Overview

Distribution

Range Description

This species is found in Sumatra (Indonesia) (southeast of Lake Toba and the Singkil River), Peninsular Malaysia (from the Mudah and Thepha Rivers in the north to the Perak and Kelanton Rivers in the south) and south Thailand (near the Malaysian border, east of the Thepha River watershed (Gittins 1978; Groves 2001; Marshall and Sugardjito 1986; W. Brockelman pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Gibbons are found throughout the tropical rainforests of South and Southeast Asia. Agile gibbons, Hylobates agilis, are found in Thailand, Indonesia, and Malaysia.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Lesser apes in the family Hylobatidae are generally small. The average weight of H. agilis is 5.4 kg for females and 5.8 kg for males. Agile gibbons come in a variety of different colors, including black, brown, light tan and reddish-brown. Both sexes have white eyebrows. Males and females can be easily distinguished by the white eyebrows and cheeks possessed by the males.

Gibbons lack tails. Hylobates agilis, like other gibbons, has extremely long arms and fingers. This adaptation aides in brachiation, the prnciple mean of locomotion for these animals. Brachiation consists of hanging from branches and swinging from tree to tree.

Range mass: 4 to 6 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs at highest densities in dipterocarp-dominated forests, but their known habitat ranges from swamp and lowland forests to hill, submontane, and montane forests (O?Brien et al. 2004). Additionally, populations in Bukit Barisan Selatan National Park in Sumatra do not seem to avoid forest edges near human habitations (O?Brien et al. 2004). In southern Sumatra, populations were found up to 1,400 meters (O?Brien et al. 2004).
These arboreal and diurnal primates are primarily frugivorous (preferring fruits high in sugar, such as figs), but they will consume immature leaves and insects as well (Gittins 1979, 1982). An average home range size of 29 ha has been determined in a study at Sungai Dal (Gunung Bubu Forest Reserve) on the Malayan peninsula (Gittins 1979, 1982; Gittins and Raemaekers 1980).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Hylobates agilis is found in the tropical rainforests of Thailand, Malaysia, and Indonesia. They live in the upper canopy of the forest, feeding on fruits, leaves, and insects. Members of Hylobates spend most of their lives in the trees, and rarely descend to the ground.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Hylobates agilis consumes large amounts of fruits. Like other gibbons, these animals are primarily frugivorous. Agile gibbons have also been observed eating a variety of other foods, including leaves, flowers, and insects. Due to their active lifestyle, it is necessary for them to eat food rich in calories. Fruits have a high caloric content.

Animal Foods: insects

Plant Foods: leaves; fruit; flowers

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As these animals are not likely to be an important source of food for other animals, their greatest role in the ecosystem is probably seed dispersal for the fruits they eat.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Details on predation in this species are not available. However, snakes and raptors are probably the greatest threats to these animals. Because of their highly arboreal lifestyle, many potential predators are not likely to have access to these animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As in all primates, communication in this species is complex and involved several different modalities.

As mentioned in the "Behavior" section, above, these animals are highly vocal, and use great call vocalizations to defend their territories from other mated pairs.

Tactile communication is also important, between mates, and between parents and their offspring. Tactile communication involves grooming, mating, play and sometimes aggression.

In addition to vocal and tactile forms of communication, these animals use facial expressions, gestures, and body postures to communicate with conspecifics.

Communication Channels: visual ; tactile ; acoustic

Other Communication Modes: duets

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The reported lifespan in captivity for these lesser apes is 44 years. Wild animals probably do not live as long.

Range lifespan

Status: captivity:
44 (high) years.

Average lifespan

Sex: male

Status: captivity:
44.0 years.

Average lifespan

Status: wild:
25.0 years.

Average lifespan

Sex: female

Status: captivity:
28.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 49 years (captivity) Observations: One wild born female, estimated to be around 49 years old, was still alive in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Hylobates agilis forms monogamous bonds. Mated pairs stay together until one of them dies.

Mating System: monogamous

Hylobates agilis becomes sexually mature around the age of 8 years. The gestation period is about seven months. These animals give birth to a single offspring per pregnancy, and a mated pair can produce five to six offspring during their reproductive lifetime. The interbirth interval for H. agilis is around forty months.

Breeding interval: The interbirth period for H. agilis is around forty months.

Breeding season: These animals do not have a strict breeding season.

Average number of offspring: 1.

Average gestation period: 7 months.

Average age at sexual or reproductive maturity (female): 8 years.

Average age at sexual or reproductive maturity (male): 8 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average number of offspring: 1.

Most female gibbons nurse and care for their offspring until the offspring are about two years old. Offspring remain with their parents until they reach sexual maturity, around eight years, they then disperse from their natal group.

Males also particpate in parental care in this monogamous species. Males groom offspring, and help to defend them.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hylobates agilis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2977-10|AB504748|Hylobates agilis| GACCGCTGGTTATTCTCCACAAACCATAAAGATATTGGAACACTATACTTGCTATTTGGCGCATGGGCCGGAGTCCTAGGCACAGCCCTA---AGCCTCCTCATTCGAGCCGAACTAGGTCAGCCCGGCAATCTCCTGGGCAAC---GACCATATCTATAACGTCATTGTAACAGCCCACGCATTCGTCATAATCTTTTTTATAGTAATACCTATCATAATTGGGGGCTTTGGCAACTGGCTCATCCCCCTGATA---ATCGGCGCCCCCGATATAGCATTCCCTCGTATAAATAACATAAGCTTCTGACTTCTTCCCCCCTCCTTCCTACTACTGCTTGCCTCCGCTATAGTAGAGGCCGGCGCCGGAACGGGGTGAACAGTCTACCCTCCGCTAGCAGGGAACTACTCCCACCCAGGAGCCTCTGTTGACCTA---ACCATTTTTTCTCTACACCTGGCCGGAGTATCATCTATCCTAGGGGCTATTAACTTCATTACCACAATCATTAACATAAAACCCCCGGCCATATCCCAATATCAAACACCCCTCTTTGTCTGATCCGTCCTAATTACAGCCGTCCTACTCCTCCTCTCCCTACCAGTTCTAGCCGCC---GGCATTACCATACTACTAACGGACCGCAACCTCAACACCACTTTCTTTGACCCCTCCGGAGGGGGAGACCCTATCCTATATCAACACCTATTCTGATTCTTTGGTCACCCCGAGGTTTATATTCTCATCCTACCAGGCTTCGGAATAATTTCACATATCGTAACACACTACTCAGGAAAAAAA---GAACCATTCGGATATATGGGCATAGTCTGAGCCATAATATCAATTGGCTTCCTAGGTTTCATTGTCTGAGCCCACCATATATTCACGGTAGGTATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hylobates agilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Geissmann, T. & Nijman, V.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
The species is considered Endangered in light of a continued decline inferred from habitat loss, calculated to be ? 50% over the past 45 years (3 generations), in combination with illegal trade for the pet market. Threats are driven primarily in the Sumatran portion of its range where the species seems to be declining rapidly and is certainly endangered. On the mainland (Peninsular Malaysia and Thailand), there seem to be a number of stable populations, but the range has contracted. The species is entirely confined to closed canopy forest, and thus, habitat conversion, road building and fragmentation are increasingly threatening the species.

History
  • 2000
    Lower Risk/near threatened
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Hylobates agilis is listed by IUCN as an endangered species. Due to massive deforestation, their habitat is rapidly decreasing. This loss of habitat due to logging and agricultural demands is the main threat to gibbon species. Conservation measures have been taken, such as reserve game parks and breeding programs in zoos. Unfortunately, these measures are not enough, and more intense conservation efforts must be initiated in order to ensure the survival of these species.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
O'Brien et al. (2004) performed a population assessment in 2002 on agile gibbons in Bukit Barisan Selatan National Park, Sumatra, Indonesia. Using calling counts in both forest edge and interior habitats, and basing their estimate on forest cover area in the park, they calculated a population of 4,479 agile gibbons (CV = 30%) (O?Brien et al. 2004). In Peninsular Malaysia, Belum and Ulu Muda are strongholds. Portions of the population in Thailand likely number a few thousand individuals, located in approximately three forests fragments/reserves (W. Brockelman pers. comm.).

Density estimates for this species range from 1.4-2.8 individuals/km2 in Bukit Barisan Seletan (O?Brien et al. 2004), and 6-11.4 individuals/km2 in Kerinci-Seblat (Yanuar 2001) to 5.5-18.9 individuals (2-5 groups)/km2 in Sungai Dal on the Malay peninsula (Gittins 1979). Recent surveys in south Thailand reveal the density to be 2 groups/km2 in parts of Hala Bala Wildlife Sanctuary (W. Brockelman pers. comm.)

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
On Sumatra, this species is threatened by conversion of their forest habitats by humans and a subsequent opportunistic capture for the pet trade. These threats extend to populations within national parks and forests, including illegal agricultural development inside the parks. In Bukit Barisan Selatan National Park in southwestern Sumatra, deforestation rates are linked to the coffee market; coffee plantations serve to completely strip arboreal primates of their canopy habitats (O?Brien et al. 2004). The expansion of oil palm plantations is a major cause of forest loss on Sumatra. In nearby Java, agile gibbons are one of the most commonly seen gibbons in the wildlife markets (Nijman 2005).

The species? status in West Malaysia is uncertain; in Indonesia, it was certainly affected by fires and deforestation of the 1990s. There has been a probable 50%-plus range reduction in last 10 years (C. Groves pers. comm.), and oil palm plantations are expanding rapidly in the country. In Thailand there is extensive conversion of forests to rubber plantations and other crops (even inside protected areas), as well as hunting for the pet trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Agile gibbons are protected throughout their range by local laws as well as by listing on CITES Appendix I, although the extent to which national or international laws actually protect the species is uncertain.

The species occurs in a number of protected areas, including Bukit Barisan National Park, Kerinci Seblat National Park, Selantan National Park, and Way Kambas National Park in Indonesia; Mudah Wildlife Reserve in Malaysia; and Hala Bala Sanctuary in Thailand. Unfortunately, many of these are merely proposed or gazetted, and their actual protected status is uncertain. Moreover, many of the Sumatran reserves are in montane regions where the species occurs only at low densities. In Bukit Barisan Selatan National Park in southwestern Sumatra, populations are presently secure and healthy but will depend on the regaining of control by the Indonesian government over illegal deforestation of its parks for their continued survival (O'Brien et al. 2004).

As the validity of the subspecies is questionable, a research priority is to clarify this issue so that the species can be further assessed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There is no known negative economic effect of this species on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hylobates agilis is not an important economic resource for humans. These animals are sometimes hunted for food, and they are illegally captured for the pet trade. Poaching is a threat to H. agilis, for animals that are caught often die in transport from mishandling. Illegal poaching for meat and the pet trade are contributing factors in the declining numbers of H. agilis.

Positive Impacts: pet trade ; food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Agile gibbon

The agile gibbon (Hylobates agilis), also known as the black-handed gibbon, is an Old World primate in the gibbon family. It is found in Indonesia on the island of Sumatra, Malaysia, and southern Thailand. The species is listed as endangered on the IUCN Red List due to habitat destruction and the pet trade.

Contents

Taxonomy

The species is generally thought not to have subspecies, but some experts recognise a mountain form and a lowland form.[2]

Physical description

The agile gibbon has fur varying in color from black to red-brown. Its brow is white, and the male can be recognized by its white or light-grey cheeks. Additionally, the male is slightly larger than the female. The agile gibbon weighs from 4 to 6 kg (8.8 to 13 lb) with an average of 5 kg (11 lb), though in captivity it can reach 8 kg (18 lb).[3][4] It has a head and body length of 44–63.5 cm (17–25.0 in).[4] Like all gibbons it is tailless.

Behaviour

With its long arms they swing on branches, brachiating at a fast pace. Like all gibbons, it lives in serially monogamous pairs in a strictly enforced territory, which is defended with vigorous visual displays and songs.[3] The diet of the agile gibbon is generally frugivorous but have also been observed each leaves, flowers, and insects.[3]

Females give birth to a single offspring after seven months' gestation. The young gibbon is weaned at barely 2 years of age. When fully mature, at about 8 years, it leaves its family group in order to look for a mate.[3]

Distribution and habitat

The agile gibbon is found on Sumatra southeast of Lake Toba and the Singkil River, in a small area on the Malay Peninsula, and south Thailand near the Malaysian border.[2] It predominantly lives arboreally in rain forests and rarely comes to the ground.

References

  1. ^ Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 179. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100758. 
  2. ^ a b c Geissmann, T. & Nijman, V. (2008). Hylobates agilis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ a b c d Kuester, J. (2000). "Hylobates agilis". Animal Diversity Web. http://animaldiversity.ummz.umich.edu/site/accounts/information/Hylobates_agilis.html. Retrieved 6 January 2012. 
  4. ^ a b "Fact sheet: agile gibbon" (pdf). EAZA Ape Campaign. 2010. http://www.apecampaign.org/wp-content/uploads/2010/06/gibbon-agilis-fact-sheet.pdf. Retrieved 6 January 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!