Overview

Brief Summary

Biology

Black lemurs live in groups of between 2-15 individuals, with adult males and females in equal numbers, together with their dependant offspring (5). The activities and movements of the group are dictated by the dominant female, and group relationships are maintained by grunts, contact calls and grooming. Home ranges extend for five to six hectares and there is considerable overlap with the ranges of neighbouring groups (2). This species, like other lemurs, exhibits an activity pattern that is virtually unique amongst primates and rarely encountered amongst other arboreal mammals. They have activity bursts which may occur during the day and the night, though most activity occurs in the early morning and late afternoon (5). This activity pattern is called cathemeral, meaning 'all hours', contrasting with the usual distinction between nocturnal and diurnal (9). Foraging is concentrated in the middle and upper parts of the canopy, where this lemur feeds on fruit, flowers, leaves, fungi and occasionally invertebrates like millipedes. This primate plays an extremely important role is seed dispersal through the forests because it has such a high amount of fruit in its diet (6). In the dry season nectar becomes an important part of its diet as well (2). During the day it forages in the understory of the canopy where it is more protected from predatory birds such as hawks, and at night is able to feed in the upper levels (2). The breeding season is seasonal and births occur after a gestation period of 12 - 129 days. One offspring is usual, though twins are fairly common. The young cling to their mother's belly for three weeks and will only move to suckle. After three weeks the young are heavier and ride on the mother's back, and at 5 - 6 months of age they are fully weaned (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

There are two subspecies of the black lemur, the black lemur Eulemur macaco macaco and the Sclater's or blue eyed lemur E. m. flavifrons. These subspecies are similar in size, shape and behaviour, though they differ in their coat and eye colour and their habitat preferences (2). In both subspecies the sexes look quite different from each other. Male black lemurs have a dark brown to black pelage with black tufted ears and beady yellow-orange eyes, while females look so different they were thought for a long time to be a different species (4). Black lemur females are tawny on the back and head; their underparts are golden-brown to rich-chestnut brown, with paler fur on the limbs, and the tail is a darker chestnut brown (2). The females' ears are also dramatically tufted, but with long white hair which extends around the cheeks (3). Male Sclater's lemursnormally have a completely black pelage, which is shorter in length and has a softer appearance than that of the black lemur. The forehead has a distinct ridge of hair that forms a distinctive crest, and the ears are not tufted (2). As the alternative name of the Sclater's lemur, the blue-eyed black lemur, suggests, this subspecies has blue eyes, which is highly unusual in primates and very striking (2). Females of this subspecies have paler brown coloured underparts and dark grey hands and feet. Their crown is reddish-tan in colour and they have short white beards which may have reddish tinges (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Black lemurs are limited to the northwestern tip of Madagascar and the two adjacent islands of Nosy Komba and Nosy Be. In Madagascar, the two subspecies are separated by the Andranomalaza river, but clear separation only occurs in a relatively small area (Rabarivola and Meyers,1991). Eulemur macaco macaco can be found to the north of the river and Eulemur macaco flavifrons to the south of it (Rabarivola and Meyers, 1991).

Biogeographic Regions: ethiopian (Native )

Other Geographic Terms: island endemic

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Like all lemurs, these two subspecies are endemic to Madagascar, a large island off the coast off east Africa. They occur in the forests of the Sambirano region on the north-western tip of the island as well as on the islands of Nosy Be and Nosy Komba. These subspecies are separated by the Andranomalaza River, though clear separation occurs only in a small area. The black lemur occurs to the north of the river, and Sclater's lemur to the south (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Black lemurs are primitive primates that are about the size of a house cat. Adults can weigh about 2.4 kg (Duke Primate Center, 1998). Head and body lengths vary between 300 and 450 mm (Nowak, 1999). There are two subspecies of the black lemur: black lemurs (Eulemur macaco macaco) and blue-eyed lemurs (Eulemur macaco flavifrons). These subspecies are similar in size, shape and behavior. Differences between the two subspecies include habitat, coat and eye color.

There is striking sexual dimorphism in color. Males in both subspecies are black. Female black lemurs have a dark coat which lightens to a deep rust on the sides. They are off-white on the stomachs. Female blue-eyed lemurs have a coat that is reddish-tan in color over the entire body. All black lemurs have brown eyes as opposed to blue-eyed lemurs which all have turquoise blue eyes (Duke University, 1998).

Range mass: 2 to 2.5 kg.

Average mass: 2.5 kg.

Range length: 300 to 450 mm.

Sexual Dimorphism: sexes colored or patterned differently; female more colorful

  • Duke University, 1998. "Blue eyed lemur" (On-line). Duke Primae Center. Accessed August 08, 2005 at http://primatecenter.duke.edu/animals/blueeyed/print.php.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
E. macaco is considered to be quite adaptable and has been reported from a wide variety of habitats that include primary forest, secondary forest, forest-agricultural mosaics, and timber plantations. The species is considered cathemeral, group size ranges from two to 15 animals, and females give birth to a single young, usually between September and November (Mittermeier et al. 2008, and references therein).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

Eulemur flavifrons inhabits more or less disturbed primary and secondary tropical sub-humid forests in the southern Sambirano, a transition zone between the Sambirano region in the north and the western dry deciduous forest region in the south. It occurs from sea level up to an altitude of 1,200 m (Randriatahina and Rabarivola 2004). Its home range size and utilization differs between primary and secondary forest fragments, indicating that this species is somewhat able to adapt to different types of habitat. However, larger home ranges and lower densities of E. flavifrons in secondary forest as compared to primary forest suggest that the former is less suitable habitat for the species (Schwitzer et al. 2007a). Parasite prevalence seems to be higher in secondary than in primary forest and seems generally high when compared to data from other lemur species, suggesting that E. flavifrons on the Sahamalaza Peninsula are generally under pressure, possibly due to the high degree of fragmentation and degradation of the remaining forest habitat (Schwitzer et al. 2010). During a 12-month study, E. flavifrons consumed parts of 72 different plant species from 35 families. 52.3% of these were fruits, and 47.7% were leaves. The animals also fed on flowers, insects, insect exudates and fungi (Polowinsky and Schwitzer 2009). Eulemur flavifrons exhibits a bimodal activity pattern with peaks during the morning and evening twilight. It shows activity bouts during the day and night year-round. Nocturnal illumination and the proportion of illuminated lunar disk are positively associated with the amount of nocturnal activity. Total daily activity, as well as nocturnal activity, is higher in secondary forest than in primary forest (Schwitzer et al. 2007b). At certain times of the year, this species may feed on large quantities of cicadas. Group size ranges from 4 to 11 individuals (Andrianjakarivelo 2004, Randriatahina and Rabarivola 2004, Schwitzer 2004, Volampeno et al. 2011).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Black lemurs are tree dwellers. They can be found in four habitats: primary rain forest, secondary forest, timber plantations and food crop plantations.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The habitats of these two subspecies differ. The black lemuroccurs in moist Sambirano forests, rainforests on offshore islands, and in modified habitats of timber, coffee and cashew nut plantations, while Sclater's lemur occurs in mixed moist forests, dry deciduous forests and plantations (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

During the rainy season, their diet seems to consist mainly of fruit. They have also been reported to eat mushrooms and millipedes on occasion during this season. Early in the dry season, a significant part of their diet comes from the nectar of flowers. Other things included in the dry season diet are seed pods, leaves, and flowers (Kappeler and Ganzhorn, 1993).

Animal Foods: terrestrial non-insect arthropods

Plant Foods: leaves; seeds, grains, and nuts; fruit; nectar; flowers

Other Foods: fungus

Primary Diet: herbivore (Folivore , Nectarivore )

  • Kappeler, P., J. Ganzhorn. 1993. Lemur Social Systems and Their Ecological Basis. New York: Plenum Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As frugivores, these lemurs are likely to play some role in seed dispersal. However, because they eat nectar, they may also be important pollinators. To the extent that these lemurs are food for predators, they may have impact in local food webs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of these lemurs are not known. However, it seems likely that animals like fossas and raptors are possible predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

These animals use vocalizations, scent marks, body postures and facial expressions, as well as tactile communication.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

These animals are reported to live 20 to 25 years, presumably in captivity.

Range lifespan

Status: captivity:
20 to 25 years.

Average lifespan

Status: captivity:
39.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 36.2 years (captivity) Observations: A hybrid between a brown and a black lemur lived 39 years (Ronald Nowak 1999). One captive female was still alive after 36.2 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating system of these animals has not been well studied. In the wild, groups range in size from 4 to 15 individuals. Females are dominant to males, and there may be some exchange of adults between groups. In captivity, females have their choice of mates. From this information, it seems likely that breeding is polygynous.

Mating System: polygynous

Black lemurs breed seasonally in June and July. Birth occurs after a gestation period of 120 to 129 days. One offspring is usually born, however, twins are fairly common. The young are weaned at five to six months of age. Sexual maturity is reached by about 2 years of age.

Breeding interval: These animals can breed annually.

Breeding season: Breeding occurs in June and July.

Range number of offspring: 1 to 2.

Range gestation period: 120 to 129 days.

Range weaning age: 5 to 6 months.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 74.67 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
548 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
548 days.

Infants can be found clinging to their mothers' bellies for the first 3 weeks and will shift only to nurse. At about 3 weeks of age, the young lemur will begin to ride on its mother's back and will soon after take its first tentative steps. Nursing continues until about 5 to 6 months of age. Mothers provide grooming, protection, and transportation for their young, as well as valuable socialization. The role of males in parental care is not clear, although there is some evidence that males can be infanticidal in captivity. They may, therefore, have some role in protecting their offspring in the wild.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
  • Duke University, 1998. "Blue eyed lemur" (On-line). Duke Primae Center. Accessed August 08, 2005 at http://primatecenter.duke.edu/animals/blueeyed/print.php.
  • Henson Robinson Zoo, 1997. "BLACK LEMUR (Eulemur macaco)" (On-line). Accessed (Date Unknown) at http://www.hensonrobinsonzoo.org/o003.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eulemur macaco

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2546-09|AB371088|Eulemur macaco| AATCGTTGATTTTATTCAACCAATCATAAAGATATCGGAACTCTTTATCTCCTATTTGGGGCTTGAGCAGGCATGGTAGGAACAGCTCTT---AGCCTTTTAATTCGAGCTGAACTTGGTCAACCAGGGGCTTTACTAGGAGAT---GACCAAATCTATAATGTAATCGTAACAGCCCATGCTTTCGTTATAATTTTTTTCATAGTTATACCTATCATAATCGGAGGCTTTGGGAATTGACTAGTCCCCTTAATA---ATTGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGCTTCTGGCTTCTACCACCATCCTTCTTACTACTTCTAGCGTCTTCAATAGTAGAGGCAGGCGCTGGAACTGGGTGAACCGTATATCCTCCTCTAGCTGGGAACTTGGCTCATGCAGGGGCCTCCGTAGACTTA---ACAATTTTTTCATTACACCTAGCAGGAGTATCCTCAATTCTAGGGGCTATCAACTTTATTACCACAGTAATTAACATAAAACCCCCAGCCATATCACAGTACCAAACGCCTCTATTCGTATGATCTGTGATAATTACCGCTGTCCTTCTACTTCTGTCCCTACCAGTTCTAGCAGCA---GGAATTACTATACTCTTAACTGACCGTAATCTCAACACAACATTTTTTGATCCTGCAGGAGGAGGTGATCCAATTCTATATCAACATTTATTCTGATTCTTCGGACATCCTGAAGTCTACATCTTAATCCTTCCAGGCTTTGGCATAATTTCACACATTGTCACATATTATTCAGGTAAAAAA---GAGCCATTTGGTTATATAGGCATAGTCTGAGCTATAATATCCATTGGCTTCCTAGGATTTATCGTATGAGCTCACCACATATTCACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eulemur macaco

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(i,ii,iii,v)

Version
3.1

Year Assessed
2011

Assessor/s
Andrainarivo, C., Andriaholinirina, V.N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R.A., Perieras, A., Princee, F., Rabarivola, J.C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Sussman, R., Thalmann, U., Wilmé, L. & Wright, P.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B.

Contributor/s

Justification
Listed as Vulnerable as the species has a range well less than 20,000 km², is severely fragmented, and there is ongoing decline in extent, area and quality of habitat, as well as in the numbers of mature individuals due to levels of exploitation.

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A4cd

Version
3.1

Year Assessed
2011

Assessor/s
Andrainarivo, C., Andriaholinirina, V.N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R.A., Perieras, A., Princee, F., Rabarivola, J.C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Sussman, R., Thalmann, U., Wilmé, L. & Wright, P.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B.

Contributor/s

Justification
Listed as Critically Endangered based on a suspected ongoing decline in the taxon’s area of occupancy and quality of habitat (and, thus, a population size reduction) of ≥80% over three generations (or 24 years, assuming a generation length of eight years), the causes of which have not ceased and will to a large extent not be easily reversible (see e.g., Seiler et al. in press); and on very high actual levels of exploitation (Andrianjakarivelo 2004 found a density of up to 570 lemur traps/km² within certain areas of Eulemur flavifrons distribution).

History
  • 2000
    Critically Endangered
  • 1996
    Critically Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

All lemurs are considered endangered by the U.S. Fish and Wildlife Service and are protected under Appendix I of CITES. They are also listed as vulnerable in the IUCN Red Data Book. Evidence indicates that their numbers are declining. The main threats to black lemurs include habitat destruction, poaching for their meat or fur, and capture for the pet trade or zoos. They have also been killed in some areas as crop pests.

Lemurs breed fairly well in captivity and are popular in zoos worldwide. The St. Louis Zoological Park in the United States coordinates the Species Survival Plan (SSP) for black lemurs. Reintroduction of lemurs bred in captivity may be used one day to boost wild populations.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The black lemur is classified as Vulnerable (VU A1cd) on the IUCN Red List (1) and is listed on Appendix I on CITES (8). Two subspecies of the black lemur are recognised. The black lemur Eulemur macaco macaco is classified as Vulnerable (VU B1+2bc), and Sclater's lemur (or blue-eyed black lemur) E. m. flavifrons is classified as Critically Endangered (CR A1cd, B1+2bc) on the IUCN Red List (1) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population status of the Black Lemur is not known.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In E. flavifrons, mean density was calculated to be 24 indviduals/km² in the eastern part of the species’ range (Andrianjakarivelo 2004) and 97 individuals/km² in the Ankarafa Forest on the Sahamalaza Peninsula (Volampeno et al. 2011), but the latter figure seems to be unusually high.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Slash-and-burn agriculture is a persistent threat to north-western Madagascar’s remaining forests, where E. macaco is also hunted for food or killed as a crop pest in some areas. Hunting with traps seems to kill females preferentially, as they tend to lead groups in travel. There is also a small, but persistent, trade in this species as pets, particularly on Nosy Be.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats

The greatest threat to the Blue-eyed Black Lemur is habitat destruction due to the continuing slash-and-burn agriculture as well as selective logging and “feu de colère” (Seiler et al. in press). Logging and forest fires have increased dramatically since the onset of the political crisis in Madagascar in early 2009. The species is also hunted for food, especially by the Tsimihety in the eastern range of its distribution, where Andrianjakarivelo (2004) found a trap density of up to 570 traps/km² within certain areas. Blue-eyed Black Lemurs are locally kept as pets.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This species is threatened by habitat destruction, hunting for meat or fur, and by trapping for the pet trade (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix I of CITES. E. macaco occurs in two strict nature reserves (Lokobe and Tsaratanana) and in the Manongarivo Special Reserve. It is protected on the island of Nosy Komba where the local people consider it sacred and the animals serve as a major tourist attraction (Mittermeier et al. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions

This species is listed on Appendix I of CITES. Parts of the distribution area of E. flavifrons officially received protected area status in 2007 (Parc National Sahamalaza-Iles Radama), including the Sahamalaza Peninsula and some mainland forests to the north and east (Lernould 2002, Schwitzer and Lork 2004, Schwitzer et al. 2006). The Sahamalaza Peninsula is also a UNESCO Biosphere Reserve.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The back lemur occurs in three protected areas in Madagascar but its range is limited and its distribution patchy (2). Sclater's lemurpopulations are even lower as this subspecies seems less adaptable to the disturbed forest (2). A national park has been proposed within this lemur's range, and it is hoped that this will allow this species to recover (2). However, the threats facing Madagascar's forests are so great it seems unlikely the black lemur will recover without intervention. Captive breeding projects in association with the Species Survival Plan are now being co-ordinated by the St. Louis Zoological Park in the United States. Fortunately lemurs breed well in captivity and it is hoped that reintroducing these lemurs may be successful and boost wild populations in the near future (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Black lemurs are considered crop pests by farmers in some areas.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Humans have found the black lemurs to be useful as a food resource and for their furs. They can also be trapped and sold to people as pets or used as attractions in zoos.

Positive Impacts: pet trade ; food ; body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue-eyed black lemur

The blue-eyed black lemur (Eulemur flavifrons), also known as the Sclater's lemur, is a species of true lemur. It can attain a body length of 39–45 cm, a tail length of 51–65 cm- a total length of 90–100 cm, and a weight of 1.8-1.9 kg.[3] Being a primate, it has strong hands with palms like a human, which have a rubbery texture to give it a firm grip on branches. Its tail is longer than its body and non-prehensile.

Like many of the species in the Eulemur genus, the blue-eyed black lemur is sexually dichromatic. Males are solid black in color, with the hairs sometimes tinged brown at the roots. Females are reddish-brown in color with their underside and outline of their face a lighter tan. They have a dark brown or gray muzzle and the back of their hands and feet are a similar dark color. Both sexes have blue eyes, hence the common name, and are one of the only primates other than humans to consistently have blue eyes. The eyes can range in color from shocking electric blue, a light sky-glue, or a softer gray-blue.

Although the blue-eyed black lemur and the black lemur look similar, they can be differentiated by the blue eyes and lack of prominent ear tufts of this subspecies, while the black lemur has orange-red eyes and long, spiky cheek hairs. In the Manongarivo Special reserve, where the range of the two species overlap, there is report of hybridization between the two species, but the resulting offspring always have orange eyes. Until 2008, the blue-eyed black lemur was considered a subspecies, E. macaco flavifrons, of the black lemur.[1]

Contents

Behavior

This true lemur has not been studied intensively in the wild, but it is known to be fairly social. Group sizes vary dramatically with numbers of 2-15 individuals having been observed, although 7-10 individuals being the most common. Females are dominant as in most lemur species, and there are usually more males than females in each social group. The blue-eyed black lemur is thought to be polygynous. Females give birth to one or two offspring in June or July, after a gestation of 120 to 129 days. The young are weaned after about 5–6 months, and reach maturity at about 2 years of age. It may live between 15–30 years in captivity, with little data recorded on their longevity in the wild. It demonstrates a cathemeral activity pattern, being awake sporadically throughout the day. The occasional nighttime activities are thought to be based on the intensity of the moonlight.

The blue-eyed black lemur communicates with scent-marking, vocalizations, and perhaps some facial expressions. Scent marking is an important means of communication as with most lemur species. Both genders will mark on trees with anogenital glands, while males will also mark using wrist and palm glands by rubbing and twisting them against leaves, twigs or branches. Males also use a scent gland on the top of their head to mark, lowering their head and rubbing in quick sliding motions.[4] Little is known of its vocalizations, but it has been observed making a variety of grunts, chirps, barks and clicks. The males are known to make a sharp 'scree' when distressed.

The blue-eyed black lemur has also been observed to be a highly aggressive subspecies. There is frequent infighting between troop members, especially during the breeding and birthing seasons. In captivity it has been observed committing infanticide against other species of lemurs, a behavior that is usually uncommon, especially in captivity.

Diet

Detail of face showing blue eyes (male, captive specimen in Edinburgh Zoo)

Fruit, pollen, and nectar make up the bulk of this lemur's diet. During the dry season when food is scarce it may eat leaves, seeds and berries and rarely insects. It may also raid farmlands and eat some of the crops, which may lead to it being shot by farmers.

The blue-eyed black lemur helps propagate many rain forest plants. Since it digests the flesh but not the seeds of the fruits it eats, it spreads the seeds of more than 50 different plant species (deposited in a fresh pile of fertilizer), and some plants may have evolved specifically to be dispersed by this lemur. The blue-eyed black lemur also pollinates many plants while it eats nectar and pollen from the plants' flowers.

Habitat

The blue-eyed black lemur inhabits primary and secondary sub-tropical moist and dry forests in the northwestern tip of Madagascar. Its range extends from the Andranomalaza River in the north, to the Maevarano River in the south. Some areas where it can readily be seen are in the forests south of Maromandia near Antananarivo and Antsiranana. It may also be seen in the remaining forest patches of the Sahamalaza Peninsula, such as the Ankarafa forest. Unfortunately, it is not currently found in any protected forests on the island.

Conservation

Humans have cut down almost all of this subspecies' habitat to clear farm land. As a result, the blue-eyed black lemur is nearly extinct in the wild. The blue-eyed black lemur is listed on Appendix I of CITES, and is critically endangered.[2] As few as 1,000 individuals are thought to remain in the wild, largely due to slash and burn habitat destruction, as well as a mild threat from hunting problems. Consequently, this species has been named one of "The World's 25 Most Endangered Primates."[5]

References

  1. ^ a b Mittermeier, R. A. et al. (2008). "Lemur Diversity in Madagascar". International Journal of Primatology 29 (6): 1607–1656. doi:10.1007/s10764-008-9317-y. 
  2. ^ a b Andrainarivo, C., Andriaholinirina, V.N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R.A., Perieras, A., Princee, F., Rabarivola, J.C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Sussman, R., Thalmann, U., Wilmé, L. & Wright, P. (2011). "Eulemur macaco ssp. flavifrons". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/8211. Retrieved 18 January 2012. 
  3. ^ Mittermeier, RA (2006). Lemurs of Madagascar. p. 291. ISBN 1-881173-88-7. 
  4. ^ Duke Lemur Center
  5. ^ Oates, R.A.; Wallis, J.; Rylands, A.B. et al, eds. (2009) (PDF). Primates in Peril: The World's 25 Most Endangered Primates 2008–2010. Illustrated by S.D. Nash. Arlington, VA.: IUCN/SSC Primate Specialist Group (PSG), International Primatological Society (IPS), and Conservation International (CI). pp. 1–92. ISBN 978-1-934151-34-1. http://www.primate-sg.org/PDF/Primates.in.Peril.2008-2010.pdf. 
  • C. Birkinshaw. Biotropica. 2001. 33(3): 478–486.
  • Birkinshaw, et al. Folia Primatology (Basel). 1998. 69(5):252-259.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Black lemur

The Black Lemur (Eulemur macaco) is a species of lemur from the family Lemuridae. Like all lemurs, it is endemic to Madagascar. Originally, the species was thought to have two subspecies,[3] Eulemur macaco macaco and Eulemur macaco flavifrons, both of which were elevated to species status by Mittermeier et al. in 2008 to Eulemur macaco and Eulemur flavifrons respectively.[3]

Sclater's LE. flavifrons has blue eyes, the only primate other than humans which has blue eyes,[4] while E. macaco has brown or orange eyes, and ear tufts.[4][5]

Both species live in northwest Madagascar. E. macaco occurs in moist forests in the Sambirano region of Madagascar and on nearby islands.[4] E. flavifrons is restricted to the Sahamalaza Peninsula and adjacent forests.[4] There are reports of the two species hybridizing where their ranges overlap in Manongarivo Special Reserve.[6]

Contents

Physical description

The Black Lemur is between 90 and 110 centimeters in length, of which 51-65 centimeters are tail.[4] Weight typically ranges between 1.8 and 2.0 kilograms.[4]

The Black Lemur displays sexual dimorphism in coloration. Males have black or dark chocolate fur, while females' fur is of a lighter brown color, generally medium brown, chestnut brown or even orange-brown.[4] Males of E. m. macaco have large black ear tufts, while females of E. m. macaco have large white ear tufts.

The only other Eulemur species that occur within the range of the Black Lemur are the Common Brown Lemur, E. fulvus, which overlaps with E. macaco at the extreme southern and eastern edge of its range,[4] and the Red-bellied Lemur, E. rubriventer, on the Tsaratanana Massif.[6] E. fulvus and E. rubriventer have different coloration and do not show the extreme sexual dimorphism of E. macaco, making confusion between the Black Lemur and the species unlikely.[4][6]

Diet

The Black Lemur primarily eats fruit,[7] which makes up an estimated 78% of is diet.[8] The ripeness of this fruit is vital to the lemur's diet.[8] Other foods eaten include flowers, leaves, fungi, some invertebrates and, especially during the dry season, nectar.[4]

Behavior

Male and female Black Lemurs. This image was taken in Madagascar.

The Black Lemur lives in both primary and secondary forest.[7] It is active both during the day and at night.[4] It forages in both the upper and middle canopy, especially at night, and during the day it also forages in the understory.[4] In degraded habitats, it also forages on the ground and may even eat soil.[4]

The Black Lemur lives in groups of 2 to 15 members, including approximately equal numbers of males and females.[4] Average group size is about 10 members,[9] although the average may be smaller for E. m. flavifrons.[4] Females are dominant over males, although intragroup fighting is rare.[7]

Groups have home ranges of about 3.5 to 7 hectares.[9] Ranges overlap considerably, and population density can reach 200 individuals per square kilometer.[7]

Black lemurs also have a habit of picking up and biting at toxic millipedes. The toxins are usually not fatal to the lemurs and they try to stimulate the millipede to release its toxins in self defence. Once this is achieved the black lemur will rub the millipede around its body to get the toxins on its fur. Its believed that they do this to help repel insects with the millipedes poison. However other researchers have theorized that they may also do this for a source of pleasure. Because when they inhale or swallow too much of the toxins it inhibits their monoamine oxidase system and as a result gives them a high sensation.[citation needed]

Reproduction

Mating usually takes place in April and May.[4] During mating season, antagonism between males increases, and males sometimes roam between groups.[7] After a gestation of about 125 days, a single infant is usually born between late August and early October.[4] Females typically give birth for the first time at 2 years of age.[7]

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 115. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100041. 
  2. ^ Andrainarivo, C., Andriaholinirina, V. N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R. A., Perieras, A., Princee, F., Rabarivola, J. C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Sussman, R., Thalmann, U., Wilmé, L. & Wright, P. (2011). "Eulemur macaco". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/8201. Retrieved 18 January 2012. 
  3. ^ a b Mittermeier, R. A. et al. (2008). "Lemur Diversity in Madagascar". International Journal of Primatology 29: 1607–1656. doi:10.1007/s10764-008-9317-y. 
  4. ^ a b c d e f g h i j k l m n o p q Nick Garbutt (2007). Mammals of Madagascar. pp. 166–170. ISBN 978-0-300-12550-4. 
  5. ^ Noel Rowe (1996). The Pictorial Guide to the Living Primates. pp. 41–42. ISBN 0-9648825-0-7. 
  6. ^ a b c Russell Mittermeier et al. (2006). Lemurs of Madagascar (Second ed.). pp. 288–293. ISBN 1-881173-88-7. 
  7. ^ a b c d e f Robert W. Sussman (1999). Primate Ecology and Social Structure Volume 1: Lorises, Lemurs and Tarsiers. pp. 186–187. ISBN 0-536-02256-9. 
  8. ^ a b Rakotosamimanana, Berthe; Hanta Rasamimanana (1999). New Directions in Lemur Studies. Springer. ISBN 0-306-46187-0. 
  9. ^ a b Lisa Gould and Michelle Sauther (2007). "Lemuriformes". In Christina J. Campbell, Agustin Fuentes, Katherine C. MacKinnon, Melissa Panger and Simon K. Bearder. Primates in Perspective. p. 53. ISBN 978-0-19-517133-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!