Overview

Brief Summary

Biology

The activity pattern of mongoose lemurs varies with the season, making it very different to that of most other primates (4). Individuals display cathemeral behaviour throughout the wet and dry seasons but, during the dry season, individuals tend to be more nocturnal, switching to more diurnal and/or crepuscular activity at the start of the wet season (4) (8). Fruit appears to dominate the diet throughout the year but flowers, particularly those from the kapok tree, are also eaten during the wet season, and these lemurs are extremely fond of nectar (6) (8). During the dry season, the mongoose lemur supplements its diet with mature and immature leaves (6) (8). The species has also been observed to feed on the occasional grub and beetle (6) (8). On the mainland, mongoose lemurs live in small family groups made up of an adult male, adult female and one to three of their offspring (6), but congregate in larger groups in the Comoros (2). Home ranges are small and often overlap those of other groups. Although neighbouring groups rarely encounter one another, aggressive vocalisations, scent marking, and physical charges and threats are made when they do (8). Females are generally dominant to males, having preferential choice over food and mates (4). Mating is seasonal, with single offspring (rarely twins) being born from August to October, just before the rainy season, after a gestation period of around 126 - 128 days (2) (4) (5). The infant is weaned at approximately 135 days old, and young are forced to leave the group when they mature at around 2.5 to 3.5 years old (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

One of the smallest of the five Eulemur species, the mongoose lemur has soft, woolly fur, a relatively long, bushy tail and a pronounced ruff around the neck and ears (4) (5). This species is sexually dimorphic, with the sexes displaying different coat colouration. Males have grey-brown fur on their upper parts, with a slightly darker tip to the tail, much paler, creamy-grey underparts, pale grey faces, and distinctive reddish-brown fur on the sides of the body, cheeks, beard, forehead and back of the neck (4) (6). Males have white beards when born that become red as they mature (4). Females are generally paler grey than males but, like males, usually have a darker tail tip and creamy-grey underparts (6). However, in contrast to the red collar of the males, the cheeks and beard of females form a creamy-grey to white ruff, and the face is darker grey (6) (7). The eyes of both sexes are reddish-orange (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in north-western Madagascar and in the Comores on the islands of Moheli, Anjouan and Gran Comoro, where they were almost certainly introduced by human agency. On Madagascar, it is known from the region of Ambato-Boéni and Ankarafantsika; the northern limit of its distribution appears to be near Analalava on the Bay of Narindra, and it has been seen south and west of the Betsiboka River at Katsepy and on the shores of Lac Kinkony, on both sides of the Mahavavy River and in the Tsiombikibo forest near Mitsinjo (Mittermeier et al. 2008, and references therein). Ranges from sea level to 400 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Mongoose lemurs, Eulemur mongoz, are found in northwest Madagascar and on the Comoro Islands of Moheli and Anjouan.

Biogeographic Regions: ethiopian (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The mongoose lemur's natural range is restricted to north-west Madagascar, but the species is also found on the Comoros Islands of Moheli and Anjouan, where it is thought to have been introduced (1) (6). A few feral individuals may also exist on Grande Comoro (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Mongoose lemurs are the smallest species of the genus Eulemur, which includes five species. Head and body length averages 35 cm and the tail length averages 48 cm. These animals weigh between 2 and 3 kg.

Pelage in this species is sexually dimorphic. It is woolly and the tails are bushy and gray in both sexes. Males have a gray body with red fur on the side of the body and the face. Males have white beards when they are born that turn red as they grow older. Females are darker gray than males and they have white fur on the sides of the body and face.

Mongoose lemurs have binocular vision, as in other lemurs, and their noses have a rhinarium (unfused nasal projection) to aid in olfactory communication.

Range mass: 2 to 3 kg.

Average length: 35 cm.

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

  • Flannery, S. August 25, 2000. "Primate Info Net" (On-line). Accessed October 22, 2000 at http://pin.primate.wisc.edu/factsheets/eulemur_mongoz.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in dry deciduous forests in western Madagascar, more typically in humid forests in the Comores, and can survive in secondary forest. In Madagascar it lives in small cohesive family units of an adult male-female pair with one to four offspring; larger groups have been recorded on Mohéli in the Comoros. A cathemeral species, with fruit predominating in the diet. The birth season appears to be around mid-October on Anjouan and in Madagascar, and females give birth each year (Mittermeier et al. 2008, and references therein).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Eulemur mongoz may be found in two different habitats. On the island of Madagascar, they are found in drier forests with deciduous trees. However, on the smaller islands, they are found in more humid forests.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest

  • July 31, 1999. "Primate Center at Duke University" (On-line). Accessed October 22, 2000 at http://www.duke.edu/web/primate/index.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

On the mainland, habitat includes dry deciduous forests and secondary forests. On the Comoros Islands, this arboreal species is found in humid forest (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Mongoose lemurs first begin to eat solid food when they are about 5 weeks of age (around the same time they take their first steps). They taste whatever the older members of the group are eating, which includes flowers, pollen, fruit, and leaves.

Mongoose lemurs have very small upper incisors and upper canines and their premolars become vertically smaller posteriorly. The molars are hypocone, but the trigonids and talonids become less distinct toward the posterior. Eulemur species have dental formulas of 0-2/2, 1/1, 3/3, 3/3=32-36.

Plant Foods: leaves; fruit; pollen; flowers

Primary Diet: herbivore (Folivore , Frugivore )

  • Vaughan, T., J. Ryan, N. Czaplewski. 2000. Mammalogy. Fort Worth: Saunders College Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Because they are frugivorous, these animals may help in dispersing seeds. When they feed upon pollen, they may help some species to pollinate. To the extent that these lemurs are preyed upon by other animals, they may affect local food webs.

Ecosystem Impact: disperses seeds; pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Details regarding predation upon these animals are lacking. However, it is likely that fossas and raptors may be predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As in all primates, communication is varied and complex. Visual signals, such as facial expressions and body postures, are often used in communication. In addition, vocalizations are used, especially in marking territories. Chemical communication (i.e. scent marks) are used in marking territories as well. Tactile communication occurs between members of a social group and may include grooming, agonsism, and play.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of these animals has not been reported. However, another member of the genus, Eulemur fulvus is known to have reached an age of 36 years in captivity. An individual which was a hybrid of E. fulvus and Eulemur macaco lived for 39 years in captivity. It is likely that E. mongoz is similarly long lived, although wild lifespan is likely to be shorter than that seen in captivity.

Average lifespan

Status: captivity:
36.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 36.2 years (captivity) Observations: One captive female was still alive after 36.2 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

In some areas, these animal appear to form stable monogamous pair bonds. It is possible that in other areas these animals are polygynous, as are other members of the genus.

Mating System: monogamous ; polygynous

Mongoose lemurs reach sexual maturity at about 2 years of age.

Mating is seasonal. Females experience estrus for about one month between April and June. They give birth to a single offspring per year, though twins are not rare. Young are usually born from August to October after a gestation period of about 128 days. Newborn lemurs weigh about 60 to 70 grams at birth and are weaned from their mother at about 135 days of age.

Breeding interval: These lemurs breed once per year.

Breeding season: Females experience estrus for about one month between April and June

Range number of offspring: 1 to 2.

Average gestation period: 128 days.

Average weaning age: 135 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 53 g.

Average gestation period: 128 days.

Average number of offspring: 1.1.

Average age at sexual or reproductive maturity (female)

Sex: female:
796 days.

Female mongoose lemurs care for their young and nurse them until they are about 135 days old. Maternal care includes grooming, playing, and socialization, as well as carrying of the young when they are small. The role of males in parental care has not been described.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
  • July 31, 1999. "Primate Center at Duke University" (On-line). Accessed October 22, 2000 at http://www.duke.edu/web/primate/index.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eulemur mongoz

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1719-08|NC_010300|Eulemur mongoz| AATCGTTGATTCTATTCAACTAATCATAAAGATATCGGAACTCTTTACCTCTTATTTGGGGCTTGAGCAGGAATGGTAGGAACAGCCCTT---AGCCTTTTAATTCGAGCAGAACTTGGTCAACCCGGGGCTTTATTGGGAGAT---GATCAAATCTACAATGTGATCGTAACAGCTCATGCTTTCGTCATAATTTTTTTCATAGTTATACCTATCATAATTGGGGGCTTTGGGAACTGACTAGTTCCCTTAATA---ATTGGAGCTCCTGATATAGCATTCCCTCGAATAAATAATATAAGCTTTTGGCTTCTACCACCATCCTTCTTGCTACTTCTAGCGTCTTCAATAGTAGAAGCAGGCGCTGGAACTGGGTGGACCGTATACCCCCCTCTAGCTGGGAATTTGGCCCATGCAGGAGCCTCCGTAGACCTA---ACAATTTTTTCATTACACCTAGCAGGGGTATCCTCAATTCTAGGGGCCATCAACTTTATCACCACAGTAATTAACATAAAACCCCCAGCCATATCACAATATCAAACACCTCTGTTTGTATGATCCGTGATAATTACCGCTGTCCTTTTACTTCTATCCCTACCGGTTCTAGCAGCA---GGAATCACTATACTCTTGACTGACCGTAACCTCAACACAACATTTTTTGACCCTGCGGGAGGAGGTGATCCAATTCTATATCAACATTTATTCTGATTCTTCGGACACCCTGAAGTCTACATCTTAATCCTTCCAGGTTTTGGCATAATTTCCCACATTGTCACATACTACTCAGGTAAAAAA---GAACCCTTTGGTTATATAGGCATAGTCTGAGCTATGATATCTATTGGCTTCTTAGGATTTATCGTATGAGCACACCATATATTCACAGTAGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eulemur mongoz

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(i,ii,iii,v)

Version
3.1

Year Assessed
2008

Assessor/s
Andrainarivo, C., Andriaholinirina, V.N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R.A., Perieras, A., Princee, F., Rabarivola, J.C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Thalmann, U., Wilmé, L. & Wright, P.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Listed as Vulnerable as the species has a range of less than 10,000 km², is fragmented, and there is ongoing decline in extent, area and quality of habitat, as well as in the numbers of mature individuals due to levels of exploitation.

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

There are only about 100 mongoose lemurs in captivity worldwide and their habitats are disappearing. Land that is inhabited by mongoose lemurs is being cleared to produce charcoal and farm land. It has been illegal to kill lemurs since 1974, but many local people are unaware of the law. In 1996, IUCN considered the species vulnerable, the CITES have E. mongoz on appendix I and the USDI lists all species of Eulemur as endangered.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU A1c, C2a) on the IUCN Red List 2004 (1) and listed under Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Muller et al. (2000) recorded densities of 16 groups/km² and 45 individuals/km² in Anjamena, using transect line sampling.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Forests of western Madagascar inhabited by mongoose lemurs are already highly fragmented and continue to be cleared for pastures, crops, and charcoal production. Hunting using traps is also considered to be a threat. While previously under less threat on Anjouan and Mohéli, this species is now more often regarded as a crop pest, especially by an influx of Malagasy who do not adhere to local customs that have historically provided lemurs in the Comores a greater degree of protection (Tattersall 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The principle reason for the decline of the mongoose lemur is habitat loss, as dry-deciduous forests of the north-west continue to be cleared to create pasture and charcoal (6) (8). Additionally, the species is hunted for food throughout much of its range, occasionally trapped for the pet trade, and persecuted for its assumed role in raiding and destroying crops (4) (8). In Comoros, the mongoose lemur faces similar threats (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix I of CITES. It is protected by law in the Comores. It is known to occur in a single protected area, Ankarafantsika National Park. Unprotected populations are found in the forests of Anjamena, Antrema (at Katsepy), Mariarano, and Tsiombikibo (near Mitsinjo) (Mittermeier et al. 2008). There is a relatively large worldwide captive population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

It has been illegal to kill lemurs since 1974 but, sadly, many local people are unaware of this law and hunting continues (4). The lemur is protected through its occurrence in the Ankarafantsika Nature Reserve, and captive populations are present in European and North American zoos. Some of these institutions have achieved notable breeding success, and captive breeding and reintroduction programmes are therefore a viable option for future conservation efforts to preserve this small, rare primate (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Mongoose lemurs have been hunted and trapped by humans because of their assumed role in raiding and destroying crops.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Eulemur mongoz is hunted for food and for sale into the pet trade. All lemurs are captivating animals and may play some role in attracting tourists to Madagascar.

Positive Impacts: pet trade ; food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mongoose lemur

The mongoose lemur (Eulemur mongoz) is a lemur ranging from 12 to 18 inches long plus a tail of 16 to 25 inches. The mongoose lemur lives in dry deciduous forests on the island of Madagascar as well as in the humid forests on the islands of the Comoros. This makes the Mongoose Lemur one of only two lemurs found outside of Madagascar,[3] though it is believed to be an introduced species in the Comoros.[4] The mongoose lemur mostly eats fruit, though flowers, leaves and nectar also make up part of its diet. As such, mongoose lemurs act as both pollinators and seed dispersers,[3] but may use the nectar of the kapok tree for nearly 80% of their diet in some parts of their range during the dry season.[5] Feeding on grubs and beetles has also been observed.[4] They are unusual among primates in that they will be diurnal or nocturnal depending on the season, being more active during the day in the wet season and changing activity to the night during the hotter dry season.[3]

Both sexes are born with white beards, but become obviously dimorphic at about six weeks of age when the males develop red beards and red cheeks. The males also have lighter faces than the females.[3] Males may further distinguish themselves when scent-marking territory, as they occasionally develop a bald patch on top of the head from rubbing.[5]

LemurMongozSmit.jpg

Mongoose lemurs are arboreal, with the ability to jump several meters from one tree to another.[3] They live in small family groups, usually consisting of a bonded pair and 1 to 3 offspring.[5] These groups rarely encounter one another, but when they do, they are aggressive.[4] Young are born just prior to the rainy season, from August to October.[4] Gestation lasts approximately four months and weaning takes place around five months after the young are born. The offspring then usually stay with their parents until three years of age, when they have reached full maturity.[5]

Captive mongoose lemurs can live up to 26 years, while wild specimens live 18–20 years.[5]

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 115. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100044. 
  2. ^ Andrainarivo, C., Andriaholinirina, V. N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R. A., Perieras, A., Princee, F., Rabarivola, J. C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Thalmann, U., Wilmé, L. & Wright, P. (2008). Eulemur mongoz. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 1 January 2009.
  3. ^ a b c d e Chicago Zoological Society - Brookfield Zoo's Mongoose Lemur page
  4. ^ a b c d ARKive - Mongoose LEulemur mongoz")
  5. ^ a b c d e Bristol Zoo - Mongoose Lemur
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!