Overview

Brief Summary

Biology

Bornean orang-utans are predominantly solitary, occupying large overlapping home ranges. The largest arboreal mammal, they spend almost all of their time in the trees, clambering between branches or using their body weight to bend and sway trees (2). Each night a nest is built from bent branches, high up in the trees (5). Orang-utans are the slowest breeding of all mammal species, with an inter-birth interval of approximately eight years (7). They are long-lived and females tend to only give birth after they reach 15 years of age. The infant spends its first two to three years being carried constantly and will still remain close to the mother for at least another three years (7). The orang-utan diet is composed of over 400 types of food, including wild figs (Ficus spp.) and durians (Durio spp.) (7). When fruit is scarce however, orang-utans will feed on leaves, seeds and even bark (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Orang-utan means 'person of the forest' (4) and this Asian ape is indeed truly a tree-dweller. Recent genetic evidence has led to the re-classification of Bornean and Sumatran orang-utans as separate species: Pongo pygmaeus and Pongo abelii respectively (5). Orang-utans have distinctive body shapes with very long arms that may reach up to two metres in length. They have a coarse, shaggy reddish coat (6) and grasping hands and feet (2). They are highly sexually dimorphic, with adult males being distinguished by their large size, throat pouch and flanges on either side of the face, known as cheek pads (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Bornean orangutan is endemic to the island of Borneo where it is present in the two Malaysian states of Sabah and Sarawak, as well as in three of the four Indonesian Provinces of Kalimantan.

Species distribution is now highly patchy throughout the island: it is apparently absent or uncommon in the south-east of the island, as well as in the forests between the Rejang River in central Sarawak and the Padas River in western Sabah (including the Sultanate of Brunei).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bornean orangutans (Pongo pygmaeus) currently inhabit only the island of Borneo, excluding the southeastern portion of Borneo. Fossil evidence indicates that their past distribution included much of Southeast Asia. Pongo pygmaeus was until recently considered the only orangutan species. Sumatran orangutans (Pongo abelii) are now considered a separate species.

Biogeographic Regions: oriental (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Borneo, Sumatra

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Fossil evidence suggests that orang-utans were once widely distributed in South East Asia, but the Bornean orang-utan is today restricted solely to the island of Borneo with the largest population located in Kalimantan, the Indonesian part of the island (8). Three subspecies are recognised; P. p. pygmaeus ranges from northwest Kalimantan to Sarawak, P. p. wurmbi occurs on southwest Kalimantan, and P. p. morio can be found on northeast Kalimantan to Sabah (1) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Bornean orangutans are sexually dimorphic. Females range from 30 to 50 kg, whereas males are from 50 to 90 kg. Head and body length is about 1.5 meters and the arms have a spread of about 2.2 meters. They have a thin, shaggy coat that is reddish brown in color. Males have large cheek pads, which are made up of deposits of subcutaneous fat bound by connective tissue. These cheek pads continue growing for much of an adult male's life. Orangutans have a high, sloping forehead and a bulging snout. They have short, weak legs, but strong hands and arms.

Range mass: 30 to 90 kg.

Average length: 1.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Orangutans are the largest arboreal mammals found on earth today. They are semi-solitary animals, but complex social networks of loose relationships are maintained between members of a community. Males tend to disperse further than females at maturity. More than 500 plant species have been recorded in their diet. Fruits make up more than 60% of their average total intake (Wich et al. 2006). The diet also includes leaves, barks, flowers and insects. Orangutans are best described as “gardeners” of the forest (Rijksen and Meijaard 1999); they play a vital role in seed dispersal, especially for large seeds that are not dispersed by smaller animals (Ancrenaz et al. 2006). Fruit availability in the Bornean forest directly impacts all aspects of their life: ranging patterns, seasonal movements, health, social and reproductive behaviour.

The orangutan is the only primate species with two different forms of mature males (bimaturism). Flanged males are twice the size of the female; they possess a long coat of dark hair on the back, a facial disk, flanges and a throat sac used for “long calls”. These males are rather intolerant and aggressive towards other adult males. Unflanged males do not possess these secondary sexual characteristics; they are the size of an adult female, they do not emit long calls nor do they show mutual intolerance. These two types of male both sire offspring and contribute to the reproduction of a given population (Goossens et al. 2006a). The transition from the unflanged to the flanged form can happen anytime; this depends mostly on complex social cues that are not yet fully understood.

Bornean orangutan distribution is patchy throughout the island. Large rivers are impassable natural barriers and limit their dispersal (Goossens et al. 2005). The species occurs typically at relatively low abundance in the Bornean forests: from 0.5 to 4.0 ind./km² in most populations (review in Singleton et al. 2004, van Schaik et al. 2005). Bornean orangutans are more abundant in low-lying forests (below 500 meters asl) than in uplands. Flood-prone forests and peatswamps produce more regular and larger fruit crops than dry dipterocarp forests and harbour the highest orangutan densities. Bornean orangutans are vulnerable to habitat disturbances, although the taxon P. p. morio shows a relative and unexpected tolerance to habitat degradation in the northern part of the island (Ancrenaz et al. 2005).

Females generally give birth to a single infant after a gestation period of approximately 245 days (Nowak 1999). Female Bornean orangutans reach maturity between 10 and 15 years old and reproduce every six to eight years on average (Nowak 1999, Wich et al. in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Bornean orangutans are only found in forested areas, but can be found in various types of forests, from low-level swamps to mountainous areas 1500 m in elevation. They can be found at various heights in the trees. They may move large distances to find trees bearing fruit.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Mainly inhabits lowland and hilly tropical rainforests (2), up to 800 meters above sea level (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet consists mainly of fruit, especially figs. Various species of figs ripen at different times in the year, and the movement pattern of the animals can largely be explained by their following this process. Bornean orangutans will also eat other kinds of vegetation, such as leaves, bark, buds, and flowers. They will also occasionally eat mineral-rich soil, insects, and possibly eggs and small vertebrates. They drink by reaching into tree holes and lapping water from their hands.

Animal Foods: eggs; insects

Plant Foods: leaves; wood, bark, or stems; fruit; flowers

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Becuase they are frugivorous, these animals play some role in seed dispersal.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Bornean orangutans fall prey to humans. Large snakes and raptors may take young orangutans.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Bornean orangutans have a vocal repertoire of about 13 sounds. Within a small social group they communicate with lip smacking. They scream when scared, and males sometimes roar. They seem to grind their teeth when frustrated. Males also emit a long series of loud groans, which can be heard by a human up to 1 kilometer away. This vocalization may serve to space males apart.

In addition to vocal communication, tactile communication is used by these animals. Social grooming is an important activity in all primates. Facial expressions, gestures, and body postures are also used to communicate.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

All of the great apes live a long time. In captivity, Bornean orangutans may reach the age of 60 years, although the lifespan in the wild is probably shorter.

Range lifespan

Status: captivity:
60 (high) years.

Average lifespan

Status: captivity:
59.0 years.

Average lifespan

Sex: female

Status: captivity:
57.3 years.

Average lifespan

Status: wild:
59.0 years.

Average lifespan

Sex: male

Status: captivity:
58.8 years.

Average lifespan

Status: wild:
35.0 years.

Average lifespan

Status: captivity:
50.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 59 years (captivity) Observations: Like other great apes, orangutans appear to be long-lived. Even in the wild, these animals might live more than 50 years. One field study conducted in the *abelii* subspecies estimated maximum longevity in the wild to be at least 58 years for males and at least 53 years for females without any evidence of menopause (Wich et al. 2004). One wild born male was about 59 years old when he died in captivity (Richard Weigl 2005). Some authors consider *Pongo pygmaeus abelii* to be a separate species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Bornean orangutans are polygynous. Although mainly solitary, the home ranges of males overlap those of females. On the rare occasions that the females within their home ranges are sexually receptive, dominant males will mate with them. Younger, smaller males, which are not able to maintain home ranges of their own, often wander alone through the forests. These males may also mate with females, although such copulations are generally forced, and appear to occur as the opportunity arizes, not because the female is sexually receptive or fertile.

Mating System: polygynous

Female Bornean orangutans have an estrous cycle about 30 days in length with ovulation occurring around the 15th day. This species does not have genital swelling during estrous, and females have a light menstrual flow lasting 3 or 4 days. Copulation is usually done with the male and female facing each other, each hanging by the arms from a tree branch. Gestation can take anywhere from 233 to 263 days, and typically one offspring is born, although twinning sometimes occurs. Weaning occurs around 42 months, although the timing of this may be affected by habitat quality. The interbirth interval is about 4 years, but can be much longer if conditions are poor. In females, sexual maturity is reached at 7 years of age, by which time females have attained their adult size. Males, however, continue to grow until they are 10 years old, and do not have the physical and social maturity required for successful mating until about 14 years of age.

Breeding interval: The interbirth interval is about 4 years

Breeding season: Breeding occurs throughout the year.

Range number of offspring: 1 to 2.

Range gestation period: 233 to 263 days.

Average weaning age: 42 months.

Average age at sexual or reproductive maturity (female): 7 years.

Average age at sexual or reproductive maturity (male): 10 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 1736.5 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2555 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
2555 days.

Newborn infants weigh around 1.5 kg. Babies nurse every 3 to 4 hours, and begin to take soft food from their mothers' lips at age 4 months. A young orangutan clings to its mother's abdomen by entwining its fingers in and gripping her fur until it is a year old, then it begins to ride on her back, which it may continue to do until 2.5 years of age. An infant will scream loudly if separated from its mother. The young are not weaned until they are 3 1/2 years old.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Teeth adapted to changing environments: great apes
 

The teeth of great apes help them survive times of food scarcity because they are diverse in type and material characteristics, allowing consumption of fallback foods.

           
  "Lucas and colleagues recently proposed a model based on fracture and  deformation concepts to describe how mammalian tooth enamel may be  adapted to the mechanical demands of diet (Lucas et al.: Bioessays 30  2008 374-385). Here we review the applicability of that model by  examining existing data on the food mechanical properties and enamel  morphology of great apes (Pan, Pongo, and Gorilla). Particular attention  is paid to whether the consumption of fallback foods is likely to play a  key role in influencing great ape enamel morphology. Our results  suggest that this is indeed the case. We also consider the implications  of this conclusion on the evolution of the dentition of extinct  hominins." (Constantino et al. 2009:653)
  Learn more about this functional adaptation.
  • Constantino PJ; Lucas PW; Lee JJ; Lawn BR. 2009. The influence of fallback foods on great ape tooth enamel. Am J Phys Anthropol. 140(4): 653-60.
  • 2009. Among apes, teeth are made for the toughest times. EurekAlert! [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pongo pygmaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0528-06|NC_001646|Pongo pygmaeus| GACCGCTGGCTATTCTCCACGAACCACAAAGATATTGGAACGCTATACCTGTTGTTCGGCGCATGAGCTGGTGTCCTAGGCACTGCCCTA---AGCCTCCTCATTCGTGCTGAACTAGGCCAACCCGGCAACCTCCTAGGTAAT---GACCATATTTACAATGTCATCGTCACAGCCCATGCATTCGTAATAATTTTTTTCATGGTCATGCCCATAATAATTGGAGGCTTTGGCAACTGACTAGTGCCCCTGATA---ATTGGCGCCCCTGATATGGCATTCCCGCGCATAAATAACATAAGCTTCTGACTCCTCCTCCCCTCCTTCCTCCTATTACTCGCTTCTGCTACAGTAGAGGCCGGAGCAGGAACGGGCTGAACAGTCTATCCACCCCTAGCAGGAAACTACTCTCACCCAGGAGCCTCTGTAGACTTG---ACAATCTTCTCTCTACACCTAGCAGGCATTTCCTCAATTCTAGGGGCTATCAATTTCATTACAACAATTATTAATATAAAACCCCCTGCAATATCCCAATATCAAACTCCCCTCTTCGTCTGATCAATCCTGATCACAGCAGTCCTACTTCTCCTCTCCCTCCCAGTCCTAGCCGCT---GGCATCACCATACTACTAACAGACCGCAACTTAAATACTACATTCTTTGACCCGGCTGGAGGTGGGGATCCTATCCTATACCAACACTTATTCTGATTTTTCGGCCACCCTGAAGTCTACATTCTCATCCTACCAGGTTTCGGCATAATCTCCCACATCGTAACACACTACTCCGGAAAAAAA---GAACCATTTGGGTATATAGGCATAGTCTGAGCCATAGTCTCAATTGGTTTCCTGGGTTTTATCGTATGAGCCCACCACATATTCACAGTAGGGATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pongo pygmaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 13
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd+3cd+4cd

Version
3.1

Year Assessed
2008

Assessor/s
Ancrenaz, M., Marshall, A., Goossens, B., van Schaik, C., Sugardjito, J., Gumal, M. & Wich, S.

Reviewer/s
Mittermeier, R.A. & Williamson, E.A. (Primate Red List Authority)

Justification
There has been an estimated decline of orangutan well over 50% during the last 60 years (generation length estimated at 20 years, Wich et al. in press). The decline of the species is predicted to continue at this rate, primarily because of forest loss due to conversion of forest to agriculture and fires. The majority of remnant wild populations are located outside of protected areas, in forests that are exploited for timber production or in the process of being converted to agriculture. Last but not least, poaching and the pet-trade remain major threats to orangutans across most of Borneo.

History
  • 2007
    Endangered
  • 2000
    Endangered
  • 1996
    Vulnerable
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Bornean orangutans populations have been declining in both range and numbers for many years. The species is now in danger of becoming extinct. Humans have a long history of hunting this particular primate for various reasons, more recently for exhibition in zoos. It is estimated that at least 3 orangutans die for each one that is successfully captured and transported. They are now protected by law, but poaching still occurs. The population is currently being further devastated by the destruction of their habitat through deforestation, mainly for logging purposes.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Pongo pygmaeus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (3). Subspecies: Pongo pygmaeus pygmaeus (west Bornean orang-utan), P. p. wurmbii (southern Bornean orang-utan) and P. p. morio (north-eastern Bornean orang-utan) are all classified as Endangered (EN) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The most recent estimates for Bornean orangutan numbers are between 45,000 and 69,000 individuals living in 86,000 km² of suitable habitat (Singleton et al. 2004, Caldecott and Miles 2005). These estimates were obtained between 2000 and 2003. Since recent trends are steeply down in most places due to logging and burning, it is forecasted that the current numbers are below these figures (see Tables 1a, b and c).

Follow link below for Tables 1a, b and c: population size estimates for P. p. wurmbii, P. p. pygmaeus and P. p. morio.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The total number of Bornean orangutans is estimated to be less than 14% of what it was in the recent past (from around 10,000 years ago until the middle of the twentieth century) and this sharp decline has occurred mostly over the past few decades due to human activities and development (Singleton et al. 2004, Goossens et al. 2006b).

Major threats include:

1. Habitat losses with the destruction of vast areas of tropical forest throughout the island and their conversion to agriculture (mostly oil palm plantations - Elaeis guineensis, but also acacia, rice, subsistence crops, cocoa, etc). An overall loss of 15.5 million hectares of forest (24% of total forest area) was recorded between 1985 and 1997 in Sumatra and Kalimantan, while 37% of the total forest area was lost in Sabah between 1950 and 2000 (FAO 2000). In the lowlands (prime orangutan habitat) this figure is higher and reaches more than 60% (Holmes 2000). We consider that today only 86,000 km² of habitat remains available to the species throughout the island (which is about 740,000 km²). Protected areas home to significant orangutan populations are also threatened by habitat loss (Curran et al. 2003).

The rapid expansion of oil palm plantations in Borneo in response to international demand (the oil is used for cooking, cosmetics, mechanics, and more recently as source of bio-diesel) has accelerated habitat losses. Between 1984 and 2003, the area planted with palm oil on Borneo increased from 2,000 km² to 27,000 km²: about 10,000 km² is located in Kalimantan; 12,000 km² in Sabah and 5,000 km² in Sarawak. Many areas used to be prime habitat for the orangutans: eastern lowlands of Sabah, the plains between the Sampit and Seruyan rivers in central Kalimantan, etc.

2. Fires. The El Niño climatic event has been occurring repeatedly in the last few decades, and is associated with severe droughts and forest fires. Ninety percent of Kutai National Park was lost to massive fires in 1983 and 1998 and its orangutan population was reduced from an estimated 4000 individuals in the 1970s to a mere 500 today (Rijksen and Meijaard 1999). Over 400,000 ha of peatland forest in South Kalimantan were burnt to ashes in six months during 1997-98 following the collapse of the Mega-Rice project, representing an estimated loss of 8,000 orangutans (Page et al. 2002). Large numbers of orangutans are also killed by people while fleeing the flames and smoke during and after the fires. As a result of the 1997-98 fires, we estimate that the Bornean orangutan population was reduced by 33% in just one year. The most recent drought of 2006 in Kalimantan is thought to have killed several hundred orangutans in just six months. Forest fires can also result in the arrival of “refugees” in surrounding remnant and the resulting crowding effect can have serious negative impacts on the resident population (Husson et al. 2005).

3. Habitat exploitation and illegal logging. Although recent work in Sabah and East Kalimantan shows that orangutans can adapt and survive (at least in the short term) in commercial forest reserves exploited for timber according to sustainable logging practices (reduced-impact logging; FSC certification), it is well established that more aggressive and conventional logging practices have a negative impact on orangutan populations. Rampant legal and illegal logging results in the destruction of key food sources that sustain orangutans, and in the fragmentation of remnant subpopulations which subsequently become more prone to local extinction and catastrophes.

4. Habitat fragmentation. Recent results from the orangutan PHVA show that Bornean orangutan populations of fewer than 50 individuals are not viable in the long-term and will most probably go extinct in the next 100 years (Singleton et al. 2004, Marshall et al. in prep.). Forest fragmentation further reduces the size of orangutan populations and makes them more prone to genetic drift and inbreeding as well as to local catastrophes, such as floods, fires, outbreak diseases, hunting pressure.

5. Hunting. In some parts of the island, hunting has been a major threat and is directly responsible for local extinctions (Rijksen and Meijaard 1999). Even low levels of hunting for traditional purposes strongly reduce orangutan population densities (Marshall et al. 2006). Indeed, recent vortex models showed that a 2% hunting rate is not sustainable for this species (Singleton et al. 2004, Marshall et al. in prep.). Major reasons for hunting include: bushmeat trade, wanton killing as part of poaching for other forest products (such as gaharu or aloe wood), use of body parts for traditional medicine, pet trade and to mitigate conflicts with agriculture.

6. Pet trade. Illegal export of animals continues. In early 2004 about 100 individuals of Bornean origin were confiscated in Thailand and 50 of them were repatriated to Kalimantan in 2006. Several hundred Bornean orangutan orphans who were confiscated by local authorities have been entrusted to different orphanages in both Malaysia and Indonesia. They are in the process of being rehabilitated into the wild.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Orang-utans were hunted relentlessly in the majority of their South East Asian range, their large size and slow movements making them easy targets for hunters (9). However, the main threat to orang-utans today is loss of habitat. In the past twenty years, 80 percent of orang-utan habitat has been lost to illegal logging, gold mining and conversion to permanent agriculture, in particular, palm oil plantations. These animals are extremely vulnerable to exploitation, largely as a result of their extremely long inter-birth interval (7). Forest fires raged through much of Borneo in 1997 and 1998 and it is estimated that around one third of the island's orang-utan population was lost at this time (9). Orang-utans that wander into palm oil plantations and other human-inhabited areas may also be captured for the illegal pet trade, although this is a by-product of shrinking habitat and not a main issue (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Bornean orangutan is a fully protected species in both Malaysia and Indonesia legislation. This species is listed on Appendix I of CITES.

Although some major populations are found within the network of protected areas existing in Borneo, it is now well established that the vast majority of Bornean orangutans live outside protected forests. New mechanisms to ensure their long-term survival outside protected forests are urgently needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Bornean orang-utan is protected by law in both the Malaysian and Indonesian areas of the island, and is listed on Appendix I of the Convention on International Trade in Endangered Species (CITES), which prohibits international trade (8). Populations also occur within a number of protected parks, although illegal logging even within protected areas remains a key threat to the survival of this species, and has increased with political instability in Indonesia (2). Captive individuals are re-introduced into the wild in three rehabilitation centres in Kalimantan, one in Sabah and one in Sarawak (7). Time is running out for the Asian ape however, and there are fears that at current rates of decline, both the Sumatran and the Bornean orang-utan could be extinct in the wild by 2010 (9). Due to the large home ranges that these apes require it is the protection of habitat that will ensure that these beautiful and enigmatic 'people of the forest' survive into the next century (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Bornean orangutans prefer many of the same types of fruit that people do, but their numbers are so small now that this is normally not a significant problem for human food production. Attacks on humans occasionally occur.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Bornean orangutans provide increasing economic benefits on Borneo by attracting "eco-tourism."

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bornean orangutan

The Bornean orangutan, Pongo pygmaeus, is a species of orangutan native to the island of Borneo. Together with the Sumatran orangutan, it belongs to the only genus of great apes native to Asia. Like the other great apes, orangutans are highly intelligent, displaying advanced tool use and distinct cultural patterns in the wild. Orangutans share approximately 97% of their DNA with humans.[3]

The Bornean orangutan has a life span of 35-45 years in the wild;[4] in captivity it can live to be about 60.[5] A survey of wild orangutans found that males weigh on average 75 kilograms (170 lb), ranging from 50–100 kilograms (110–220 lb), and 1.4–1.8 metres (4.6–5.9 ft) long; females average 38.5 kilograms (85 lb), ranging from 30–50 kilograms (66–110 lb), and 1–1.2 metres (3.3–3.9 ft) long.[6][7]

The Bornean orangutan is an endangered species, with deforestation, oil-palm plantations and killing posing a serious threat to its continued existence.

Contents

Taxonomy

The Bornean orangutan and the Sumatran orangutan diverged about 400,000 years ago. [4] There has been a continued low level of gene flow between them since then.[4] The two orangutan species were considered merely subspecies until 1996, following sequencing of their mitochondrial DNA.

The Bornean orangutan has three subspecies:[1][2]

There is some uncertainty about this, however. The population currently listed as P. p. wurmbii may be closer to the Sumatran orangutan (P. abelii) than to the Bornean orangutan. If this is confirmed, abelii would be a subspecies of P. wurmbii (Tiedeman, 1808).[8] In addition, the type locality of pygmaeus has not been established beyond doubt; it may be from the population currently listed as wurmbii (in which case wurmbii would be a junior synonym of pygmaeus, while one of the names currently considered a junior synonym of pygmaeus would take precedence for the taxon in Sarawak and northern West Kalimantan).[8] Bradon-Jones et al considered morio to be a synonym of pygmaeus and the population found in East Kalimantan and Sabah to be a potentially unnamed separate taxon.[8]

Physical description

The Bornean orangutan has a distinctive body shape with very long arms that may reach up to two metres in length. It has a coarse, shaggy reddish coat[9] and prehensile, grasping hands and feet.[10]

Habitat and distribution

The Bornean orangutan lives in tropical and subtropical moist broadleaf forests in the Bornean lowlands as well as mountainous areas 1,500 metres (4,900 ft) above sea level. [11] This species lives throughout the canopy of primary and secondary forests and moves large distances to find trees bearing fruit.[11]

It can be found in the two Malaysian states of Sabah and Sarawak, and three of the four Indonesian Provinces of Kalimantan.[2] Due to habitat destruction the species distribution is now highly patchy throughout the island, the species has become rare in the south-east of the island, as well as in the forests between the Rejang River in central Sarawak and the Padas River in western Sabah.[2]

Behavior and ecology

Juvenile orangutan at the Aalborg Zoo, Denmark

In history, orangutans ranged throughout Southeast Asia and into southern China, as well as on the island of Java and in southern Sumatra. Orangutans primarily inhabit peat swamp forests, tropical health forests, and mixed dipterocarp forests. [3]

The Bornean orangutan is more solitary than its Sumatran relatives. Two or three orangutans that have overlapping territories may interact, but only for short periods of time.[12] Although orangutans are not territorial, adult males will display threatening behaviors upon meeting other males and only socializing with females to mate.[13] Males are considered the most solitary of the orangutans.

Despite being arboreal, the Bornean orangutan travels on the ground more than its Sumatran counterpart. It is theorized this may be in part because there is no need to avoid the large predators which only exist in Sumatra such as the Sumatran tiger.[14]

Diet

The Bornean orangutan diet is composed of over 400 types of food, including wild figs, durians, leaves, seeds, bird eggs, flowers, honey, insects, to a lesser extent than the Sumatran orangutan, and bark.[7][3] They have also been known to consume the inner shoots of plants and vines.[3] They get the necessary quantities of water from both fruit and from tree holes.[11]

Bornean orangutans have been sighted using spears to catch fish.[15] The species has been observed using tools such as leaves to wipe off feces, a pad of leaves for holding spiny durian fruit, a leafy branch for a bee swatter, a bunch of leafy branches held together as an "umbrella" while traveling in the rain, a single stick as backscratcher, and a branch or tree trunk as a missile."[16] And in other regions, orangutans occasionally eat soil to get minerals that may neutralize the toxins and acids they consume in their primarily vegetarian diet.[3] On rare occasions, orangutans will prey upon other, small primates such as slow lorises. [3]

Reproduction

Males and females generally come together only to mate. Sub-adult males (unflanged) will try to mate with any female and will be successful around half the time.[12] Dominant flanged males will call and advertise their position to receptive females, who prefer mating with flanged males.[12] Adult males will often target females with weaned infants as mating partners because the female is likely to be fertile. [17]

Females reach sexual maturity and experience their first ovulatory cycle between about 6 and 11 years of age, although females with more body fat may experience this at an earlier age. [12] The estrous cycle lasts between 22 and 30 days and menopause has been reported in captive orangutans at about age 48. [12] Females tend to give birth at about 14-15 years of age. Newborn orangutans nurse every three to four hours, and begin to take soft food from their mothers' lips by four months. During the first year of its life, the young clings to its mother's abdomen by entwining its fingers in and gripping her fur. Offspring are weaned at about four years but this could be much longer, and soon after they start their adolescent stage of exploring, but always within site of their mother.[12] During this period they will also actively seek other young orangutans to play with and travel with.

A 2011 study on female orangutans in free-ranging rehabilitation programs found that individuals who were supplemented with food resources had shorter inter-birth intervals as well as a reduced age at first birth. [18]

Conservation status

The Bornean orangutan is more common than the Sumatran, with about 54,500 individuals in the wild; there are only about 6,600 Sumatran orangutans left in the wild.[19] Orangutans are becoming increasingly endangered due to habitat destruction and the bushmeat trade, and young orangutans are captured to be sold as pets, usually entailing the killing of their mothers.[20]

The Bornean orangutan is endangered[2] according to the IUCN Red List of mammals, and is listed on Appendix I of CITES. The total number of Bornean orangutans is estimated to be less than 14 percent of what it was in the recent past (from around 10,000 years ago until the middle of the twentieth century) and this sharp decline has occurred mostly over the past few decades due to human activities and development.[2] Species distribution is now highly patchy throughout Borneo: it is apparently absent or uncommon in the south-east of the island, as well as in the forests between the Rejang River in central Sarawak and the Padas River in western Sabah (including the Sultanate of Brunei).[2] There is a population of around 6,900 in Sabangau National Park, but this environment is at risk.[21] According to an anthropologist at Harvard University, it is expected that in 10 to 20 years orangutans will be extinct in the wild if there is no serious effort to overcome the threats that they are facing.[22]

This view is also supported by the United Nations Environment Programme, which stated in its 2007 report that due to illegal logging, fire and the extensive development of oil palm plantations, orangutans are endangered, and if the current trend continues, they will become extinct.[23]

A November 2011 survey, based on interviews with 6,983 respondents in 687 villages across Kalimantan in 2008 to 2009, gave estimated orangutan killing rates of between 750 and 1800 in the year leading up to April 2008.[24] These killing rates were higher than previously thought and confirm that, the continued existence of the orangutan in Kalimantan, is under serious threat. The survey did not quantify the additional threat to the species of habitat loss due to deforestation and expanding palm-oil plantations. The survey found that 73% of respondents knew that orangutans were protected by Indonesian law.[24]

However the Indonesian government rarely prosecutes or punishes perpetrators.[25] In a rare prosecution in November 2011, two men were arrested for killing at least 20 orangutans and a number of long-nosed proboscis monkeys. They were ordered to conduct the killings by the supervisor of a palm oil plantantion, to protect the crop, with a payment of $100 for a dead orangutan and $22 for a monkey.[26]

A young rescued orangutan at Nyaru Menteng takes a nap.

Rescue and rehabilitation centers

A number of orangutan rescue and rehabilitation projects operate in Borneo.

The Borneo Orangutan Survival Foundation (BOS) founded by Dr Willie Smits has rescue and rehabilitation centres at Wanariset and Samboja Lestari in East Kalimantan and Nyaru Menteng, in Central Kalimantan founded and managed by Lone Drøscher Nielsen. BOS also works to conserve and recreate the fast disappearing rainforest habitat of the orangutan, at Samboja Lestari and Mawas.

Orangutan Foundation International, founded by Dr Birutė Galdikas, rescues and rehabilitates orangutans, preparing them for release back into protected areas of the Indonesian rain forest. In addition, OFI promotes the preservation of the rain forest for the orangutans.

The Sepilok Orangutan Rehabilitation Centre near Sandakan in the state of Sabah in Malaysian Borneo opened in 1964 as the first official orangutan rehabilitation project.[27]

See also

References

This article incorporates text from the ARKive fact-file "Bornean orangutan" under the Creative Commons Attribution-ShareAlike 3.0 Unported License and the GFDL.

  1. ^ a b Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 183–184. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100805. 
  2. ^ a b c d e f g Ancrenaz, M., Marshall, A., Goossens, B., van Schaik, C., Sugardjito, J., Gumal, M. & Wich, S. (2008). Pongo pygmaeus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 2009-01-04.
  3. ^ a b c d e f "Orangutan Facts". Orangutan Foundation International. http://www.orangutan.org/orangutan-facts. Retrieved 2012-03-17. 
  4. ^ a b c Locke, Devin P.; et al. (2011-01-26). "Comparative and demographic analysis of orang-utan genomes". Nature 469 (7331): 529–533. doi:10.1038/nature09687. http://www.nature.com/nature/journal/v469/n7331/full/nature09687.html. Retrieved 2012-03-17. 
  5. ^ "Primates: Orangutans". Smithsonian National Zoological Park. http://nationalzoo.si.edu/Animals/Primates/Facts/FactSheets/Orangutans/default.cfm. Retrieved 2011-01-27. 
  6. ^ Wood, G. (1977). The Guinness Book of Animal Facts and Feats. New York: Sterling Pub. Co.. ISBN 978-0-85112-235-9. 
  7. ^ a b Ciszek, D.; Schommer, M.K. (2009-06-28). "ADW: Pongo pygmaeus: Information". Animal Diversity Web. http://animaldiversity.ummz.umich.edu/site/accounts/information/Pongo_pygmaeus.html. Retrieved 2009-07-03. 
  8. ^ a b c Bradon-Jones, D.; Eudey, A.A.; Geissmann, T.; Groves, C.P.; Melnick, D.J.; Morales, J.C.; Shekelle, M.; Stewart, C.B. (2004). "Asian primate classification" (pdf). International Journal of Primatology 25 (1): 97–164. doi:10.1023/B:IJOP.0000014647.18720.32. http://www.gibbons.de/main/papers/pdf_files/2004asianprimates.pdf. Retrieved 2011-03-02. 
  9. ^ Burnie, D. (2001). Animal. London: Dorling Kindersley. 
  10. ^ Macdonald, D. (2001). The New Encyclopedia of Mammals. Oxford: Oxford University Press. 
  11. ^ a b c "Orangutans". WWF. http://wwf.panda.org/what_we_do/endangered_species/great_apes/orangutans/. Retrieved 2012-03-17. 
  12. ^ a b c d e f Cawthon Lang, K.A. (2005). "Primate Factsheets: Orangutan (Pongo) Behavior". Primate Info Net. http://pin.primate.wisc.edu/factsheets/entry/orangutan/behav. Retrieved 2011-03-02. 
  13. ^ "Orangutan". Sea World, Busch Gardens, & Discovery Cove. http://www.seaworld.org/animal-info/info-books/orangutan/habitat-&-distribution.htm. Retrieved 2012-03-17. 
  14. ^ Cawthon Lang, K.A. (2005). "Primate Factsheets: Orangutan (Pongo) Taxonomy, Morphology, & Ecology". Primate Info Net. http://pin.primate.wisc.edu/factsheets/entry/orangutan/taxon. Retrieved 2011-07-23. 
  15. ^ Bleiman, B. (2008-04-29). "Orangutan "Spear Fishes"". Zooillogix. ScienceBlogs. http://scienceblogs.com/zooillogix/2008/04/orangutan_spear_fishes.php. Retrieved 2009-07-03. 
  16. ^ Parker, S.T.; Mitchell, R.W.; Miles, H.L. (1999). "The Mentalities of Gorillas and Orangutans: Comparative Perspectives". Cambridge: Cambridge University Press. 
  17. ^ Fox, E.A. (2002). ""Female tactics to reduce sexual harassment in the sumatran orangutan ("Pongo pygmaeus abelii")". Behavioral Ecology and Sociobiology (2). doi:10.1007/s00265-002-0495-x. 
  18. ^ Kuze, Noko; Pratje, Peter (2011). ""Factors affecting reproduction in rehabilitant female orangutans: young age at first birth and short inter-birth. interval"". primates. doi:10.1007/s10329-011-0285-z. http://www.springerlink.com/content/el51764477433573/fulltext.pdf. Retrieved 2012-03-17. 
  19. ^ (in Indonesian) (pdf) Orangutan Action Plan 2007-2017 (Report). Government of Indonesia. 2007. p. 5. http://www.yorku.ca/arusson/Papers/GoI%20OU%20action%20plan%2007-17.pdf. Retrieved 2011-03-02. 
  20. ^ Cawthon Lang, K.A. (2005). "Primate Factsheets: Orangutan (Pongo) Conservation". Primate Info Net. http://pin.primate.wisc.edu/factsheets/entry/orangutan/cons. Retrieved 2011-03-02. 
  21. ^ Cheyne, S. M.; Thompson, C. J. H.; Phillips, A. C.; Hill, R. M. C.; Limin, S. H. (2007). "Density and population estimate of gibbons (Hylobates albibarbis) in the Sabangau catchment, Central Kalimantan, Indonesia". Primates 49 (1): 50–56. doi:10.1007/s10329-007-0063-0. PMID 17899314. Archived from the original on 2009-03-26. http://web.archive.org/web/20090326001206/http://www.wildcru.org/aboutus/people/cheyne_pdfs/Cheyne%20Gibbon%20Density%202007.pdf.  edit
  22. ^ Mayell, H. (2004-03-09). "Wild Orangutans: Extinct by 2023?". National Geographic. http://news.nationalgeographic.com/news/2003/09/0930_030930_orangutanthreat.html. Retrieved 2011-03-03. 
  23. ^ Nellemann, C., Miles, L., Kaltenborn, B.P., Virtue, M. & Ahlenius, H. (2007) (pdf). The last stand of the orangutan – State of emergency: Illegal logging, fire and palm oil in Indonesia’s national parks (Report). Norway: United Nations Environment Programme, GRID-Arenda­l. http://www.unep.org/grasp/docs/2007Jan-LastStand-of-Orangutan-report.pdf. Retrieved 2011-03-03. 
  24. ^ a b Meijaard, Erik; Buchori, Damayanti, Hadiprakarsa, Yokyok, Utami-Atmoko, Sri Suci, Nurcahyo, Anton, Tjiu, Albertus, Prasetyo, Didik, Nardiyono, , Christie, Lenny, Ancrenaz, Marc, Abadi, Firman, Antoni, I Nyoman Gede, Armayadi, Dedy, Dinato, Adi, Ella, , Gumelar, Pajar, Indrawan, Tito P., Kussaritano, , Munajat, Cecep, Priyono, C. Wawan Puji, Purwanto, Yadi, Puspitasari, Dewi, Putra, M. Syukur Wahyu, Rahmat, Abdi, Ramadani, Harri, Sammy, Jim, Siswanto, Dedi, Syamsuri, Muhammad, Andayani, Noviar, Wu, Huanhuan, Wells, Jessie Anne, Mengersen, Kerrie, Turvey, Samuel T. (11 November 2011). "Quantifying Killing of Orangutans and Human-Orangutan Conflict in Kalimantan, Indonesia". PLoS ONE 6 (11): e27491. doi:10.1371/journal.pone.0027491. http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0027491. Retrieved 27 November 2011. 
  25. ^ Marshall, Michael (15 November 2011). "Humans killing at least 750 Bornean orang-utans a year". The New Scientist. http://www.newscientist.com/article/dn21170-humans-killing-at-least-750-bornean-orangutans-a-year.html. Retrieved 27 November 2011.  quoting Ashley Leiman, director of the Orangutan Foundation.
  26. ^ "Mass Slaughter of Orang-utans and Monkeys is Continuing in Kalimantan". November 24, 2011. http://english.kompas.com/read/2011/11/24/13304328/Mass.Slaughter.of.Orang-utans.and.Monkeys.is.Continuing.in.Kalimantan. 
  27. ^ Thompson, S. (2010). The Intimate Ape: Orangutans and the Secret Life of a Vanishing Species. Citadel Press. p. 54. ISBN 978-0-8065-3133-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!