Overview

Brief Summary

Biology

Both sexes of the ring-tailed lemur maintain complex dominance relationships, but there are no actual hierarchies (3). Both males and females mark their territory boundaries; females use genital smears and males use scent from a wrist gland that they gouge into bark with the help of a horny pad on the wrist. However, home ranges overlap, and groups, numbering between 3 and 20 individuals, may come into contact. In such circumstances females will attempt to intimidate the opposing group by staring, and occasionally will fight briefly before retreating to the centre of the range (2). Following increased scent marking by females (5), mating takes place in a short period in mid April, resulting in synchronous births four months later in August and September (2). The purpose of this careful timing is to ensure that the young are weaned just as fruit becomes plentiful. Males compete for access to females, daubing their tails with scent from their wrist glands and wafting this pungent odour towards their opponent. These stink fights are commonly sufficient to establish rank, but fights can occur. Males might move between groups during the mating season to impregnate as many females as possible. After 134 – 138 days of gestation the females give birth to one or occasionally two young (3). Groups of females share the parental duties and form crèches. Young initially cling to the underside of a female, but will ride on her back when larger (6). All male offspring leave their natal group once mature, and will continue to transfer groups every three to five years throughout their life (2). These diurnal lemurs feed on the fruit, leaves, flowers, bark and sap from over 30 plant species (1). They are particularly social; sunbathing in groups in a characteristic yoga-like position, as well as spending much of their time grooming each other (7). They are also highly communicative, using several calls to unite members of a group, defend the territory and sound the alarm. Predators include the fossa (Cryptoprocta ferox) which preys upon both young and adults, as well as the Madagascar harrier hawk (Polyboroides radiatus) and the Madagascar buzzard (Buteo brachypterus) which only take young (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Impossible to confuse with any other species, the ring-tailed lemur has a distinctive long and bushy black-and-white-ringed tail. These medium-sized lemurs move quadrupedally and are the most terrestrial of Madagascar's primates. The back is greyish-brown and the rump and limbs are grey. The underparts are cream and the neck and crown are dark grey. The face is white with large, dark, triangular patches around the eyes. The snout is also dark, but the ears are lighter than the crown. An isolated population in the Andringitra Massif has a slightly different appearance, tending towards darker, redder fur and with fewer black rings on the tail. The taxonomic status of this population has not yet been determined (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Ring-tailed Lemur is found in the dry forests and bush of southern and south-western Madagascar. The north-western boundary is north of the Mangoky River at Belo sur Mer or Mahababoky and slightly more inland within the Kirindy-Mitea National Park. The south-eastern limit ends at the divide between the western and eastern watersheds, which is aligned with the division between western dry and eastern humid vegetation types. All records from the Andohahela National Park are from the extreme western portion, at the ecotone between dry and humid forests. The north-eastern limit is more complex; the most north-easterly site is Ankafina, but this is from an animal collected in 1881 (see Goodman et al. 2006). A seemingly isolated population also occurs at altitudes up to 2,600 m in the mountains of Andringitra on the south-eastern plateau (Goodman and Langrand 1996; Yoder et al. 1999). Throughout the range of this species, its distribution is best described as patchy. Sussman et al. (2003) consider that the overall geographical distribution of Ring-tailed Lemurs has not changed much over the past 50 years, and may even be wider than previously thought.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Ringtailed lemurs, Lemur catta, inhabit southern and southwestern Madagascar, with an additional population on the southeastern plateau of the Andringita Mountains.

Biogeographic Regions: ethiopian (Native ); oceanic islands (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Endemic to south-central and southwest Madagascar (1), with an isolated population in the Andringitra Massif on the south-eastern plateau (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Lemur catta is an average sized lemur, with a head and body length of 385 to 455 mm. The tail is longer than the body, measuring 560 to 624 mm. Individuals weigh between 2.3 and 3.5 kg.

The most noticeable characteristic of Lemur catta is its tail, which is black and white. In fact, the species gets its common name from the ringed pattern of the fur on the tail. These lemurs have gray or rosy brown backs with lighter gray or brown hind legs and white stomachs. Their faces are also white with triangular black markings around their eyes and black noses.

Range mass: 2.3 to 3.5 kg.

Range length: 385 to 455 mm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits many habitat types throughout its range in the southern third of Madagascar, including spiny bush, lowland gallery forest, anthropogenic savanna, dry deciduous forest, rock canyons and upland inland areas. Indeed, at the upper portion of its elevation range on Andringitra, the species occurs in a zone above the forest line and in a vast expanse of vertical rock, with up to 400-m tall talwegs, surrounded by ericoid savanna. It encounters the most extreme climatic conditions on the island from the hottest and driest to the coldest (Andringitra Massif). It has a varied diet, and does not seem to be constrained by available water sources (Goodman et al. 2006). This is the best-studied of Madagascar's lemurs; its biology and ecology have been summarized most recently by Jolly (2003) and Mittermeier et al. (2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Lemurs spend most of their time in the trees, but this species also spends considerable time on the ground. Ring tailed lemurs prefer gallery forests and Euphorbia bush habitat, but they also live in many other types of forests in Madagascar.

In the Berenty Reserve in southern Madagascar, ring tailed lemurs inhabit 3 different types of forest. These include the Ankoba forest, which consists of Pithosolobium trees and a few tamarinds, figs, and Melia; the Malaza forest, which consists of Tamarindus indicus, tall figs, celtis, and creteva. (The sub-canopy of this forest type consists of Rhinorhea and Celtis, with great numbers of peppers and sometimes capers.); and finally the Berenty Reserve, which is a spiny forest. Lemur catta does not spend as much time here, but can occasionally be seen. The spiny forest contains trees called Alaudia and Euphorbia, which look like cacti. Kalanchoe, Aloe, and Xerisicyos are also found in the area.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The ring-tailed lemur inhabits dry brush and scrub, as well as closed canopy forest. Unlike other lemur species it is found in open areas and will walk along the ground as well as moving between the trees (1). The population in the Andringitra Massif is found at higher elevations with exposed rocks, low bush and sub-alpine vegetation (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

These lemurs are not meat eaters. They feed on plants, leaves, flowers, fruit, and even sap and bark. They feed from many different species of plants and trees, but are partial to Kily trees. Occasionally they eat insects.

Animal Foods: insects

Plant Foods: leaves; wood, bark, or stems; fruit; flowers; sap or other plant fluids

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Because of their occasional frugivory, ring tailed lemurs may aid in dispersing some seeds. To the extent that they serve as prey to other animals, they may influence local food webs. Their feeding behaviors may contribute to the structure of local plant communities.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Data on predation is lacking for this species. However, L. catta is not very large, and could fall prey to any number of mid-sized predators. Likely predators include humans, domestic dogs, raptors, and fossas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As in other diurnal primates, communication is complex. Visual communication signals, such as body postures and facial expressions are used, in addition to vocal communication. Ring tailed lemurs are known to use scent marking, and even to engage in "stink battles" with one another, where secretions from scent glands are rubbed onto the tail, then wafted at opposing animals. Tactile communication is important between mothers and their young, as well as between mates. This includes grooming, play, and mating.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

A captive ring-tailed lemur is reported to have lived in excess of 33 years.

Range lifespan

Status: captivity:
33+ (high) years.

Average lifespan

Status: captivity:
20.0 years.

Average lifespan

Status: captivity:
26.0 years.

Average lifespan

Status: wild:
27.1 years.

Average lifespan

Sex: female

Status: captivity:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 37.3 years (captivity) Observations: One 37.3 year old female was still alive in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

These animals breed polygynously. Although they live in multi-male, multi-female troops, there is typically one central male who interacts more with females than do the other males.

The mating season is the time when the most fighting occurs. Females compete among themselves for space and resources, and males fight for reproductive access to females. These fights include the infamous stink fights, where males rub their tails with scents from glands in their wrists and genitals, and then aim their tails at their opponents.

Mating System: polygynous

Lemur catta mates from mid April to June and gives birth in August or September. Females are in estrus for less than one day, and all of the females within a troop come into estrus within 2 weeks of each other. The normal gestation period is 4 to 4.5 months, after which females give birth to 1 or 2 young. Infant mortality is high, with 30 to 50% of newborns dying in the first year of their lives. Surviving young are weaned some time after 5 months of age.

Males are capable of breeding by about 2.5 years of age, but may not be allowed to do so by older males in the group. Females usually have their first offspring at the age of 3 years and continue to produce offspring annually.

Breeding interval: Females are capable of breeding annually.

Breeding season: Lemur catta breeds from mid April through June.

Range number of offspring: 1 to 2.

Range gestation period: 4 to 4.5 months.

Range weaning age: 5 (high) months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 2.5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 70.6 g.

Average number of offspring: 1.1.

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
595 days.

Females provide the bulk of the care for their offspring. They shelter, groom, carry, and feed the young. Young are initially carried on the abdomen, but as they grow, they begin to ride on the mother's back. Although young take solid food by the time they are a two months old, they may not be weaned until they are as old as 5 months. The role of males in parental care has not been described.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lemur catta

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0573-06|NC_004025|Lemur catta| AATCGTTGATTTTATTCAACTAACCATAAAGACATTGGAACTCTTTATCTATTATTCGGAGCTTGAGCAGGCATGGTAGGAACAGCTCTC---AGCCTTTTAATTCGAGCAGAACTAGGTCAACCTGGGTCTCTGTTAGGAGAC---GACCAGATCTACAACGTTGTTGTAACAGCTCATGCTTTCGTCATAATCTTTTTCATAGTTATACCTATTATAATTGGAGGCTTCGGAAACTGATTAGTTCCATTAATA---ATTGGAGCTCCTGATATAGCATTCCCCCGAATAAACAATATAAGCTTCTGACTTCTACCACCTTCCTTTCTATTACTCCTAGCATCATCAATAGTAGAAGCTGGGGCAGGAACAGGATGAACCGTATACCCTCCTTTAGCAGGAAACTTGGCTCACGCAGGAGCCTCCGTAGACCTA---ACAATTTTTTCCTTACATCTAGCAGGGGTATCCTCTATTTTAGGCGCCATCAACTTCATTACAACAGTAATTAATATAAAACCTCCAGCCATATCACAATACCAAACACCTTTATTCGTGTGATCTGTAATAATTACTGCTGTTCTTCTACTTCTATCTTTACCAGTTTTAGCAGCA---GGTATTACAATACTTCTAACTGACCGTAATCTTAACACAACCTTTTTTGACCCTGCAGGCGGCGGTGATCCTATTCTATATCAACACTTATTCTGATTTTTTGGACACCCTGAAGTCTACATCTTAATTCTCCCAGGCTTTGGCATAATTTCCCATATCGTCACATATTATTCAGGTAAAAAA---GAACCATTCGGTTACATGGGTATAGTCTGAGCCATAATATCTATTGGTTTCTTAGGATTCATCGTGTGAGCTCACCATATATTCACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lemur catta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Species: 11
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Andrainarivo, C., Andriaholinirina, V.N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R.A., Perieras, A., Princee, F., Rabarivola, J.C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Sussman, R., Thalmann, U., Wilmé, L. & Wright, P.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Listed as Near Threatened as the species is thought to have undergone a reduction of 20-25% over the past 24 years (assuming a generation length of 8 years) due primarily to a decline in area and quality of habitat within the known range of the species and due to known levels of exploitation. Almost qualifies as threatened under criterion A2cd.

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Lemur catta is threatened in Madagascar because of habitat loss due to fires, overgrazing by livestock, and tree cutting for charcoal production. The IUCN/SSC Primate Specialist Group's Lemurs of Madagascar: An Action Plan for Their Conservation gave the species a "High Priority" rating (5).

US Federal List: endangered

CITES: appendix ii

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The ring-tailed lemur is classified as Vulnerable (VU A1c) on the IUCN Red List 2004 (1) and is listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population densities vary with habitat type, but are generally low, ranging from 100 individuals/km² in the dry forests of the Beza Mahafaly Special Reserve to 250 individuals/km² and 600 individuals/km² in the gallery forests and secondary forests of the Berenty Private Reserve, respectively (see Mittermeier et al. 2008, and references therein).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Habitat loss and hunting are the greatest causes of concern. The Ring-tailed Lemur has a strong preference for gallery forests and for Euphorbia bush, but these habitats are already restricted in southern Madagascar and continue to diminish due to annual burning practices that help create new pasture for livestock. Subsequent over-grazing and the felling of trees for charcoal production further impact wildlife populations. This species is also hunted for food in certain areas and frequently kept as a pet.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Satellite imagery of Madagascar over the last few decades has revealed the full extent of habitat loss that the island has suffered. Fires, over-grazing by livestock, tree-cutting for charcoal production, and development have all contributed to the severe changes that this unique island has seen (7). The ring-tailed lemur is still hunted in many areas and individuals are trapped and kept as pets (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix I of CITES. It is found in a number of protected areas including six national parks (Andohahela, Andringitra, Isalo, Kirindy-Mitea, Tsimanampetsotsa, Zombitse, and Vohibasia), three special reserves (Beza Mahafaly, Kalambatritra and southern Pic d'Ivohibe), and the Berenty Private Reserve. It has also been reported recently from the unprotected forests of Ankoba, Ankodida, Anjatsikolo, Bereny, Mahazoarivo, Masiabiby, and Mikea (Mittermeier et al. 2008, and references therein). Many of the best remaining forest patches within the range of L. catta, and where it appears to occur at the highest densities, are found on sacred lands (Sussman et al. 2003)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Despite being so well-known and valued, the ring-tailed lemur is thought to be at serious long-term risk, so conservation action is important. It is found in all five of the protected areas in its range, as well as two private reserves. Much research is being carried out on ring-tailed lemur populations to discover more about their behaviour, ecology and movements. There is a large and active captive breeding programme for this species, as many individuals are held in captivity around the world (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Although L. catta is not known to have direct negative effects on human economies, the effort to save lemur habitat may interfere with other economic ventures, such as charcoal production and farming.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Ring tailed lemurs are a popular sight for tourists and are easily found in protected reserves such as Isalo National Park, The Andohahela, Andringita, and Tsimanampetsotsa Nature Reserves, The Beza Mahafaly Special Reserve, and The Berenty Private Reserve. The attraction of tourists brings in valuable money for Madagascar.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ring-tailed lemur

The ring-tailed lemur (Lemur catta) is a large strepsirrhine primate and the most recognized lemur due to its long, black and white ringed tail. It belongs to Lemuridae, one of five lemur families, and is the only member of the Lemur genus. Like all lemurs it is endemic to the island of Madagascar. Known locally in Malagasy as maky (spelled maki in French) or hira, it inhabits gallery forests to spiny scrub in the southern regions of the island. It is omnivorous and the most terrestrial of lemurs. The animal is diurnal, being active exclusively in daylight hours.

The ring-tailed lemur is highly social, living in groups of up to 30 individuals. It is also female dominant, a trait common among lemurs. To keep warm and reaffirm social bonds, groups will huddle together. The ring-tailed lemur will also sunbathe, sitting upright facing its underside, with its thinner white fur towards the sun. Like other lemurs, this species relies strongly on its sense of smell and marks its territory with scent glands. The males perform a unique scent marking behavior called spur marking and will participate in stink fights by impregnating their tail with their scent and wafting it at opponents.

As one of the most vocal primates, the ring-tailed lemur uses numerous vocalizations including group cohesion and alarm calls. Experiments have shown that the ring-tailed lemur, despite the lack of a large brain (relative to simiiform primates), can organize sequences, understand basic arithmetic operations and preferentially select tools based on functional qualities.

Despite being listed as Near Threatened by the IUCN Red List and suffering from habitat destruction, the ring-tailed lemur reproduces readily in captivity and is the most populous lemur in zoos worldwide, numbering more than 2,000 individuals. It typically lives 16 to 19 years in the wild and up to 27 years in captivity.

Contents

Etymology

The genus name Lemur was created by Carl Linnaeus, the founder of modern binomial nomenclature, to describe only three species,[5] but the word eventually became the collective name used for all primates endemic to Madagascar. Linnaeus was familiar with the historical works of Virgil and Ovid and their references to the festival of Lemuria, during which specters or ghosts—referred to as lemures—were exorcised. As an analogy to these ghosts from Roman mythology, he created the name "Lemur" to include these prosimian primates[7][8] due to their nocturnal habits and ghost-like appearance.[9] Their noiseless movements at night, reflective eyes, and ghostly cries may also have been a factor. It is even possible that Linnaeus knew that some Malagasy people have held legends that lemurs are the souls of their ancestors.[10]

The species name, catta, refers to the ring-tailed lemur's cat-like appearance. Its purring vocalization is similar to that of the domestic cat.[5]

Evolutionary history

All mammalian fossils from Madagascar come from recent times.[11] Thus, little is known about the evolution of the ring-tailed lemur, let alone the rest of the lemur clade, which comprises the entire endemic primate population of the island. However, chromosomal and molecular evidence suggest that lemurs are more closely related to each other than to other Strepsirrhine primates. For this to have happened, it is thought that a very small ancestral population came to Madagascar via a single rafting event between 50 and 80 million years ago.[7][11][12] Subsequent evolutionary radiation and speciation has created the diversity of Malagasy lemurs seen today.[13]

According to analysis of amino acid sequences, the branching of the family Lemuridae has been dated to 26.1 ±3.3 mya while rRNA sequences of mtDNA place the split at 24.9 ±3.6 mya. The ruffed lemurs are the first genus to split away (most basal) in the family, a view that is further supported by analysis of DNA sequences and karyotypes.[14] Additionally, Molecular data suggests a deep genetic divergence and sister group relationship between the true lemurs (Eulemur) and the remaining three genera: Lemur, Hapalemur, and Prolemur.[15]

The ring-tailed lemur is thought to share closer affinities to the bamboo lemurs of the genera Hapalemur and Prolemur than to the other two genera in its family.[16][17] This has been supported by comparisons in communication, chromosomes, genetics, and several morphological traits, such as scent gland similarities. However, other data concerning immunology and other morphological traits fail to support this close relationship. For example, Hapalemur and Prolemur have short snouts, while the ring-tailed lemur and the rest of Lemuridae have long snouts. However, differences in the relationship between the orbit (eye socket) and the muzzle suggest that the ring-tailed lemur and the true lemurs evolved their elongated faces independently.[15]

The relationship between the ring-tailed lemur and bamboo lemurs (both Hapalemur and Prolemur) is the least understood. Molecular analysis suggests that either the bamboo lemurs diverged from the ring-tailed lemur, making the group monophyletic and supporting the current 3-genera taxonomy, or that the ring-tailed lemur is nested in with the bamboo lemurs.[15]

The karyotype of the ring-tailed lemur has 56 chromosomes, of which four are metacentric (arms of nearly equal length), four are submetacentric (arms of unequal length), and 46 are acrocentric (the short arm is hardly observable). The X chromosome is metacentric and the Y chromosome is acrocentric.[5]

Taxonomic classification

Linnaeus first used the genus name Lemur to describe "Lemur tardigradus" (the red slender loris, now known as Loris tardigradus) in his 1754 catalog of the Museum of King Adolf Frederick. In 1758, his 10th edition of Systema Naturae listed the genus Lemur with three included species, only one of which is still considered to be a lemur while another is no longer considered to be a primate. These species include: Lemur tardigradus, Lemur catta (the ring-tailed lemur), and Lemur volans (the Philippine colugo, now known as Cynocephalus volans). In 1911, Oldfield Thomas made Lemur catta the type species for the genus, despite the term initially being used to describe lorises. On January 10, 1929, the International Commission on Zoological Nomenclature (ICZN) formalized this decision in its publication of Opinion 122.[5][6]

The ring-tailed lemur shares many similarities with ruffed lemurs (genus Varecia) and true lemurs (genus Eulemur), and its skeleton is nearly indistinguishable from that of the true lemurs.[16] Consequently, the three genera were once grouped together in the genus Lemur and more recently are sometimes referred to as subfamily Lemurinae (within family Lemuridae). However, ruffed lemurs were reassigned to the genus Varecia in 1962,[1] and due to similarities between the ring-tailed lemur and the bamboo lemurs, particularly in regards to molecular evidence and scent glands similarities, the true lemurs were moved to the genus Eulemur by Yves Rumpler and Elwyn Simons (1988) as well as Colin Groves and Robert H. Eaglen (1988).[1][5][16][17] In 1991, Ian Tattersall and Jeffrey H. Schwartz reviewed the evidence and came to a different conclusion, instead favoring to return the members of Eulemur and Varecia to the genus Lemur. However, this view was not widely accepted and the genus Lemur remained monotypic, containing only the ring-tailed lemur.[1][17][18] Because the differences in molecular data are so minute between the ring-tailed lemur and both genera of bamboo lemurs, it has been suggested that all three genera be merged.[15]

Because of the difficulty in discerning the relationships within family Lemuridae, not all authorities agree on the taxonomy, although the majority of the primatological community favors the current classification.[18]

Taxonomy of family Lemuridae[1][17][18]Phylogeny of family Lemuridae[12][14][15][19]
Lemuridae 

Varecia (ruffed lemurs)






Lemur (ring-tailed lemur)



Prolemur (greater bamboo lemur)



Hapalemur (lesser bamboo lemurs)




Eulemur (true lemurs)





In 1996, researchers Steven Goodman and Olivier Langrand suggested that the ring-tailed lemur may demonstrate regional variations, particularly a high mountain population at Andringitra Massif that has a thicker coat, lighter coloration, and variations in its tail rings.[5][20] In 2001, primatologist Colin Groves concluded that this does not represent a locally occurring subspecies. This decision was later supported by further fieldwork that showed that the differences fell within the normal range of variation for the species. The thicker coat was considered a local adaptation to extreme low temperatures in the region, and the fading of the fur was attributed to increased exposure to solar radiation. Additional genetic studies in 2000 further supported the conclusion that population did not vary significantly from the other ring-tailed lemur populations on the island.[20][21]

Anatomy and physiology

The ring-tailed lemur is a relatively large lemur. Its average weight is 2.2 kilograms (4.9 lb).[18] Its head–body length ranges between 39 and 46 cm (15 and 18 in), its tail length is 56 and 63 cm (22 and 25 in), and its total length is 95 and 110 cm (37 and 43 in).[5][18] Other measurements include a hind foot length of 102 and 113 mm (4.0 and 4.4 in), ear length of 40 and 48 mm (1.6 and 1.9 in), and cranium length of 78 and 88 mm (3.1 and 3.5 in).[5]

A ring-tailed lemur runs on the ground. Its long tail trails behind it, demonstrating its length relative to the body.
The ring-tailed lemur's tail is longer than its body.

The species has a slender frame and narrow face, fox-like muzzle.[5] The ring-tailed lemur's trademark—a long, bushy tail—is ringed in alternating black and white transverse stripes, numbering 12 or 13 white rings and 13 or 14 black rings, and always ending in a black tip.[5][16][22] The total number of rings nearly matches the approximate number of caudal vertebrae (~25).[23] Its tail is longer than its body[22] and is not prehensile. Instead, it is only used for balance, communication, and group cohesion.[18]

The pelage (fur) is so dense that it can clog electric clippers.[5] The ventral (chest) coat and throat are white or cream. The dorsal (back) coat varies from gray to rosy-brown, sometimes with a brown pygal patch around the tail region, where the fur grades to pale gray or grayish brown. The dorsal coloration is slightly darker around the neck and crown. The hair on the throat, cheeks, and ears is white or off-white and also less dense, allowing the dark skin underneath to show through.[5][6][18] The muzzle is dark grayish and the nose is black, and the eyes are encompassed by black triangular patches.[5][18] Facial vibrissae (whiskers) are developed and found above the lips (mystacal), on the cheeks (genal), and on the eyebrow (superciliary). Vibrissae are also found slightly above the wrist on the underside of the forearm.[5] The ears are relatively large compared to other lemurs and are covered in hair, which has only small tufts if any.[5][6] Although slight pattern variations in the facial region may be seen between individuals, there are no obvious differences between the sexes.[5]

Unlike most diurnal primates, but like all strepsirhine primates, the ring-tailed lemur has a tapetum lucidum, or reflective layer behind the retina of the eye, that enhances night vision.[24] The tapetum is highly visible in this species because the pigmentation of the ocular fundus (back surface of the eye), which is present in—but varies between—all lemurs, is very spotty. The ring-tailed lemur also has a rudimentary foveal depression on the retina. Another shared characteristic with the other strepsirrhine primates is the rhinarium, a moist, naked, glandular nose supported by the upper jaw and protruding beyond the chin. The rhinarium continues down where it divides the upper lip. The upper lip is attached to the premaxilla, preventing the lip from protruding and thus requiring the lemur to lap water rather than using suction.[5]

Close-up of the chest of a male ring-tailed lemur showing one black scent gland above each armpit
Close-up of a male ring-tailed lemur's wrist, showing a black scent gland and a thorn-like spur next to it
Scent glands on a male: the brachial glands on the upper chest (left), and antebrachial gland and spur on the forearm (right)

The skin of the ring-tailed lemur is dark gray or black in color, even in places where the fur is white. It is exposed on the nose, palms, soles, eyelids, lips, and genitalia. The skin is smooth, but the leathery texture of the hands and feet facilitate terrestrial movement. The anus, located at the joint of the tail, is covered when the tail is lowered. The area around the anus (circumanal area) and the perineum are covered in fur. In males, the scrotum lacks fur, is covered in small, horny spines, and the two sacs of the scrotum are divided. The penis is nearly cylindrical in shape and is covered in small spines, as well as having two pairs of larger spines on both sides. Males have a relatively small baculum (penis bone) compared to their size. The scrotum, penis, and prepuce are usually coated with a foul-smelling secretion. Females have a thick, elongated clitoris that protrudes from the labia of the vulva. The opening of the urethra is closer to the clitoris than the vagina, forming a "drip tip."[5]

Females have two pairs of mammary glands (four nipples), but only one pair is functional.[5][6] The anterior pair (closest to the head) are very close to the axillae (armpit).[5] Furless scent glands are present on both males and females. Both genders have small, dark antebrachial (forearm) glands measuring 1 cm long and located on the inner surface of the forearm nearly 25 cm (9.8 in) above the wrist joint.[5][6][18] (This trait is shared between the Lemur and Hapalemur genera.[18]) The gland is soft and compressible, bears fine dermal ridges (like fingerprints), and is connected to the palm by a fine, 2 mm–high, hairless strip.[5] However, only the male has a horny spur that overlays this scent gland.[5][6][18] The spur develops with age through the accumulation of secretions from an underlying gland that may connect through the skin through as many as a thousand minuscule ducts. The males also have brachial (arm) glands on the axillary surface of their shoulders (near the armpit). The brachial gland is larger than the antebrachial gland, covered in short hair around the periphery, and has a naked crescent-shaped orifice near the center. The gland secretes a foul-smelling, brown, sticky substance.[5] The brachial gland is barely developed if present at all in females.[5][6] Both genders also have apocrine and sebaceous glands in their genital or perianal regions,[25] which are covered in fur.[6]

Its fingers are slender, padded, mostly lacking webbing, and semi-dexterous with flat, human-like nails. The thumb is both short and widely separated from the other fingers. Despite being set at a right angle to the palm, the thumb is not opposable since the ball of the joint is fixed in place. As with all strepsirrhines, the hand is ectaxonic (the axis passes through the fourth digit) rather than mesaxonic (the axis passing through the third digit) as seen in monkeys and apes. The fourth digit is the longest, and only slightly longer than the second digit. Likewise, the fifth digit is only slightly longer than the second. The palms are long and leathery,[5] and like other primates, they have dermal ridges to improve grip.[26] The feet are semi-digitigrade and more specialized than the hands. The big toe is opposable and is smaller than the big toe of other lemurs, which are more arboreal. The second toe is short, has a small terminal pad, and has a toilet-claw (sometimes referred to as a grooming claw) specialized for personal grooming, specifically to rake through fur that is unreachable by the mouth.[5] The toilet-claw is a trait shared among nearly all prosimian primates.[27] Unlike other lemurs, the ring-tailed lemur's heel is not covered by fur.[5]

Close-up of a ring-tailed lemur's toes, showing a claw-like nail on the second toe (compared to the nail on the third toe next to it)
Close-up of a ring-tailed lemur's hands, showing black skin and dermal ridges
Close-up of a ring-tailed lemur's foot, showing black skin and a lack of fur on the heel
Like other lemurs, the ring-tailed lemur has a claw-like nail (toilet-claw) on its second toe (left) and dermal ridges on its hands to improve its grip (center). Unlike other lemurs, it lacks fur on its heel (right).

Dentition

Close-up of the front, bottom teeth of a ring-tailed lemur, showing the first six teeth pointing directly forward instead of up-and-down like the canine-like premolar behind them.
The front, lower dentition includes a toothcomb (4 incisors and 2 canine teeth), while the first premolars resemble canines.

The ring-tailed lemur has a dentition of Upper: 2.1.3.3, lower: 2.1.3.3, total: 36, meaning that on each side of the jaw it has two incisors, one canine tooth, three premolars, and three molar teeth.[5] Its deciduous dentition is Upper: 2.1.3, lower: 2.1.3, total: 24.[28] The permanent teeth erupt in the following order: m 1/1 (first molars), i 2/2 (first incisors), i 3/3 (second incisors), C1 (upper canines), m 2/2 (second molars), c1 (lower canines), m 3/3 (third molars), p 4/4 (third premolars), p 3/3 (second premolars), p 2/2 (first premolars).[5]

Its lower incisors (i1 and i2) are long, narrow, and finely spaced while pointing almost straight forward in the mouth (procumbent). Together with the incisor-shaped (incisiform) lower canines (c1), which are slightly larger and also procumbent, form a structure called a toothcomb,[5] a trait unique to nearly all strepsirrhine primates.[29] The toothcomb is used during oral grooming, which involves licking and tooth-scraping. It may also be used for grasping small fruits, removing leaves from the stem when eating, and possibly scraping sap and gum from tree bark. The toothcomb is kept clean using a sublingual organ—a thin, flat, fibrous plate that covers a large part of the base of the tongue. The first lower premolar (p2) following the toothcomb is shaped like a canine (caniniform) and occludes the upper canine, essentially filling the role of the incisiform lower canine. There is also a diastema (gap) between the second and third premolars (p2 and p3).[5]

The upper incisors are small, with the first incisors (I1) space widely from each other, yet closely to the second incisors (I2). Both are compressed between buccolingually (between the cheek and the tongue). The upper canines (C1) are long, have a broad base, and curve down and back (recurved). The upper canines exhibit slight sexual dimorphism, with males exhibiting slightly larger canines than females. Both sexes use them in combat by slashing with them. There is a small diastema between the upper canine and the first premolar (P2), which is smaller and more caniniform than the other premolars. Unlike other lemurs, the first two upper molars (M1 and M2) have prominent lingual cingulae, yet do not have a protostyle.[5]

Ecology

The ring-tailed lemur can leap from tree to tree.

The ring-tailed lemur is diurnal and semi-terrestrial.[30] It is the most terrestrial of lemur species, spending as much as 33% of its time on the ground. However it is still considerably arboreal, spending 23% of its time in the mid-level canopy, 25% in the upper-level canopy, 6% in the emergent layer and 13% in small bushes. Troop travel is 70% terrestrial.[31]

Troop size, home range, and population density vary by region and food availability. Troops typically range in size from 6 to 25, although troops with over 30 individuals have been recorded.[16] The average troop contains 13 to 15 individuals.[16] Home range sizes varies between 6 and 35 hectares (15 and 86 acres).[32] Troops of the ring-tailed lemur will maintain a territory, but overlap is often high. When encounters occur, they are agonistic, or hostile in nature. A troop will usually occupy the same part of its range for three or four days before moving. When it does move, the average traveling distance is 1 km (0.62 mi).[31] Population density ranges from 100 individuals per 1 km2 (0.39 sq mi) in dry forests to 250–600 individuals per km2 in gallery and secondary forests.[22]

The ring-tailed lemur has both native and introduced predators. Native predators include the fossa (Cryptoprocta ferox), the Madagascar Harrier-Hawk (Polyboroides radiatus), the Madagascar Buzzard (Buteo brachypterus) and the Madagascar ground boa (Boa madagascariensis). Introduced predators include the small Indian civet (Viverricula indica), the domestic cat and the domestic dog.[22]

Geographic range and habitat

Two ring-tailed lemurs in their natural habitat, clinging vertically to two small trees close to the ground
The ring-tailed lemur can be found in several protected areas, including Isalo National Park in Madagascar.

Endemic to southern and southwestern Madagascar, the ring-tailed lemur ranges further into highland areas than other lemurs. It inhabits deciduous forests, dry scrub, montane humid forests, and gallery forests (forests along riverbanks). It strongly favors gallery forests, but such forests have now been cleared from much of Madagascar in order to create pasture for livestock.[22][18] Depending on location, temperatures within its geographic range can vary from −12 °C (10 °F)[21] at Andringitra Massif to 48 °C (118 °F) in the spiny forests of Beza Mahafaly Special Reserve.[33]

This species is found as far east as Tôlanaro, inland towards the mountains of Andringitra on the southeastern plateau, among the spiny forests of the southern part of the island,[22][18] and north along the west coast to the town of Belo sur Mer.[5] Historically, the northern limits of its range in the west extended to the Morondava River near Morondava. It can still be found in Kirindy Mitea National Park, just south of Morondava, though at very low densities. It does not occur in Kirindy Forest Reserve, north of Morondava. Its distribution throughout the rest of its range is very spotty, with population densities varying widely.[18]

The ring-tailed lemur can be easily seen in five national parks in Madagascar: Andohahela National Park, Andringitra National Park, Isalo National Park, Tsimanampetsotse National Park, and Zombitse-Vohibasia National Park. It can also be found in Beza-Mahafaly Special Reserve, Kalambatritra Special Reserve, Pic d'Ivohibe Special Reserve, Amboasary Sud, Berenty Private Reserve, Anja Community Reserve, and marginally at Kirindy Mitea National Park. Unprotected forests that the species has been reported in include Ankoba, Ankodida, Anjatsikolo, Anbatotsilongolongo, Bereny, Mahazoarivo, Masiabiby, and Mikea.[18]

Within the protected regions it is known to inhabit, the ring-tailed lemur is sympatric (shares its range) with as many as 24 species of lemur, covering every living genus except Allocebus, Indri, and Varecia. Historically, the species used to be sympatric with the critically endangered southern black-and-white ruffed lemur (Varecia variegata editorum), which was once found at Andringitra National Park; however, no sightings of the ruffed lemur have been reported in recent years.[34]

List of species sympatric with the ring-tailed lemur[34]

In western Madagascar, sympatric ring-tailed lemurs and red-fronted lemurs (Eulemur rufifrons) have been studied together. Little interaction takes place between the two species. While the diets of the two species overlap, they eat in different proportions since the ring-tailed lemur has a more varied diet and spends more time on the ground.[31]

Behavior

Diet

The ring-tailed lemur is an opportunistic omnivore primarily eating fruits and leaves, particularly those of the tamarind tree (Tamarindus indica), known natively as kily.[22][31] When available, tamarind makes up as much as 50% of the diet, especially during the dry, winter season.[22] The ring-tailed lemur eats from as many as three dozen different plant species, and its diet includes flowers, herbs, bark and sap. It has been observed eating decayed wood, earth, spider webs, insect cocoons, arthropods (spiders, caterpillars, cicadas and grasshoppers) and small vertebrates (birds and chameleons).[22] During the dry season it becomes increasingly opportunistic.

Social systems

Troops are classified as multi-male groups, with a matriline as the core group.[35] As with most lemurs, females socially dominate males in all circumstances, including feeding priority. Dominance is enforced by lunging, chasing, cuffing, grabbing and biting. Young females do not always inherit their mother's rank and young males leave the troop between three and five years of age.[31][35] Both sexes have separate dominance hierarchies; females have a distinct hierarchy while male rank is correlated with age. Each troop has one to three central, high-ranking adult males who interact with females more than other group males and lead the troop procession with high-ranking females. Recently transferred males, old males or young adult males that have not yet left their natal group are often lower ranking. Staying at the periphery of the group they tend to be marginalized from group activity.[35]

A group of three ring-tailed lemurs rest in the sun, with two sitting upright, facing the sun, with their arms to their sides.
The ring-tailed lemur will sit facing the sun to warm itself in the mornings.

For males, social structure changes can be seasonal. During the six month period between December and May a few males immigrate between groups. Established males transfer every 3.5 years,[31] although young males may transfer every 1.4 years. Group fission occurs when groups get too large and resources become scarce.[35]

In the mornings the ring-tailed lemur sunbathes to warm itself. It faces the sun sitting in what is frequently described as a "sun-worshipping" posture or Lotus position. However, it sits with its legs extended outward, not cross-legged, and will often support itself on nearby branches. Sunning is often a group activity, particularly during the cold mornings. At night, troops will split into sleeping parties huddling closely together to keep warm.[35]

Despite being quadrupedal the ring-tailed lemur can rear up and balance on its hind legs, usually for aggressive displays. When threatened the ring-tailed lemur may jump in the air and strike out with its short nails and sharp upper canine teeth in a behaviour termed jump fighting. This is extremely rare outside of the breeding season when tensions are high and competition for mates is intense. Other aggressive behaviours include a threat-stare, used to intimidate or start a fight, and a submissive gesture known as pulled-back lips.[35]

Border disputes with rival troops occur occasionally and it is the dominant female's responsibility to defend the troop's home range. Agonistic encounters include staring, lunging approaches and occasional physical aggression, and conclude with troop members retreating toward the center of the home range.[35]

Olfactory communication

Lemur catta - scent marking 01.ogv
Male ring-tailed lemurs will scent-mark saplings and branches by spur-marking.

Olfactory communication is critically important for prosimians like the ring-tailed lemur. Males and females scent mark both vertical and horizontal surfaces at the overlaps in their home ranges using their anogenital scent glands. The ring-tailed lemur will perform a handstand to mark vertical surfaces, grasping the highest point with its feet while it applies its scent.[35] Use of scent marking varies by age, sex and social status.[36] Male lemurs use their antebrachial and brachial glands to demarcate territories and maintain intragroup dominance hierarchies. The thorny spur that overlays the antebrachial gland on each wrist is scraped against tree trunks to create grooves anointed with their scent. This is known as spur-marking.[35]

In displays of aggression, males engage in a social display behaviour called stink fighting, which involves impregnating their tails with secretions from the antebrachial and brachial glands and waving the scented tail at male rivals.[37] During the mating season, males wave their scented tails at females as a form of sexual overture; this usually results in the female cuffing or biting the male and elicits subordinate vocalizations from the male.

Ring-tailed lemurs have also been shown to mark using urine. Behaviorally, there is a difference between regular urination, where the tail is slightly raised and a stream of urine is produced, and the urine marking behavior, where the tail is held up in display and only a few drops of urine are used.[38][39] The urine-marking behavior is typically used by females to mark territory, and has been observed primarily at the edges of the troop's territory and in areas where other troops may frequent.[40] The urine marking behavior also is most frequent during the mating season, and may play a role in reproductive communication between groups.[38]

Auditory communication

Ring-tailed lemurs are some of the most vocal primates.

The ring-tailed lemur is one of the most vocal primates and has a complex array of distinct vocalizations used to maintain group cohesion during foraging and alert group members to the presence of a predator. Calls range from simple to complex. An example of a simple call is the purr (About this sound listen ), which expresses contentment. A complex call is the sequence of clicks, close-mouth click series (CMCS), open-mouth click series (OMCS) and yaps (About this sound listen ) used during predator mobbing. Some calls have variants and undergo transitions between variants, such as an infant "whit" (distress call) transitioning from one variant to another (About this sound listen ).[41]

The most commonly heard vocalizations are the moan (About this sound listen ) (low-to-moderate arousal, group cohesion), early-high wail (About this sound listen ) (moderate-to-high arousal, group cohesion), and clicks (About this sound listen ) ("location marker" to draw attention).[41]

Breeding and reproduction

A female ring-tailed lemur sits in a tree while nursing her infant
In the wild, females typically give birth to a single offspring.

The ring-tailed lemur is polygynandrous,[31] although the dominant male in the troop typically breeds with more females than other males. Fighting is most common during the breeding season.[42] A receptive female may initiate mating by presenting her backside, lifting her tail and looking at the desired male over her shoulder. Males may inspect the female's genitals to determine receptiveness. Females typically mate within their troop, but may seek outside males.[31]

The breeding season runs from mid-April to mid-May. Estrus lasts 4 to 6 hours,[16] and females mate with multiple males during this period.[31] Within a troop, females stagger their receptivity so that each female comes into season on a different day during the breeding season, reducing competition for male attention.[43] Gestation lasts for about 135 days, and parturition occurs in September or occasionally October. In the wild, one offspring is the norm, although twins may occur. Ring-tailed lemur infants have a birth weight of 70 g (2.5 oz) and are carried ventrally (on the chest) for the first 1 to 2 weeks, then dorsally (on the back).[16]

The young lemurs begin to eat solid food after two months and are fully weaned after five months. Sexual maturity is reached between 2.5 and 3 years.[42] Male involvement in infant rearing is limited, although the entire troop, regardless of age or sex, can be seen caring for the young. Alloparenting between troop females has been reported. Kidnapping by females and infanticide by males also occur occasionally.[35] Due to harsh environmental conditions, predation and accidents such as falls, infant mortality can be as high as 50% within the first year and as few as 30% may reach adulthood.[16] The longest-lived ring-tailed lemur in the wild was a female at the Berenty Reserve who lived for 20 years.[22] In the wild, females rarely live past the age of 16, whereas the life expectancy of males is not known due to their social structure. The longest-lived male was reported to be 15 years old. The maximum lifespan reported in captivity was 27 years.[5]

Cognitive abilities and tool use

Historically, the studies of learning and cognition in non-human primates have focused on simians (monkeys and apes), while strepsirrhine primates, such as the ring-tailed lemur and its allies, have been overlooked and popularly dismissed as unintelligent.[44] A couple of factors stemming from early experiments have played a role in the development of this assumption. First, the experimental design of older tests may have favored the natural behavior and ecology of simians over that of strepsirrhines, making the experimental tasks inappropriate for lemurs. For example, simians are known for their manipulative play with non-food objects, whereas lemurs are only known to manipulate non-food objects in captivity.[45] This behaviour is usually connected with food association. Also, lemurs are known to displace objects with their nose or mouth more so than with their hands.[44] Therefore, an experiment requiring a lemur to manipulate an object without prior training would favor simians over strepsirrhines. Second, individual ring-tailed lemurs accustomed to living in a troop may not respond well to isolation for laboratory testing. Past studies have reported hysterical behaviour in such scenarios.[46] As a result of these early studies lemurs were often omitted from further research.

The notion that lemurs are unintelligent has been perpetuated by the view that the neocortex ratio (as a measure of brain size) indicates intelligence.[47] In fact, primatologist Alison Jolly noted early in her academic career that some lemur species, such as the ring-tailed lemur, have evolved a social complexity similar to that of cercopithecine monkeys, but not the corresponding intelligence.[48] After years of observations of wild ring-tailed lemur populations at the Berenty Reserve in Madagascar and as well as baboons in Africa, she more recently concluded that this highly social lemur species does not demonstrate the equivalent social complexity of cercopithecine monkeys, despite general appearances.[49]

Regardless, research has continued to illuminate the complexity of the lemur mind, with emphasis on the cognitive abilities of the ring-tailed lemur. As early as the mid-1970s, studies had demonstrated that they could be trained through operant conditioning using standard schedules of reinforcement. The species has been shown to be capable of learning pattern, brightness and object discrimination, skills common among vertebrates. The ring-tailed lemur has also been shown to learn a variety of complex tasks often equaling, if not exceeding, the performance of simians.[44]

More recently, research at the Duke Lemur Center has shown that the ring-tailed lemur can organize sequences in memory and retrieve ordered sequences without language.[50] The experimental design demonstrated that the lemurs were using internal representation of the sequence to guide their responses and not simply following a trained sequence, where one item in the sequence cues the selection of the next.[50] But this is not the limit of the ring-tailed lemur's reasoning skills. Another study, performed at the Myakka City Lemur Reserve, suggests that this species along with several other closely related lemur species understand simple arithmetic operations.[51]

Since tool use is considered to be a key feature of primate intelligence, the apparent lack of this behavior in wild lemurs, as well as the lack of non-food object play, has helped reinforce the perception that lemurs are less intelligent than their simian cousins.[45] However, another study at the Myakka City Lemur Reserve examined the representation of tool functionality in both the ring-tailed lemur and the common brown lemur and discovered that, like monkeys, they used tools with functional properties (e.g., tool orientation or ease of use) instead of tools with nonfunctional features (e.g., color or texture). Although the ring-tailed lemur may not use tools in the wild, it can not only be trained to use a tool, but will preferentially select tools based on their functional qualities. Therefore, the conceptual competence to use a tool may have been present in the common primate ancestor, even though the use of tools may not have appeared until much later.[52]

Conservation status

In addition to being listed as Near Threatened in 2008 by the IUCN,[2] the ring-tailed lemur has been listed since 1977 by CITES under Appendix I,[3] which makes trade of wild-caught specimens illegal. Although there are more endangered species of lemur, the ring-tailed lemur is considered a flagship species due to its recognizability.[53]

A small group of five ring-tailed lemurs walks as a group along a dirt road
Ring-tailed lemurs are a common sight at Berenty Private Reserve in southern Madagascar.

Three factors threaten ring-tailed lemurs. First and foremost is habitat destruction. Starting nearly 2,000 years ago with the introduction of humans to the island, forests have been cleared to produce pasture and agricultural land.[53] Extraction of hardwoods for fuel and lumber, as well mining and overgrazing, have also taken their toll. Today, it is estimated that 90% of Madagascar's original forest cover has been lost.[54] Rising populations have created even greater demand in the southwest portion of the island for fuel wood, charcoal, and lumber. Fires from the clearing of grasslands, as well as slash-and-burn agriculture destroy forests. Another threat to the species is harvesting either for food (bush meat) or pets. Finally, periodic drought common to southern Madagascar can impact populations already in decline. In 1991 and 1992, for example, a severe drought caused an abnormally high mortality rate among infants and females at the Beza Mahafaly Special Reserve. Two years later, the population had declined by 31% and took nearly four years to start to recover.[53]

The ring-tailed lemur resides in several protected areas within its range, each offering varying levels of protection. At the Beza Mahafaly Special Reserve, a holistic approach to in-situ conservation has been taken. Not only does field research and resource management involve international students and local people (including school children), livestock management is used at the peripheral zones of the reserve and ecotourism benefits the local people.[53]

Outside of its diminishing habitat and other threats, the ring-tailed lemur reproduces readily and has fared well in captivity. For this reason, along with its popularity, it has become the most populous lemur in zoos worldwide, with more than 2500 in captivity as of 2009. It is also the most common of all captive primates.[18] Ex situ facilities actively involved in the conservation of the ring-tailed lemur include the Duke Lemur Center in Durham, NC, the Lemur Conservation Foundation in Myakka City, FL and the Madagascar Fauna Group headquartered at the Saint Louis Zoo. Due to the high success of captive breeding, reintroduction is a possibility if wild populations were to crash. Although experimental releases have met success on St. Catherines Island in Georgia, demonstrating that captive lemurs can readily adapt to their environment and exhibit a full range of natural behaviors, captive release is not currently being considered.[53]

Ring-tailed lemur populations can also benefit from drought intervention, due to the availability of watering troughs and introduced fruit trees, as seen at the Berenty Private Reserve in southern Madagascar.[53] However, these interventions are not always seen favorably, since natural population fluctuations are not permitted. The species is thought to have evolved its high fecundity due to its harsh environment;[53] therefore, interfering with this natural cycle could significantly impact the gene pool.

Cultural references

The ring-tailed lemur is known locally in Malagasy as maky (pronounced [ˈmakʲi̥], and spelled maki in French) or hira (pronounced [ˈhirə] or colloquially [ˈir]). Being the most widely recognized endemic primate on the island, it has been selected as the symbol for Madagascar National Parks (formerly known as ANGAP).[18] The Maki brand, which started by selling t-shirts in Madagascar and now sells clothing across the Indian Ocean islands, is named after the this lemur due to its popularity, despite the fact that the company's logo portrays the face of a sifaka and its name uses the French spelling.[55]

The first mention of the ring-tailed lemur in Western literature came in 1625 when English traveler and writer Samuel Purchas described them as being comparable in size to a monkey and having a fox-like long tail with black and white rings.[5]

It has been popularized in Western culture by the Animal Planet television series Lemur Kingdom (United States) and Lemur Street (United Kingdom), as well as by the character King Julien in the animated Madagascar film series and spin-off TV series. Lemur Street depicts real events in the lives of wild ring-tailed lemurs, whereas the Madagascar films and spin-off series depict anthropomorphic representations, such as lemurs talking, singing, and dancing. The ring-tailed lemur was also the focus of the 1996 Nature documentary A Lemur's Tale, which was filmed at the Berenty Reserve and followed a troop of lemurs. The troop included a special infant named Sapphire, who was nearly albino, with white fur, bright blue eyes, and the characteristic ringed tail.

This species also played a role in the 1997 comedy film Fierce Creatures, starring John Cleese, who has a passion for lemurs.[56][57] Cleese later hosted the 1998 BBC documentary In the Wild: Operation Lemur with John Cleese, which tracked the progress of a reintroduction of Black-and-white Ruffed Lemurs back into the Betampona Reserve in Madagascar. The project had been partly funded by Cleese's donation of the proceeds from the London premier of Fierce Creatures.[57][58]

Notes

  1. ^ The genus name Prosimia was declared unavailable by the International Commission on Zoological Nomenclature in 1998.[5]
  2. ^ Type species was designated as Catta mococo (= Lemur catta Linnaeus, 1758).[5]
  3. ^ Type species was designated as Maki mococo (= Lemur catta Linnaeus, 1758).[5][6]
  4. ^ The synonym Mococo is sometimes omitted because it was technically a vernacular term for the genus Prosimia.[6] René Primevère Lesson named the type species for this genus as Prosimia catta (= Lemur catta Linnaeus, 1758) in the same year (1878).[5]
  5. ^ Muirhead (1819) credited the name Maki mococo to Anselme Gaëtan Desmarest (1817), although it was actually used as a vernacular name.[5][6]
  6. ^ The pale fork-marked lemur found at Zombitse-Vohibasia National Park may instead be a new species.[34]

References

  1. ^ a b c d e Groves, Colin P. (16 November 2005). "Lemur catta". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press. p. 117. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=12100056. 
  2. ^ a b Andrainarivo, C., Andriaholinirina, V. N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R. A., Perieras, A., Princee, F., Rabarivola, J. C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Sussman, R., Thalmann, U., Wilmé, L. & Wright, P. (2008). Lemur catta. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 1 January 2009.
  3. ^ a b UNEP-WCMC. "CITES species database: Lemur catta". UNEP-WCMC Species Database. http://www.unep-wcmc.org/isdb/CITES/Taxonomy/tax-species-result.cfm/isdb/CITES/Taxonomy/tax-species-result.cfm?Genus=Lemur&Species=catta&source=animals&displaylanguage=eng. Retrieved 27 January 2011. 
  4. ^ Mittermeier et al. 2006, p. 238
  5. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad ae af ag ah ai aj ak al am an ao ap aq Wilson, D.E.; Hanlon, E. (2010). "Lemur catta (Primates: Lemuridae)" (PDF). Mammalian Species 42 (854): 58–74. doi:10.1644/854.1. http://www.mammalsociety.org/uploads/Wilson%20and%20Hanlon%202010.pdf. 
  6. ^ a b c d e f g h i j k l m Tattersall 1982, pp. 43–46
  7. ^ a b Garbutt 2007, pp. 85–86
  8. ^ Blunt & Stearn 2002, p. 252
  9. ^ Flower & Lydekker 1891, p. 682
  10. ^ Nield 2007, p. 41
  11. ^ a b Mittermeier et al. 2006, pp. 23–26
  12. ^ a b Horvath, J.E.; Weisrock, D.W.; Embry, S.L.; Fiorentino, I.; Balhoff, J.P.; Kappeler, P.; Wray, G.A.; Willard, H.F. et al (2008). "Development and application of a phylogenomic toolkit: resolving the evolutionary history of Madagascar's lemurs" (PDF). Genome Research 18 (3): 489–499. doi:10.1101/gr.7265208. PMC 2259113. PMID 18245770. http://www.biology.duke.edu/yoderlab/reprints/2008Horvath_etalGR.pdf. 
  13. ^ Mittermeier et al. 2010, Chapter 2
  14. ^ a b Matsui, A.; Rakotondraparany, F.; Munechika, I.; Hasegawa, M.; Horai, S. (2009). "Molecular phylogeny and evolution of prosimians based on complete sequences of mitochondrial DNAs". Gene 441: 53–66. doi:10.1016/j.gene.2008.08.024. PMID 18824224. 
  15. ^ a b c d e Pastorini, J.; Forstner, M.R.J.; Martin, R.D. (2002). "Phylogenetic relationships among Lemuridae (Primates): evidence from mtDNA". Journal of Human Evolution 43: 463–478. doi:10.1006/jhev.2002.0587. PMID 12393004. 
  16. ^ a b c d e f g h i Garbutt 2007, pp. 146–148
  17. ^ a b c d Mittermeier et al. 2006, p. 237
  18. ^ a b c d e f g h i j k l m n o p q Mittermeier et al. 2010, pp. 358–375
  19. ^ Orlando, L.; Calvignac, S.; Schnebelen, C.; Douady, C.J.; Godfrey, L.R.; Hänni, C. (2008). "DNA from extinct giant lemurs links archaeolemurids to extant indriids". BMC Evolutionary Biology 8 (121). doi:10.1186/1471-2148-8-121. PMC 2386821. PMID 18442367. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2386821. 
  20. ^ a b Goodman, Rakotoarisoa & Wilmé 2006, pp. 3–15
  21. ^ a b Yoder; Irwin, J.A.; Goodman, S.M.; Rakotoarisoa, S.V. (2000). "Genetic tests of the taxonomic status of the ring-tailed lemur (Lemur catta) from the high mountain zone of the Andringitra Massif, Madagascar" (PDF). Journal of Zoology 252 (1): 1–9. doi:10.1111/j.1469-7998.2000.tb00814.x. http://biology.duke.edu/yoderlab/reprints/2000YoderIrwinJZool.pdf. 
  22. ^ a b c d e f g h i j Mittermeier et al. 2006, pp. 246–249
  23. ^ Ankel-Simons 2007, p. 294.
  24. ^ Rowe 1996, p. 27
  25. ^ Scordato, E.S.; Dubay, G.; Drea, C.M. (2007). "Chemical composition of scent marks in the ringtailed lemur (Lemur catta): Glandular differences, seasonal variation, and individual signatures". Chemical Senses 32 (5): 493–504. doi:10.1093/chemse/bjm018. PMID 17488747. 
  26. ^ Ankel-Simons 2007, pp. 391–505
  27. ^ Ankel-Simons 2007, pp. 47–160
  28. ^ Ankel-Simons 2007, pp. 224–283
  29. ^ Cuozzo & Yamashita 2006, pp. 67–96
  30. ^ Howarth, C.J. et al (1986). "Population ecology of the ring-tailed lemur and white sifaka at Berenty, Madagascar". Folia Primatologica 47: 39–48. 
  31. ^ a b c d e f g h i Sussman 1999, pp. 154–173
  32. ^ Gould & Sauther 2007, p. 53
  33. ^ Sussman, R.W. (1991). "Demography and social organization of free-ranging Lemur catta in the Beza Mahafaly Reserve, Madagascar". American Journal of Physical Anthropology 84 (1): 43–58. doi:10.1002/ajpa.1330840105. 
  34. ^ a b c Mittermeier et al. 2010, Appendix C
  35. ^ a b c d e f g h i j Cawthon Lang, K.A. (2005-09-21). "Primate Factsheets: Ring-tailed lemur (Lemur catta) Behavior". Wisconsin Primate Research Center (WPRC). http://pin.primate.wisc.edu/factsheets/entry/ring-tailed_lemur/behav. Retrieved 2008-09-23. 
  36. ^ Gouzoules & Gouzoules 2007, p. 624
  37. ^ Rowe 1996, p. 38
  38. ^ a b Palagi, E.; Dapporto, L.; Borgognini-Tarli, S.M. (2005). "The neglected scent: on the marking function of urine in Lemur catta" (PDF). Behavioral Ecology and Sociobiology 58: 437–445. doi:10.1007/s00265-005-0963-1. http://www.springerlink.com/content/t8m4g21q48670l50/fulltext.pdf. 
  39. ^ Palagi, E.; Dapporto, L. (2006). "Urine marking and urination in Lemur catta: a comparison of design features" (PDF). Annales Zoologici Fennici 43: 280–284. http://www.sekj.org/PDF/anzf43/anzf43-280.pdf. 
  40. ^ Palagi, E.; Norscia, I. (2005). "Multimodal signaling in wild Lemur catta: Economic design and territorial function of urine marking". American Journal of Physical Anthropology 139: 182–192. doi:10.1002/ajpa.20971. 
  41. ^ a b Macedonia, J.M. (1993). "The vocal repertoire of the ring-tailed lemur (Lemur catta)". Folia Primatologica 61: 186–217. doi:10.1159/000156749. PMID 7959437. 
  42. ^ a b Anderson, R. (1999). "Lemur catta". Animal Diversity Web. http://animaldiversity.ummz.umich.edu/site/accounts/information/Lemur_catta.html. Retrieved 2008-04-18. 
  43. ^ Narrator: Martin Shaw. "Lemur Street". episode 6 ("Home Alone"). series 1. 8:40 minutes in. BBC. Animal Planet. 
  44. ^ a b c Ehrlich, E.; Fobes, J.L.; King, J.E. (1976). "Prosimian learning capacities". Journal of Human Evolution 5: 599–617. doi:10.1016/0047-2484(76)90005-1. 
  45. ^ a b Jolly, A. (1964). "Prosimians' manipulation of simple object problems". Animal Behaviour 12 (4): 560–570. doi:10.1016/0003-3472(64)90080-6. 
  46. ^ Hosey, G.R. (2000). "A glimpse into the lemur mind" (PDF). Proceedings of the 2nd Annual Symposium on Zoo Research: 5–10. http://www.biaza.org.uk/resources/library/images/ARSP2.pdf#page=11. 
  47. ^ Dunbar, R.I.M. (1998). "The social brain hypothesis" (PDF). Evolutionary Anthropology 6 (4): 178–190. doi:10.1002/(SICI)1520-6505(1998)6:5<178::AID-EVAN5>3.0.CO;2-8. http://eebweb.arizona.edu/Faculty/Dornhaus/courses/materials/papers/Dunbar%20social%20brain%20size%20group%20review.pdf. 
  48. ^ Jolly, A. (1966). "Lemur social behavior and primate intelligence". Science 153 (3735): 501–506. Bibcode 1966Sci...153..501J. doi:10.1126/science.153.3735.501. PMID 5938775. 
  49. ^ Jolly, A. (1998). "Pair-bonding, female aggression and the evolution of lemur societies". Folia Primatologica 69 (Suppl. 1): 1–13. doi:10.1159/000052693. PMID 9595685. 
  50. ^ a b Merritt, D.; MacLean, E.L.; Jaffe, S.; Brannon, E.M. (2007). "A comparative analysis of serial ordering in ring-tailed lemurs (Lemur catta)" (PDF). Journal of Comparative Psychology 121 (4): 363–371. doi:10.1037/0735-7036.121.4.363. PMC 2953466. PMID 18085919. http://www.duke.edu/web/mind/level2/faculty/liz/Publications/Merritt,%20MacLean,%20Jaffe%20and%20Brannon%20(2007).pdf. 
  51. ^ Santos, L.R.; Barnes, J.L.; Mahajan, N. (2005). "Expectations about numerical events in four lemur species (Eulemur fulvus, Eulemur mongoz, Lemur catta and Varecia rubra)" (PDF). Animal Cognition 8 (4): 253–262. doi:10.1007/s10071-005-0252-4. PMID 15729569. http://www.yale.edu/caplab/Main/Publications_files/santosetal.lemurnumber.pdf. 
  52. ^ Santos, L.R.; Mahajan, N.; Barnes, J.L. (2005). "How prosimian primates represent tools: Experiments with two lemur species (Eulemur fulvus and Lemur catta)" (PDF). Journal of Comparative Psychology 119 (4): 394–403. doi:10.1037/0735-7036.119.4.394. PMID 16366773. http://www.yale.edu/caplab/Main/Publications_files/santosetal.lemurtools.jcp.pdf. 
  53. ^ a b c d e f g Cawthon Lang, K.A. (2005-09-21). "Primate Factsheets: Ring-tailed lemur (Lemur catta) Conservation". Wisconsin Primate Research Center (WPRC). http://pin.primate.wisc.edu/factsheets/entry/ring-tailed_lemur/cons. Retrieved 2008-09-23. 
  54. ^ Mittermeier et al. 2006, p. 57
  55. ^ Mittermeier et al. 2010, Chapter 5
  56. ^ Hans ten Cate (13 June 2002). "John Cleese Visits Lemurs at San Francisco Zoo". PythOnline's Daily Llama. Archived from the original on 28 December 2010. http://www.webcitation.org/5vKSV7UX3. Retrieved 28 December 2010. 
  57. ^ a b John Cleese (host) (1998). In the Wild: Operation Lemur with John Cleese (DVD). Tigress Productions Ltd for BBC. Archived from the original on 28 December 2010. http://www.webcitation.org/5vKSlRiBi. Retrieved 28 December 2010. 
  58. ^ Duke University (12 October 1998). "Four More Lemurs To Be Released Into Madagascar Jungle This Fall". Science Daily. Archived from the original on 28 December 2010. http://www.webcitation.org/5vKScRzZ5. Retrieved 28 December 2010. 

Literature cited

  • Ankel-Simons, F. (2007). Primate Anatomy (3rd ed.). Academic Press. ISBN 0-12-372576-3. 
  • Garbutt, N. (2007). Mammals of Madagascar: A Complete Guide. A&C Black Publishers. ISBN 978-0-300-12550-4. 
  • Campbell, C.; Fuentes, A.; MacKinnon, K. et al, eds. (2007). Primates in Perspective. Oxford University Press. ISBN 978-0-19-517133-4. 
  • Gould, L.; Sauther, M. (2007). "Lemuriformes". p. 53. 
  • Gouzoules, H.; Gouzoules, S. (2007). "The Conundrum of Communication". p. 624. 
  • Cuozzo, F.P.; Yamashita, N. (2006). "Chapter 4: Impact of Ecology on the Teeth of Extant Lemurs: A Review of Dental Adaptations, Function, and Life History". pp. 67–96. 
  • Jolly, A.; Sussman, R.W.; Koyama, N. et al, eds. (2006). Ringtailed Lemur Biology. Springer. ISBN 0-387-32669-3. 
  • Goodman, S.M.; Rakotoarisoa, S.V.; Wilmé, L. (2006). "The Distribution and Biogeography of the Ringtailed Lemur ( Lemur catta ) in Madagascar". pp. 3–15. 
  • Sussman, R.W. (1999). Primate Ecology and Social Structure. Volume 1: Lorises, Lemurs and Tarsiers. Pearson Custom Pub.. pp. 154–173. ISBN 0-536-02256-9. 
  • Tattersall, I. (1982). The Primates of Madagascar. Columbia University Press. pp. 43–46. ISBN 0-231-04704-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!