Overview

Distribution

Range Description

Traditionally, the range of N. gabriellae includes northeastern Cambodia, south of Ratanakari province, and southern Viet Nam, south of Bach Ma. The range here extends further to the north to include animals that, at least phenotypically (coloration), are N. gabriellae, to include southern Lao PDR, as far north as Savannakhet and to Thua Thien Hue province (and possibly Quang Tri province) in central Viet Nam (Geissmann et al. 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Buff-cheeked gibbons are found in southeastern Asia, including southern Laos, eastern Cambodia, and central and southern Vietnam.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Gibbons have small body size compared to the other great apes in the family Hominidae. They range in weight between 7 and 11 kg and reach lengths between 60 and 80 cm. They have extremely long arms and relatively long legs. The hands are so long that they appear hook-shaped. The thumbs on the hands are not elongated and are not used for swinging from branch to branch; instead these thumbs are used more for grooming behavior. The body is generally held in an upright position.

In N. gabriellae, males have small, light-buff cheek patches that extend to the bottom of the eye and can be slightly separated at the neck. Females of this species are smaller than other gibbon females and have a black border on the ears. Females are generally brownish-yellow in color and can have a slight grayish tint to the darker hairs on the chest, on edges of fingers and toes, and on the outer forearm. Adult females may have slightly red-brown genital hairs, and usually there is a trace of a white fringe around the face. The pelage of buff-cheeked gibbons is very fine. Finally, females are only slightly smaller than males.

Pelage coloration changes as animals mature. The timing of the color changes is variable and it may take several months to complete. When a buff-cheeked crested gibbon is born, its coat is bright yellow. Within a few months, the color changes to black within a few months; only the cheek patches remain yellow. During this time, the young resemble adult males in their fur coloration. Males retain this color pattern as they mature, but females revert to a yellowish pelage around the time of sexual maturity.

Range mass: 7.0 to 11 kg.

Average mass: 8.5 kg.

Range length: 60 to 80 cm.

Sexual Dimorphism: male larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in tall evergreen and semi-evergreen forest (Geissman et al. 2000), although it probably ranges into other forest types (like mixed bamboo and woodland forest) adjacent to these, and may also occur in riverine and gallery forest associations. In Bach Ma National Park (central Viet Nam), gibbons appeared to live in lowland evergreen forest at altitudes between 400 and 800 m, although the park area also includes forest areas at higher altitudes (Geissmann et al. 2007). In Lao PDR, gibbons are found from the Mekong plains up to at least 1,550 in the Phou Ahyon area, and 1,650 m in Phou Louey National Biodiversity Conservation Area (Duckworth et al. 1999), but the species is scarce above an altitude of 1,500 m (Eames and Robson, 1993).

Like other gibbons, yellow-cheeked crested gibbons are arboreal and diurnal. Average group size is on the order 3?5 individuals. They feed mainly on fruit and leaves (Traeholt et al. 2005). Home range sizes in Nam Cat Tien National Park range from less than 30 ha in evergreen forest to up to 100 ha in bamboo forest (Traeholt et al. 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gibbons are all primarily arboreal species that generally avoid walking on the ground or swimming. The genus name, Hylobates, actually means "dweller in the trees." Nomascus gabriellae is found in tropical evergreen forests. These primates prefer lowland forests, and are rarely seen between above elevations of 1,500 to 2,000 m.

Range elevation: 2,000 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

This species is highly unstudied in the wild so all that is documented is from captive cases. Nomascus gabriellae is a selective eater and is mostly frugivorous. However, individuals have also been documented eating shoots, leaves, flowers, and occasionally insects.

Animal Foods: insects

Plant Foods: leaves; fruit; flowers

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Since all known behaviors and relationships are primarily studied in captivity, there is no documentation of the ecosystem role of N. gabriellae. However, the appetite of buff-cheeked gibbons for fleshy fruits would suggest they have a significant role in the disperal of seeds.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult gibbons typically live in the crown region of the forest where they have no natural predators except humans. In the lower stories of the forest, leopards, clouded leopards, and pythons may be potential predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Gibbons are famous for their calls. Gibbon groups produce loud, stereotyped songs in the early morning. Songs are thought to function primarily in defense of resources such as territories, food trees, and mates. However, songs may also help to attract potential mates. Gibbon songs include species-specific characteristics which are inherited rather than learned.

Mated pairs of buff-cheeked gibbons typically produce duet songs which consist of coordinated vocal interactions by both partners using sex-specific phrases. Other family members may participate in the song. Solo songs are typically produced by unmated buff-cheeked crested gibbons only.

Also, buff-cheeked gibbons have extended fields of skin glands situated in the axillary, sternal, and inguinal areas of the body. The glands produce a reddish secretion and are particularly active under hot temperatures and when the animals are excited. It is thought that the glands may play a role in olfactory communication. The glandular secretion also influences the amount of red visible in the yellowish female pelage coloration.

Tactile communication occurs when these animals groom one another, play, or mate. Visual communication signals, such as body postures and facial expressions, are also used by these primates.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: duets

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little research has been done on this species of gibbon in the wild, so its lifespan and survivorship in the wild are unknown. The only data on the lifespan of N. gabriellae is from captivity, where individuals of this species can live up to 50 years.

Range lifespan

Status: captivity:
50 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The mating system of all gibbons is monogamy. All gibbon species have nuclear families consisting of a mated pair and 0 to 4 dependent offspring.

Mating System: monogamous

The breeding pair in the nuclear family can produce an infant every 2 to 3 years. The interbirth interval tends to be long because females nurse the young for up to two years. There has never been any record of twins being born in a buff-cheeked gibbon family. Buff-cheeked gibbons have a relatively long gestation of 7 months, and the offspring stay with the family unit for 6 to 8 years.

Breeding interval: These gibbons breed every 2 to 3 years.

Breeding season: Gibbons breed throughout the year.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Average gestation period: 7 months.

Average weaning age: 24 months.

Range time to independence: 6 to 8 years.

Range age at sexual or reproductive maturity (female): 6 to 8 years.

Range age at sexual or reproductive maturity (male): 6 to 8 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Buff-cheeked gibbons have extensive parental investment by both parents. Females necessarily provide nutrition through nursing the young, but both parents may groom, carry, and protect the immature gibbons. The young stay with the parents for 6 to 8 years after birth. After this time, they move away to establish territories and families of their own.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Protecting: Male, Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Hylobates gabriellae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Nomascus gabriellae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTCCTAGGCACAGCCCTAAGCCTCCTCATCCGAGCCGAACTAGGTCAGCCTGGCAACCTCCTGGGCAAC---GACCATATTTATAATGTCATCGTAACAGCCCACGCATTCGTCATAATCTTTTTCATAGTAATACCTATCATGATTGGAGGCTTTGGTAACTGACTAGTTCCTCTAATAATCGGTGCCCCCGACATGGCATTCCCCCGTATGAATAACATAAGCTTCTGACTCCTCCCTCCCTCTTTCCTACTACTACTTGCATCCGCCATAGTGGAAGCCGGCGCCGGAACAGGATGAACGGTATATCCCCCACTAGCAGGAAACTACTCCCACCCAGGAGCCTCCGTTGACCTAACCATCTTTTCCCTCCACCTGGCCGGAGTATCATCCATCCTGGGAGCTATCAATTTTATTACTACAATCATCAACATGAAGCCCCCAGCTATGTCTCAATATCAAACACCCCTCTTTGTCTGATCCGTCCTAATTACAGCAGTTCTACTCCTTCTCTCCTTACCAGTTCTAGCCGCCGGCATTACCATGCTATTAACGGATCGCAACCTCAACACCACTTTCTTTGACCCGGCTGGAGGAGGAGAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nomascus gabriellae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Geissmann, T., Manh Ha, N., Rawson, B., Timmins, R., Traeholt, C. & Walston, J.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
This species is considered Endangered based on an estimated population reduction of over 50% when considering the past 45 years (three generations) due primarily to hunting and habitat loss. A close monitoring of this species is required given predicated likely rates of both habitat loss and hunting in the future.

History
  • 2000
    Vulnerable
  • 1996
    Data Deficient
    (Baillie and Groombridge 1996)
  • 1996
    Data Deficient
  • 1996
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The species is threatened by habitat loss (from development and logging) and by hunting. Also, extensive military activities have had a detrimental effect on the species mainly through habitat destruction. This species is not efficiently protected at present, not even in nature reserves and national parks. There are some local laws forbidding the hunt of these animals, but they are poorly enforced. Only international trade laws that forbid sale of these creature and their body parts in Europe and the US are enforced.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is likely that this species is the most common of the crested gibbons in Viet Nam, although this is difficult to assess given the uncertainty of the identity of animals in the northern part of the range (Geissmann et al. 2000). Brickle et al. (1998) reported that it was fairly common in some areas of Dak Lak province, and the Lam Dong Plateau seems to support a relatively large population of this species (Geissmann et al. 2000). In Bach Ma National Park (central Viet Nam), eight groups were recorded during a survey covering one 6 km2 of the park (Geissmann et al. 2003). In Cat Tien National Park the population has been estimated at 150 groups and around 500 individuals (Hao et al. 2005). Based on a status report, Geissmann et al. (2003) recorded 15 localities where traditional N. gabriellae should occur, of which five no longer held any populations. There were an additional nine localities for the questionable N. gabriellae area, and gibbons no longer occurred in three of these. These must have been relatively recent losses. Recent disappearance of individual groups (for undetermined reasons) was also reported for Bach Ma National Park (Tallents et al. 2001), and disappearance of individual groups as a result of habitat clearance was reported for Nam Cat Tien (Geissmann 1995).

In Cambodia, in Seima Biodiversity Conservation Area, the population is estimated at between 1,300 and 1,700 groups (Rawson and Clements in prep.), but including the surrounding forested areas the total population may be twice this size (Traeholt et al. 2005). Other estimates include: about 850 groups in Snoul Wildlife Sanctuary; about 360 groups in Phnom Prich Wildlife Sanctuary estimated; 330 groups in Nam Lyr Wildlife Sanctuary; 5,750 groups in Virachey National Park, and 1,100 groups in the Pheapimex concession (Traeholt et al. 2005).

In Lao PDR, high gibbon densities have been reported from Xe Pian National Biodiversity Conservation Area (Duckworth et al. 1995, 1999). There is an estimated 400-6,720 groups from Xe Pian National Biodiversity Conservation Area (Duckworth et al. 1995). The large Xe Pian-Dong Hua Sao National Biodiversity Conservation Areas population is of major global significance for gibbon conservation (Duckworth et al. 1999).

During a survey of about 6 km2 of Bach Ma National Park (Thua Thien Hue province, central Viet Nam) where forests occupy 220 km², a density of about 1.3 goups/km2 was estimated (Geissmann et al. 2007). Among six provinces from Thua Thien Hue (central Viet Nam) to Thanh Hoa (southern part of north Viet Nam), Dak Rong Nature Reserve (Quang Tri province, central Viet Nam) was identified as one locality with the highest gibbon density, with an estimated density of only 0.06 groups/km2 (Nguyen Manh Ha et al. 2005). Estimated population densities in Cambodia range from 0.00 to 3.73 groups/km2 (n = 15), with an average of 1.47 groups/km2 (Traeholt et al. 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threat in Cambodia and Viet Nam is hunting for the pet trade, although in Lao PDR hunting takes place mainly for food. Areas in southern Viet Nam have been heavily degraded by the spraying of aerial defoliant, agricultural encroachment, and logging, though this species appears to survive in moderately disturbed forest, as suggested by its continued presence in Cat Tien National Park and Dak Uyn Sate Forest Enterprise (Geissmann et al. 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed in CITES Appendix I. In Viet Nam it is listed on Appendix 1B of Decree 32, 2006. In Cambodia, yellow-cheeked gibbons have been recorded from several protected areas, including Snoul Wildlife Sanctuary, Seima Biodiversity Conservation Area, Phnom Prich Wildlife Sanctuary, Nam Lyr Wildlife Sanctuary, and Virachey National Park (Traeholt et al. 2005). In Lao PDR, they are present in effectively all protected areas within their range (Duckworth et al. 1999). In Viet Nam, Bach Ma National Park, Cat Tien National Park, Bu Gia Map National Park and Nui Chua National Park hold important populations (T. Geissmann et al. pers comm.).

Recommended conservation actions for this species include: regulation of hunting and wildlife trade; minimization of habitat disturbance; and research and field surveys throughout the range, specifically sound recordings, genetic analysis and photographic recordings to help better define the distribution area (Geissmann et al. 2000).
The species is the second-most common species of crested gibbons (genus Nomascus) maintained in zoos (Gibbon Network 2006; Moisson and Baudier 2005; Varsik 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There is no known threat or negative impacts to humans by N. gabriellae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Some asian cultures use these animals for medicine, food, and pets, but not N. gabriellae exlusively. There is no particular eco-tourism draw with these animals.

Positive Impacts: pet trade ; food ; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellow-cheeked gibbon

Female adults at the Cincinnati Zoo

The yellow-cheeked gibbon (Nomascus gabriellae), also called the golden-cheeked gibbon, yellow-cheeked crested gibbon, the golden-cheeked crested gibbon or the buffed-cheeked gibbon, is a species of gibbon native to Vietnam, Laos and Cambodia.[1]

The yellow-cheeked gibbon is born blond and later turns black, and males carry this colouring through their lifespan and have the distinguishing golden cheeks; females are born blonde to blend into their mother's fur but they later turn black and turn back to blond at sexual maturity and only have a black cap on the top of their heads.[3]

This diurnal and arboreal gibbon lives in primary tropical rainforest, foraging for fruits, using brachiation to move through the trees.

The yellow-cheeked gibbon, like all gibbon species, has a unique song which is usually initiated by the male.[citation needed] The female will then join in and sing with the male to reinforce their bond and announce to other gibbons that they are a pair in a specific territory.[4] The male usually finishes the song after the female has stopped singing.[citation needed]

Little is known about this species in the wild, but it is thought that it has a life span of approximately 46 years.[5]

A recent report by the Wildlife Conservation Society counted 2,500 yellow-cheeked crested gibbons in Cambodia’s Seima Biodiversity Conservation Area, an estimate that represents the largest known population of the species in the world.[6]

References[edit]

  1. ^ a b Groves, C. P. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. p. 180. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ Geissmann, T., Manh Ha, N., Rawson, B., Timmins, R., Traeholt, C. & Walston, J. (2008). Nomascus gabriellae. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 January 2009.
  3. ^ Geissman, Thomas. "Fact Sheet: Yellow-Cheeked Crested Gibbon". Retrieved 4 December 2012. 
  4. ^ Quist, Erin. "Nomascus gabriella". 
  5. ^ Quist, Erin. "Nomascus gabriella". 
  6. ^ Unexpected Large Monkey Population Discovered Newswise, Retrieved on August 28, 2008.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!