the red ruffed lemur (V. rubra) (2). The two subspecies are similar in shape, size, life history and behaviour but are different in colouration and habitat. The black-and-white ruffed lemur has, as its name suggests, a black and white pelage with white tufted ears, a long tail and bright, beady yellow eyes (5). The red ruffed lemur is a striking chestnut red colour, with a much more dense and luxuriant pelage, and a black coloured face, limbs and tail. Recent genetic studies strongly suggest that these two forms merit distinction as separate species, though a decision has not been made as yet (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species inhabits lowland to mid-altitude rain forests (sea level to 1,350 m) in eastern Madagascar. There are three subspecies:

The subspecies V. v. subcincta is assumed to represent the northernmost subspecies, the northern limit of its range being the Antainambalana River (east of which occurs the Red Ruffed Lemur). Its range extends southwards to the Anova River, including part of Makira, Mananara-Nord, Atialanankorendrina, and Marotandrano. This subspecies was introduced to the island of Nosy Mangabe in the Bay of Antongil back in the 1930s and still occurs there (Kuhn 1972). The distribution of this lemur is very patchy throughout its range, except for Nosy Mangabe, where it lives at a relatively high density (Morland 1991).

The nominate subspecies V. v. variegata occurs south of the Anove River, from about Ambatovaky south to about Betampona and Zahamena National Park (including Ambatovaky), although the southern limit is not yet clearly defined.

The subspecies V. v. editorum is the southernmost subspecies and is known with certainty only from Mantadia southwards to Manombo Special Reserve. According to Groves (2001), the ranges of V. v. editorum and V. v. variegata overlap, and intermediate forms exist. The form occurring in Mangerivola Special Reserve is unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Ruffed lemurs, Varecia variegata, are found in the eastern rain forest of Madagascar. Two subspecies are recognized: V. v. variegata and V. v. rubra. The Antainambalana River geographically separates the two subspecies; V. v. rubra is found north of the river, and V. v. variegata is found south. The latter subspecies is also found on the island of Nosy Mangabe.

Biogeographic Regions: ethiopian (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The ruffed lemur, like all other lemurs, is endemic to Madagascar, a large island off the east coast of Africa. The black-and-white ruffed lemur inhabits the eastern rainforests of Madagascar, while the red ruffed lemur is restricted to the north east of the island and lives in the primary and secondary forests of the Masoala Peninsula. The Antainambalana River divides the ranges of these two subspecies (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Lemurs have long, soft fur and are famous for variation of color and pattern. In fact, many consider ruffed lemurs to be the most beautiful species in its family. At least five different coat patterns are found among these lemurs, including one in which an orangish-red color replaces almost all of the white coloration.

Black and white ruffed lemurs are among the largest of the true lemurs, with a head and body length of 51 to 60 cm and tail length of 56 to 65 cm (Nowak, 1987). Weights range from 3.2 to 4.5 kg. Females are larger than males (Black and White Ruffed Lemur, 1996).

The coat is long and soft, and color pattern may vary on different sides of the body (Nowak, 1987). In V. v. variegata, the coat is mostly black with large white areas on the head, back and limbs. The genus Varecia has a marking gland on the neck unlike Lemur, Eulemur, and Petterus (Nowak, 1987). In addition, other genera have only one pair of mammae, whereas Varecia has three pair.

Range mass: 3.2 to 4.5 kg.

Range length: 51 to 60 cm.

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is very patchily distributed in lowland to mid-altitude rain forests. Black-and-white Ruffed Lemurs maintain large home ranges consisting of primary forest with tall trees. They are almost exclusively frugivorous, and as they are very selective feeders, this makes them especially susceptible to disturbance (e.g. see White et al. 1995, Ratsimbazafy 2002). Group size and structure appear to vary considerably between study sites. Females usually give birth to two to three young, which are left in a nest when young and afterwards carried in the mother?s mouth. Ruffed lemurs are probably the only primates that build nests exclusively for the birth and the first days of rearing infants (Mittermeier et al. 2008, and references therein).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Ruffed lemurs are tree dwellers and are the most arboreal of the true lemurs (AZA, 1994). They inhabit the wet evergreen forest on the eastern coast of Madagascar (Black and White Ruffed Lemur, 1996).

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This species inhabits primary and secondary lowland and mid-altitude rainforest in Madagascar (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Varecia variegata is the most frugivorous of the living lemurs, but it also feeds on leaves, seeds and nectar according to the season (Primate of the Week, 1996). They have also been known to eat soil at times (Black and White Ruffed Lemur, 1996).

Plant Foods: leaves; seeds, grains, and nuts; fruit; nectar

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As frugivores, these lemurs are likely to play some role in seed dispersal. To the extent that they serve as prey for other animals, they may also influence local food webs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Formal reports of predation upon ruffed lemurs are not available. However, likely predators include raptors, humans, and fossas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

All primates show complex patterns of communication. In addition to their vocalizations, these animals use body postures and facial expressions to communicate. Tactile communication, in the form of grooming, play, and aggression, is also important. Members of both sexes are known to scent mark their territory.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Ruffed lemurs are thought to reach an average maximum age of 19 years.

Average lifespan

Status: wild:
19 years.

Average lifespan

Sex: female

Status: captivity:
32.0 years.

Average lifespan

Status: captivity:
19.0 years.

Average lifespan

Sex: male

Status: captivity:
28.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 36 years (captivity) Observations: One wild born male was living at the Duke University Primate Center at about 36 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating system of these lemurs is not well understood. These animals are usually found in what appear to be family groups, centered on a single mated pair. This indicates that the species is likely to be monogamous. However, because of variation in the social stucture, under which larger groups may be formed, there is a possibility that at least some populations are polygynous breeders.

Mating System: monogamous ; polygynous

Mating appears to occur in June and July. The estrous cycle of female ruffed lemurs lasts approximately 30 days with the estrous period averaging 6.25 days. Gestation is markedly shorter than in other lemurs, typically lasting between 90 and 102 days. Females are capable of having up to 6 offspring from a single pregnancy, but usually only 2 or 3 offspring are born at a time. In fact, over one-half of births are twins. Weaning occurs at approximately 135 days of age, and infants are close to adult size by the time they reach 6 months. Females are able to conceive at 20 months, but the average age of first reproduction is 3.4 years.

Breeding interval: Females are capable of producing young annually.

Breeding season: Breeding occurs in June and July.

Range number of offspring: 2 to 6.

Range gestation period: 90 to 102 days.

Average weaning age: 135 days.

Average age at sexual or reproductive maturity (female): 20 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 87.2 g.

Average number of offspring: 2.2.

Average age at sexual or reproductive maturity (male)

Sex: male:
608 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
604 days.

Mothers build nests for their newborns, usually in the fork of a tree. The female pulls out her own hair to line the nest. When it is necessary for the infant to be carried, the mother uses her mouth. This is distinctly different from most lemurs, whose infants cling to the mother's belly when young, then ride on her back as they get bigger. Infants are allowed to leave the nest at 3 weeks and are as mobile as their parents by the time they are 7 weeks old. The role of males in parental care has not been described.

Parental Investment: altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Varecia variegata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2532-09|NC_012773|Varecia variegata| AACCGTTGATTCTACTCAACAAACCACAAAGATATTGGAACCCTTTATCTCCTATTTGGAGCTTGAGCGGGAATAGTAGGCACAGCCCTT---AGCCTCTTAATTCGAGCAGAACTCGGTCAACCTGGAGCTCTACTAGGAGAT---GATCAAATCTACAATGTCGTCGTAACAGCTCATGCCTTCGTTATAATCTTCTTCATAGTAATACCTATTATAATTGGTGGCTTTGGGAACTGATTAATCCCTTTAATA---ATTGGAGCACCCGATATAGCATTTCCCCGTATAAATAATATAAGCTTCTGACTTTTACCACCATCCTTCCTTCTCCTTCTTGCATCCTCAATAGTAGAAGCAGGTGCAGGAACCGGATGGACTGTTTATCCCCCTCTAGCAGGGAATTTAGCCCATGCAGGGGCCTCTGTAGATCTA---ACTATTTTTTCTCTTCATTTAGCAGGAGTATCCTCAATTTTAGGTGCCATCAACTTTATCACAACAGTAATCAATATGAAACCTCCAGCTATGTCACAGTATCAAACACCTTTATTTGTATGATCTGTAATAATTACCGCCATCCTTCTACTCCTGTCCTTACCTGTCCTAGCAGCA---GGAATTACAATACTCCTAACTGATCGTAACCTAAATACAACTTTCTTTGACCCTGCAGGAGGTGGTGATCCTATTCTCTATCAGCACCTATTTTGATTCTTCGGACACCCCGAAGTCTATATCTTAATCCTTCCTGGTTTCGGTATAATTTCCCACATTGTTACATATTATTCAGGTAAAAAA---GAACCATTTGGCTATATAGGAATAGTCTGAGCCATAGTATCTATTGGCTTCTTAGGGTTCATTGTATGAGCCCATCACATATTCACAGTAGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Varecia variegata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Andrainarivo, C., Andriaholinirina, V.N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R.A., Perieras, A., Princee, F., Rabarivola, J.C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Thalmann, U., Wilmé, L. & Wright, P.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
Listed as Critically Endangered as the species is believed to have undergone a decline of 80% over a period of 27 years, due primarily to a decline in area and quality of habitat within the known range of the species and due to levels of exploitation.

History
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

All lemurs are considered endangered by the U.S. Fish and Wildlife Service and are listed as Appendix I under CITES (AZA, 1994). They are listed as endangered by IUCN. The main threats to the survival of ruffed lemurs are habitat destruction, hunting for meat and fur, and exportation (Black and White Ruffed Lemur,1996).

These lemurs breed well in captivity and have thus benefited from a long-term, organized and well-managed breeding program (Madagascar Fauna Group, 1996). There are now over 225 individuals held in more than 50 North American institutions. Individuals from these populations will be released into established natural reserves in Madagascar.

Education also plays an important role in the conservation of ruffed lemurs. The two zoos of Madagascar with ruffed lemur exhibits are developing educational programs to help the Malagasy people become more environmentally aware (AZA, 1994).

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN A1cd) on the IUCN Red List 2004 (1) and listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population densities recorded range from 0.4-2.5/km² in Manombo, to 10-15 individuals/km² in Antanamalaza, and 29-43 individuals/km² on Nosy Mangabe (Vasey 2003).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The principal threat to its survival is habitat loss due to slash-and-burn agriculture, logging and mining. They are large bodied and diurnal, and therefore also among the most heavily hunted of all lemur species. The seasonality of their vocalizations (due to increased food availability) has been tied to increased levels of hunting (Ratsimbazafy 2002; Vasey 2003). In Makira, where they are one of the more expensive and desired meats, hunting is largely unsustainable (Golden 2005). It is one of the first lemurs to disappear where humans encroach upon rain forest habitats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

As with other lemur species, the ruffed lemurs are threatened by habitat loss through logging and development in Madagascar (6). While this is a problem in many areas worldwide, Madagascar is particularly sensitive as it is an island and therefore has a limited amount of land for its wildlife and expanding human population (2). The ruffed lemur species seems to be particularly susceptible due to its high dependence on large fruiting trees for food in primary forest (2). These animals are also at risk due to extensive hunting on the island for meat and for sale as pets (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix I of CITES.

V. v. subcincta is recorded from Mananara-Nord National Park and Nosy Mangabe Special Reserve. V. v. variegata is recorded from Zahamena National Park, and two nature reserves (Betampona and Zahamena) and from Ambatovaky and Marotandrano Special Reserves. V. v. editorum is recorded from Mantadia National Park, Ranomafana National Park and Manombo Special Reserve. Now extirpated from Analamazaotra Special Reserve, and no longer reported from Andringitra National Park.

Manongarivo, to which it is not possible to assign a subspecies, is a Special Reserve. Fandriana (in the range of V. v. editorum) is in the process of becoming a national park. Unprotected forests such as Tolodoina, Vatovavy, Atialanankorendrina and Makira should be included in protected areas.

In November 1997, V. v. editorum born and raised in US zoological institutions were returned to Madagascar and released in the Betampona Reserve (Britt et al. 2003). The study of this reintroduction effort is ongoing. An education campaign against hunting, using this species as a flagship, is recommended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Since 1994, international trade in ruffed lemur has been prohibited by their listing on Appendix 1 of the Convention of International Trade of Endangered Species (CITES) (4). However, there is a greater threat of habitat destruction. Only about 10% of Madagascar's native vegetation now remains and so conservation efforts are being focussed on protecting the few existing patches of forests (3). The black-and-white ruffed lemur is known to occur in at least ten protected areas in Madagascar, though its numbers are sadly still declining (2). Tragically, the only protected area in which the red ruffed lemur was known to occur, the former Masoala Nature Reserve, was degazzetted in 1964 to permit timbering (9). This has had on-going devastating consequences for the ruffed lemur and other wildlife. In 1997 the Masoala National Park was re-opened, administered by ANGAP, an NGO affiliated with the Malagasy Government, with assistance from the Wildlife Conservation Society, Missouri Botanical Garden, CARE and the Peregrine Fund. This goes far toward protecting the red ruffed lemurs (11). As a result the Missouri Botanical Garden has taken action and proposed the creation of a 300,000 hectare national park on the Masoala Peninsula, with funding from USAID and other sources. There are also plans for staff training, research facilities and education programmes, with responsibility for the parks management lying with the regional forest association (9). It is hoped that this reserve will be a safe-haven for the red ruffed lemur. In North America, a captive breeding project for the ruffed lemur has been underway since the 1960s, under the Species Survival Plan (SSP) (10). The project has focused on increasing the genetic diversity of both the red and black-and-white ruffed lemur subspecies (10). Although this project has been a success, housing space for the lemurs is limited, restricting the success of the breeding program (10). Nine individuals of the black and white form were re-introduced to the Betampona Reserve in the Eastern forest between 1997 and 2001. This was a complex operation, beginning with choosing the captive ruffed which were genetically closest to the wild population of the local region. The released lemurs were closely monitored because animals which did not grow up in the wild have great difficulty in adapting. They fall prey to predators, or simply fall out of trees. Only one male survives, now integrated into a wild group, and one other pair produced triplets. Reintroduction is a long and costly process compared to protecting animals in their original habitat (12). It is hoped that ruffed lemurs will be reintroduced in Madagascar, though it is imperative that the reintroduction areas are declared safe first (2). There is now new hope for the ruffed lemur in Madagascar with captive breeding projects successfully underway, reintroduction programmes on the horizon and reserves being reviewed in Madagascar. It is however important that these become long term projects in order to allow the ruffed lemur time and space to recover (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Ruffed lemurs are not known to have any adverse effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Ruffed lemurs are both trapped and shot in Madagascar for the economic benefit of humans. Ruffed lemurs are often hunted for food, and they are also sold to humans as pets. Because they are such entertaining animals, these charismatic creatures, along with other lemur species, may bring ecotourists to Madagascar.

Positive Impacts: pet trade ; food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black-and-white ruffed lemur

The black-and-white ruffed lemur (Varecia variegata) is the more endangered of the two species of ruffed lemurs, both of which are endemic to the island of Madagascar. Despite having a larger range than the red ruffed lemur, it has a much smaller population that is spread out, living in lower population densities and reproductively isolated. It also has less coverage and protection in large national parks than the red ruffed lemur. Three subspecies of black-and-white ruffed lemur have been recognized since the red ruffed lemur was elevated to species status in 2001.[3]

Together with the red ruffed lemur, they are the largest extant members of the family Lemuridae, ranging in length from 100 to 120 cm (3.3 to 3.9 ft) and weighing between 3.1 and 4.1 kg (6.8 and 9.0 lb).[5] They are arboreal, spending most of their time in the high canopy of the seasonal rainforests on the eastern side of the island. They are also diurnal, active exclusively in daylight hours. Quadrupedal locomotion is preferred in the trees and on the ground, and suspensory behavior is seen during feeding. As the most frugivorous of lemurs, the diet consists mainly of fruit, although nectar and flowers are also favored, followed by leaves and some seeds.[6]

The black-and-white ruffed lemur has a complex social structure and is known for its loud, raucous calls.[3] It is unusual in that it exhibits several reproductive traits typically found in small, nocturnal lemurs, such as short a gestation period, large litters and rapid maturation.[6] In captivity, they can live up to 36 years.[7]

Contents

Taxonomic classification

The black-and-white ruffed lemur is one of two species within the genus Varecia, and has three subspecies. Of the three subspecies, the white-belted black-and-white ruffed lemur (Varecia variegata subcincta) is found furthest to the north,[8] the southern black-and-white ruffed lemur (Varecia variegata editorum) is found furthest to the south,[9] and the black-and-white ruffed lemur (Varecia variegata variegata) has a geographic range between the other two subspecies.[10]

Anatomy and physiology

Black and white ruffed lemur eating fruit

The black-and-white ruffed lemur is black with white areas on its limbs head and back. Its neck has a mane and the face has a muzzle like a dog's. Males and females look the same.

Threats in the wild

The black-and-white ruffed lemur is preyed upon by the Henst's goshawk (Accipiter henstii), fossa (Cryptoprocta ferox), ring-tailed mongoose (Galidia elegans) and brown-tailed mongoose (Salanoia concolor). Nesting behavior poses the greatest risks for predation, especially mammalian predators.


References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 117. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100061. 
  2. ^ Andrainarivo, C., et al. (2008). Varecia variegata. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 6 Oct 2008. Listed as Critically Endangered (CR A2cd v3.1)
  3. ^ a b c Mittermeier, R.A.; et al. (2006). Lemurs of Madagascar (2nd Edition ed.). Conservation International. pp. 303–320. ISBN 1-881173-88-7. 
  4. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100062. 
  5. ^ Garbutt, Nick (2007). Mammals of Madagascar, A Complete Guide. A&C Black Publishers. pp. 170–173. ISBN 978-0-300-12550-4. 
  6. ^ a b Sussman, R.W. (2003) [1999]. Primate Ecology and Social Structure. Vol. 1: Lorises, Lemurs, and Tarsiers (Revised 1st Edition ed.). Pearson Custom Publishing. pp. 195–200. ISBN 0-536-74363-0. 
  7. ^ Gron, KJ (17 August 2007). "Primate Factsheets: Ruffed lemur (Varecia) Taxonomy, Morphology, & Ecology". Wisconsin Primate Research Center (WPRC). http://pin.primate.wisc.edu/factsheets/entry/ruffed_lemur. Retrieved 19 September 2008. 
  8. ^ Andrainarivo, C., Andriaholinirina, V. N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R. A., Perieras, A., Princee, F., Rabarivola, J. C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Thalmann, U., Wilmé, L. & Wright, P. (2008). Varecia variegata ssp. subcincta. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 3 May 2009.
  9. ^ Andrainarivo, C., Andriaholinirina, V. N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R. A., Perieras, A., Princee, F., Rabarivola, J. C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Thalmann, U., Wilmé, L. & Wright, P. (2008). Varecia variegata ssp. editorum. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 3 May 2009.
  10. ^ Andrainarivo, C., Andriaholinirina, V. N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R. A., Perieras, A., Princee, F., Rabarivola, J. C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Thalmann, U., Wilmé, L. & Wright, P. (2008). Varecia variegata ssp. variegata. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 3 May 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Black-and-white Ruffed Lemur

The Black-and-white Ruffed Lemur (Varecia variegata) is the most endangered of the two species of ruffed lemurs, both of which are endemic to the island of Madagascar. Despite having a larger range than the Red Ruffed Lemur, it has a much smaller population that is spread out, living in lower population densities and reproductively isolated. It also has less coverage and protection in large national parks than the Red Ruffed Lemur. Three subspecies of Black-and-white Ruffed Lemur have been recognized since the Red Ruffed Lemur was elevated to species status in 2001.[3]

Together with the Red Ruffed Lemur, they are the largest extant members of the family Lemuridae, ranging in length from 100 to 120 cm (3.3 to 3.9 ft) and weighing between 3.1 and 4.1 kg (6.8 and 9.0 lb).[5] They are arboreal, spending most of their time in the high canopy of the seasonal rainforests on the eastern side of the island. They are also diurnal, active exclusively in daylight hours. Quadrupedal locomotion is preferred in the trees and on the ground, and suspensory behavior is seen during feeding. As the most frugivorous of lemurs, the diet consists mainly of fruit, although nectar and flowers are also favored, followed by leaves and some seeds.[6]

The Black-and-White Ruffed Lemur has a complex social structure and is known for its loud, raucous calls.[3] It is unusual in that it exhibits several reproductive traits typically found in small, nocturnal lemurs, such as short a gestation period, large litters and rapid maturation.[6] Along with the Red Ruffed Lemur, they are the only primates to build nests.[3] In captivity, they can live up to 36 years.[7]

Contents

Taxonomic classification

The Black-and-white Ruffed Lemur is one of two species within the genus Varecia, and has three subspecies. Of the three subspecies, the White-belted Black-and-white Ruffed Lemur (Varecia variegata subcincta) is found furthest to the north,[8] the Southern Black-and-white Ruffed Lemur (Varecia variegata editorum) is found furthest to the south,[9] and the Black-and-white Ruffed Lemur (Varecia variegata variegata) has a geographic range between the other two subspecies.[10]

Anatomy and physiology

The Black-and-white Ruffed Lemur is black with white areas on its limbs head and back. Its neck has a mane and the face has a muzzle like a dog's. Males and females look the same.

Threats in the wild

The Black-and-white Ruffed Lemur is preyed upon by the Henst's Goshawk (Accipiter henstii), Fossa (Cryptoprocta ferox), Ring-tailed Mongoose (Galidia elegans) and Brown-tailed Mongoose (Salanoia concolor). Nesting behavior poses the greatest risks for predation, especially mammalian predators.

References

  1. ^ Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 117. ISBN 0-801-88221-4. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=12100061. 
  2. ^ Andrainarivo, C., et al. (2008). Varecia variegata. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 6 Oct 2008. Listed as Critically Endangered (CR A2cd v3.1)
  3. ^ a b c d Mittermeier, R.A.; et al. (2006). Lemurs of Madagascar (2nd Edition ed.). Conservation International. pp. 303–320. ISBN 1-881173-88-7. 
  4. ^ Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. ISBN 0-801-88221-4. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=12100062. 
  5. ^ Garbutt, Nick (2007). Mammals of Madagascar, A Complete Guide. A&C Black Publishers. pp. 170–173. ISBN 978-0-300-12550-4. 
  6. ^ a b Sussman, R.W. (2003) [1999]. Primate Ecology and Social Structure. Vol. 1: Lorises, Lemurs, and Tarsiers (Revised 1st Edition ed.). Pearson Custom Publishing. pp. 195–200. ISBN 0-536-74363-0. 
  7. ^ Gron, KJ (17 August 2007). "Primate Factsheets: Ruffed lemur (Varecia) Taxonomy, Morphology, & Ecology". Wisconsin Primate Research Center (WPRC). http://pin.primate.wisc.edu/factsheets/entry/ruffed_lemur. Retrieved 19 September 2008. 
  8. ^ Andrainarivo, C., Andriaholinirina, V. N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R. A., Perieras, A., Princee, F., Rabarivola, J. C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Thalmann, U., Wilmé, L. & Wright, P. (2008). Varecia variegata ssp. subcincta. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 3 May 2009.
  9. ^ Andrainarivo, C., Andriaholinirina, V. N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R. A., Perieras, A., Princee, F., Rabarivola, J. C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Thalmann, U., Wilmé, L. & Wright, P. (2008). Varecia variegata ssp. editorum. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 3 May 2009.
  10. ^ Andrainarivo, C., Andriaholinirina, V. N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R. A., Perieras, A., Princee, F., Rabarivola, J. C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Thalmann, U., Wilmé, L. & Wright, P. (2008). Varecia variegata ssp. variegata. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 3 May 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!