Overview

Brief Summary

Description

Along with the pygmy chimp or bonobo (Pan paniscus), the chimpanzee is the closest living relative (4) to humans and is estimated to share 98 percent of our genes (6). There are currently four recognised subspecies of chimpanzee, showing differences in appearance and geographic range: the western or masked chimpanzee (Pan troglodytes verus), central or black-faced chimpanzee (P. t. troglodytes), eastern or long-haired chimpanzee (P. t. schweinfurthii) and the eastern Nigeria chimpanzee (P. t. vellerosus) (3). They all have the characteristic chimpanzee body shape with longer arms than legs, together with opposable thumbs and big toes (5). The bare skin on the face, ears, palms, and soles of the feet is pinkish to black (5), whilst the rest of the body is covered with brown to black hairs (6). Chimpanzees have very expressive features with their bulging eyebrows and protrusive lips (6). The long arms and fingers and mobile shoulder joints allow chimps to move easily in the trees where they forage and rest (4). The majority of their locomotion however, takes place on the ground in the form of 'knuckle-walking' (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Chimpanzees are highly intelligent, social animals with a startlingly complex culture. They live in stable communities which range in size from 15 to 150 members, although individuals tend to travel and forage in much smaller groups (4). Males stay in their natal community for life and male relationships are ordered in a strict linear hierarchy, which allows many disputes to be settled without the need for violence (4); males are also dominant over all of the females in the group (5). Chimpanzees are long-lived and do not reach sexual maturity until they are around 10 to 11 years old, with inter-birth intervals of around five years (5). Young chimpanzees develop slowly and are weaned at around four years old (4), although they retain strong ties with their mother after this. Chimps are active throughout the day and feed mainly on fruit, supplementing their diet with leaves, flowers, seeds and insects when fruit is scarce (4). Meat is a favourite food for chimps and groups will cooperate together to hunt and kill monkeys (5). Chimpanzees are remarkably dextrous and are one of the few species to exhibit tool use; from fly wisps and nutcrackers to rods used to probe for ants and termites (4). Chimps exhibit complex communication in the form of expressions, postures and calls (5); social grooming is vital for maintaining bonds between individuals (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Chimpanzees have a wide but discontinuous distribution in Equatorial Africa between 13 degrees North and 7 degrees South. They occur from southern Senegal across the forested belt north of the Congo River to western Uganda and western Tanzania, from sea-level to 2,800 m asl. The four subspecies recognized here are distributed as follows:

P. t. verus (Schwarz, 1934) is found in West Africa from Senegal to Nigeria.

P. t. ellioti (Gray, 1862) is found only in Nigeria and Cameroon, north of the Sanaga River.

P. t. troglodytes (Blumenbach, 1799) ranges from Cameroon, south of the Sanaga River, to the Congo River/Ubangi River (Democratic Republic of Congo).

P. t. schweinfurthii (Giglioli, 1872) ranges from the Ubangi River/Congo River in Central African Republic and the Democratic Republic of Congo, to western Uganda, Rwanda and western Tanzania (with small, relict populations in Burundi and south-eastern Sudan).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Chimpanzees (Pan troglodytes) inhabit the tropical forests of central Africa. They are distributed from about 10 degrees N to 8 degrees S, and from 15 degrees W to 32 degrees E. They are found from Gambia in the west to Uganda in the east, excluding the region bordered by the Congo and Lualaba rivers in central Zaire (Congo) where their sister species, bonobos (Pan paniscus), are found.

There are three recognized subspecies of common chimpanzee. Pan troglodytes verus occurs in the western portions of the range, from Gambia to the Niger river. From the Niger river to Congo, in the central portion of the range, P. troglodytes troglodytes inhabits forested regions. In the far eastern portion of the range, from the northwestern corner of Zaire into western Uganda and Tanzania, P. troglodytes schweinfurthi is found.

Biogeographic Regions: ethiopian (Native )

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
  • Napier, J., P. Napier. 1985. The natural history of the primates. Cambridge, Massachusetts: The MIT Press.
  • Goodall, J. 1986. The Chimpanzees of Gombe: Patterns of Behavior. Cambridge, Massachusetts: The Belknap Press of Harvard University Press.
  • Jones, C., C. Jones, J. Jones, Jr., D. Wilson. 1996. Pan troglodytes. Mammalian Species, 529: 1-9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Africa-see 17.40(c)(3)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Once found throughout the equatorial forest belt of Africa from the west to east coast of the continent (5), between 13°N and 7°S (2). Populations are today found where tracts of these forests remain and the largest populations are located in Gabon, Zaire and Cameroon (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult chimpanzees have a head and body length ranging between 635 and 925 mm. When standing erect, they are 1 to 1.7 m tall. In the wild, males weigh between 34 and 70 kg, whereas females are slightly smaller, weighing between 26 and 50 kg. In captivity individuals typically attain greater weights, with the top weight reaching 80 kg for males and 68 kg for females. Although data from individual subspecies are not available, it appears that P. t. schweinfurthi is smaller than P. t. verus, which is smaller than P. t. troglodytes. Some of the differences seen between captive chimps and wild chimps may be due to subspecific differences in size.

The arms are long, such that the spread of the arms is 1.5 times the height of an individual. Legs are shorter than are the arms, which allows these animals to walk on all fours with the anterior portion of the body higher than the posterior. Chimpanzees have very long hands and fingers, with short thumbs. This hand morphology allows chimpanzees to use their hands as “hooks” while climbing, without interference from the thumb. In trees, chimpanzees may move by swinging from their arms, in a form of brachiation. Although useful in locomotion, the shortness of the thumb relative to the fingers prevents precision grip between the index finger and thumb. Instead, fine manipulations require using the middle finger in opposition to the thumb.

The long hands of chimpanzees also function in quadrupedal locomotion. Fingertips are typically curled upward into the palm during locomotion, and the weight is borne along backs of the fingers. Much of the length of the hand thus contributes to the length of the forelimbs while walking. In combination with the short legs, this gives the back a downward slope from neck to rump, and orients the head into a forward facing position.

Chimpanzees have prominent ears, and a prominent superorbital crest. This gives the brows a somewhat rigid and bony appearance. A sagittal crest may be present on very large individuals, but is not common. There is no nuchal crest. Cranial capacity of these animals ranges from 320 to 480 cc. The face is slightly prognathic. The lips protrude and are very flexible, allowing an individual to accomplish many tasks through labial manipulation.

Dentition is typical of primates. The dental arch is square in shape, and there is a prominent diastema. Canines are large, as are molars. Molars decrease in size toward the back of the mouth, and lack the enamel wrinkling seen in orangutans.

The face of adults is typically black, or mottled with brown. Hair is black to brown, and there is no underfur present. There may be some white hairs around the face (looking a bit like a white beard in some individuals). Infant chimpanzees have a white tuft of hair on their rumps, which identifies their age quite clearly. This white tail tuft is lost as an individual ages.

Individuals of both sexes are prone to lose the hair on the head as they age, producing a bald patch behind the brow ridge. Graying of hairs in the lumbar region and on the back is common with age, also.

Range mass: 26 to 70 kg.

Range length: 635 to 925 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Chimpanzees are found predominantly in moist and dry forests, and forest galleries extending into savanna woodlands. They are omnivorous, and their diet is highly variable according to individual populations and seasons. Fruit comprises about half the diet, but leaves, bark, and stems are also important. Mammals comprise a small but significant component of the diet of many populations. Chimpanzees form social communities of 5 to 150 animals. Home ranges are larger in woodland forest mosaics than in mixed forest, and average 12.5 km² (range 5 to 400 km²).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chimpanzees utilize a great diversity of habitat types. Although they are typically thought of as living in tropical rainforests, they are also found in forest-savanna mosaic environments, as well as in montain forests at elevations up to 2,750 m. Some populations are known to inhabit primarily savanna habitat.

Range elevation: 0 to 2,750 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits a variety of woodlands from humid evergreen forests to deciduous forest and dry savanna woodlands (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Chimpanzees are broadly omnivorous. They rely heavily on ripe fruits and young leaves, with additional consumption of stems, buds, bark, pith, seeds, and resins. This diet is supplemented by a variety of insects, small vertebrates, and eggs. Soil is sometimes consumed, especially that associated with termite mounds, presumably for the minerals it contains. Diets vary seasonally, as different foods are available at different times of year. Diets also vary geographically. Some foods eaten by chimpanzees in one location are not eaten by chimpanzees in another location, even when the food in question is present at both locations, making it possible that geographical differences in diet are cultural.

Chimpanzees spend the bulk their time feeding or moving from one food source to another. Although foods may be eaten at any time of the day or night, there are typically two major peaks in feeding activities. The first occurs in the morning between 7 and 9 AM. The other is in the afternoon, between 3:30 and 7:30 PM.

Chimps may use a food source until the food is gone, or they may leave before having consumed all of the food. This may depend upon how many chimps are feeding at the site. Variety in the diet seems to be important, and after consuming enough of a particular food, chimps may move on in search of something else to eat.

Chimpanzees are known to hunt other large vertebrates on occasion. The largest animals hunted are bush pigs (Potamochoerus larvatus), colobus monkeys (Colobinae) and baboons (Papio). Although adults are sometimes taken, it is more common for chimps to take young animals.

The predatory behaviors of chimpanzees vary between sexes, individuals, and locations. Males typically consume more meat than females, who seem to specialize more on insect foods than do males. Chimps in the Ivory Coast are known to use more cooperative hunting techniques than the chimpanzees in Tanzania and Uganda. This may be related to differences in the habitat and the behavior of prey. In the Ivory Coast, there is a well developed canopy to the forest, and monkeys may escape chimp predators by climbing high into the trees. In this situation, only cooperative hunting tactics work well for capturing prey. However, at both Gombe and Mahale in Tanzania, the forest is not as dense, and the upper portions of the canopy are not as well developed. As a result, individuals have high success at hunting without enlisting the aid of other chimps.

Another consequence of habitat differences between western and eastern populations of chimpanzees is that in the east, the colobus monkeys preyed cannot take refuge in areas inacessible to chimpanzees. Under these conditions, colobus monkeys are more aggressive toward the chimpanzees. Coupled with the smaller size of the subspecies of chimp found in this area (P. t. schweinfurthi), a different dynamic is established between predator and prey. Chimpanzees in this area are sometimes fearful of adult male monkeys, and are most likely to attack females with young, in the hope of snatching a baby monkey to eat.

Cannibalism has been reported in chimpanzees. The circumstances under which this behavior has been observed vary, although typically chimps do not kill and eat members of their own communities. Most commonly, infants killed during intercommunity aggression may be eaten by the males of the neighboring community. However, in a famous case at Gombe, an adult female and her adolescent daughter were responsible for killing several infants of other females in their community. These infants were eaten, often in front of the mother. This behavior ended when the adult female died. The daughter has shown no inclination toward cannibalism since her mother's death.

Captive chimps commonly exhibit coprophagy and repetitive regurgitation and reingestion. These behaviors appear to be an aberration seen in captivity, as they are not found in wild chimpanzees.

Finally, sick chimpanzees are known to consume a variety of plants with potentially medicinal value. For a more comprehensive discussion of this behavior, please refer to the behavior section.

Animal Foods: birds; mammals; reptiles; eggs; insects

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers; sap or other plant fluids

Primary Diet: omnivore

  • Boesch, C. 1994. Hunting Strategies of Gombe and Tai Chimps. Pp. 77-91 in R Wrangham, W McGrew, F deWaal, P Heltne, eds. Chimpanzee Cultures. Cambridge, Massachusetts: Harvard University Press in Cooperation with the Chicago Academy of Sciences.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As predators, chimpanzees may be a factor in structuring populations of their prey species. Certainly, they have a strong impact on red colobus monkeys (Colobus mitis) at Gombe, and they are likely to have effects on other species as well. As frugivores, chimps may help to disperse seeds of certain plants, either through transportation, or by processing the fruit. There are competitive interactions with other primates, and so chimpanzees may have an additional negative effect on other primate species.

Various parsites, such as intestinal helminths, trematodes, and schistosomes, have been reported in these animals.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Chimpanzees are hunted as food by humans in many parts of their range. There is no direct evidence of predation on chimps by other animals, although there are some sympatric predators that are likely candidates for taking an occasional chimpanzee--especially young ones. These are leopards (Panthera pardus), pythons (Phython sabae), and martial eagles (Poleamaetus bellicosus).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Pan troglodytes preys on:
Papio
Procolobus verus
Papio anubis

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication in this highly social species is an area of great interest to human researchers. Chimpanzees in captivity have been involved in a number of experiments designed to show how their minds work with regard to signs, signals, and speech. In this account, communication in wild chimpanzees will be discussed first, followed by a discussion of what language studies in captivity have helped us to understand about these animals.

Visual Communication

Chimpanzees communicate with a wide variety of gestures, postures, and facial expressions. In addition, body language and physical cues are used in communication.

Gestures such as arm raising, slapping the ground, or a direct stare are threatening signals used between individuals. Male courtship signals, like branch shaking or foot stamping, may be directed at particular female with whom he wishes to mate. Some facial expressions and vocalizations may also be directed at particular individuals. Loud arm scratching while looking at another individual may be interpreted as a request for grooming.

When excited or fearful, chimps may show low closed grins, full closed grins, or open grins. Snears may also be shown in a fearful context. When the distress is less severe, communicative facial expressions include pouts and horizontal pouts. Compressed lips are often used in threatening displays, and play is generally accompanied by a “play face”, in which the chimp has an open smile with top teeth covered.

Erection of body hair (piloerection) is an important signal communicating excitement. It occurs in most chimps when a strange or frightening stimulus is encountered, during times of aggression, and in other contexts of social excitment. This bristling of the hair is an autonomic response, so it is not under the conscious control of an individual animal. It is a reliable signal of excitement in this species, just as blushing is a reliable signal of embarrassment in humans.

In times of fear induced by the behavior or presence of a dominant animal, chimpanzees never show piloerection. Instead, they have incredibly sleek hair, making them appear smaller. Also, the alpha male chimpanzee in a community, although not frightened or excited, almost always has bristled hair--making him appear even larger than he is.

The swelling of the anogenital skin of females clearly communicates their sexual state to other members of the community. Because the bright pink swelling is highly visible, even at a distance, and can be seen by all, it is considered a non-directed signal.

Auditory Communication

All chimpanzee vocalizations are closely tied to their emotions. Their vocalizations are usually spontaneous, signalling the excitment of arriving at a food source, greeting of old friends, or moments of acute fear or distress. However, producing a particular vocalizations without experiencing the underlying emotion seems to be a task that surpasses a chimpanzee's abilities. Conversely, chimps can learn through experience to suppress a particular call in contexts where the vocalizations may lead to an unwelcome result.

Chimpanzees can be quite vocal. They use a variety of grunts, barks, squeaks, whimpers, and screams. Each call is typically tied to a particular emotional context, such as fear, excitment, bewilderment, or annoyance, so that vocalizations provide information to other chimps about what is happening to other members of their community, even if they cannot see them directly. Subordinate animals direct pant-grunts at more dominant animals. During grooming, chimpanzees often lip-smack or tooth-clack. Play is often accompanied by laughter which, although very raspy-sounding to humans, is similar enough to our own laughter to be easily recognized. Some vocalizations (food grunts) attract other party members to an plentiful food source. Some louder vocalizations (food aaa calls) may attract other chimpanzees in the community from a greater distance. The famous “pant hoot” call of chimps seems to serve as a means of individual identification, and allows friends and family to locate one another even though they may not be within visual range. A detailed listing of calls made by the chimps of Gombe is available in Goodall (1986), and should be consulted by those wishing to know more about specific calls.

That chimpanzees understand the meaning of their vocalizations is clear from contexts in which they purposefully supress vocalizations. Although typically vocal--especially when traveling in groups-- male chimpanzees are almost entirely silent when they are performing a border patrol, or when raiding into the home range of a neighboring group. It is as if they understand that the success of their mission depends upon remaining covert, and that vocalizations will assuredly attract the notice of neighboring animals whom they would prefer to surprise. Similarly, during the course of a consortship, both male and female remain almost entirely silent. This silence may serve two different functions. First, it may prevent the pair from being discovered by other males in the community, disrupting the temporarily monogamous union. Second, because most consortships take place on the outskirts of the community’s range, silence helps the consorting pair to avoid attracting the attention of neighboring males, who may themselves be out patrolling their borders.

Tactile Communication

Various forms of tactile communication occur between pairs of chimps. Physical contact helps to reassure distressed individuals, to placate aggressive individuals, and to appease stress. Embracing, patting, kissing, mounting, and touching all occur in a variety of contexts, including greetings, reconciliations, and reunions. As mentioned in the section on behavior, relaxed physical contact is provided by frequent bouts of social grooming. Such friendly contact helps to cement social bonds. Playful contact, such as finger wrestling or tickling may also occur.

Although the bulk of physical contact seen in chimpanzees is friendly, there is also physical contact associated with aggression. Hitting, slapping, kicking, and biting also occur, as do pounding, dragging, and stamping. Although such aggressive physical contact usually occurs between two individuals as the result of a specific conflict, it may also sometimes be incidental, as when a chimpanzee is in the wrong place at the wrong time, and becomes incorporated into the display of a dominant or irritated individual.

Chemical Communication

Chimpanzees are very interested in smells, and seem to be using them in a variety of contexts. However, the degree to which they use smells, or the specific information they obtain from smells, is not known. Chimpanzees sniff and smell at the anogenital swellings of females. They smell the ground after a mother with a new infant has moved away, apparently trying to catch the scent of the newborn. Individual chimps may have unique odors, recognized by their fellows, but research on this point is lacking. Wild chimpanzees sometimes appear to use scent cues in tracking missing family members. Olfactory cues may be used in helping males to identifiy the approach of ovulation in females, although the specific mechanism or chemicals used for this have not been described.

Communication Studies in Captivity

Although wild chimpanzees have complex communication, they do not possess what we would call language. They do not use specific calls to identify specific objects or individuals. Indeed, they seem unable to produce vocalizations at will, instead uttering cries and calls as a result of impulsive emotions. However, in spite of having no true language, the mental function of chimpanzees is well developed and they possess many of the cognitive abilities necessary for language to develop, as studies of their acquisition of lexigrams (keyboard symbols) and sign language have shown.

Chimpanzees can be taught large numbers of signs or symbols, which they can use to respond to questions reliably and repeatably. They can identify sizes, shapes, colors, and can distinguish what attributes of objects make them different (e.g., two circles, one blue, one red, differ in color). They can use abstract concepts and generalize. For example, they can know that a wrench is a tool and a banana is a food. They are able to spontaneously mix and use symbols they know to describe novel objects. For example, one chimpanzee described a cucumber as a “banana which is green”. Further, research has demonstrated that chimpanzees can understand spoken language, responding appropriately to requests, even though they are, themselves, unable to speak.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

  • Rumbaugh, D., E. Savage-Rumbaugh, R. Sevcik. 1994. Behavioral Roots of Language: A Comparative Perspective of Chimpanzee, Child, and Culture. Pp. 319-334 in R Wrangham, W McGrew, F deWaal, P Heltne, eds. Chimpanzee Cultures. Cambridge, Massachusetts: Harvard University Press in Cooperation with the Chicago Academy of Sciences.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Chimpanzees can live from 40 to 60 years.

A variety of ailments trouble chimpanzees in natural habitats, and affect survivorship and longevity. Respiratory diseases, such as colds and coughs, seem prevalent during the rainy season. Gastrointestinal problems, such as diarrhea, peritonitis, and enteritis have been seen and can be lethal, especially in young or very old chimps. Skin ulcers and osteoarthritis have affected some chimpanzees. One chimpanzee at Gombe had a goiter. Abcesses of various sorts have been seen, as have rashes, fungal diseases, and parasitic infections. Even human diseases may sometimes affect wild chimpanzees. A polio epidemic in local human populatons devastated the chimpanzees at Gombe Stream National Park in 1966, killing some and leaving many chimpanzees partially paralyzed.

In addition to disease, injuries are an important source of infections and can lead to mortality in chimpanzees. Injuries may be sustained during falls, or as a result of aggressive interactions within groups or among neighboring groups.

Range lifespan

Status: captivity:
59 (high) years.

Average lifespan

Status: wild:
51.0 years.

Average lifespan

Sex: male

Status: captivity:
56.0 years.

Average lifespan

Status: captivity:
44.5 years.

Average lifespan

Status: wild:
60.0 years.

Average lifespan

Status: captivity:
53.0 years.

Average lifespan

Status: wild:
45.0 years.

Average lifespan

Status: wild:
50.0 years.

Average lifespan

Status: captivity:
40.0 years.

Average lifespan

Sex: female

Status: captivity:
59.4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 59.4 years (captivity) Observations: Physiological observations indicate that chimpanzees develop age-related changes typical of humans at considerably earlier ages, and geriatric chimpanzees were originally defined as animals with 34 years of age and older (http://www.chimpanzoo.org/). Even in captivity, young adult chimpanzees have considerably higher mortality rates than humans (Hill et al. 2001). Therefore, while it is not known whether the pace of ageing is different between chimpanzees and humans, the onset of ageing appears to occur at earlier ages in chimpanzees. The MRDT and IMR were estimated based on mortality rates obtained from field sites (de Magalhaes 2006).+p Determining the maximum longevity of chimpanzees is problematic due to the many anecdotal reports. "Cheeta", a male chimpanzee who participated in some Tarzan movies, has been reported to be 75 years of age and still alive, though these claims have not been verified and might well be overestimated (http://cheetathechimp.org/). One wild-born female called "Little Mama" was estimated to be over 70 years of age at Lion Country Safari in Florida (http://www.lioncountrysafari.com/). Another specimen, called "Gregoire", reportedly died at the age of 66 in Congo after living most of his life in Brazzaville Zoo. In spite of these claims, chimpanzees in captivity have not been confirmed to live for more than 60 years (Richard Weigl 2005). Therefore, although the issue is controversial, the established maximum longevity of chimpanzees remains the 59.4 years that a female called "Gamma" was when she died in 1992 at Yerkes Regional Primate Research Center in Atlanta (Hakeem et al. 1996). Similarly, the maximum longevity in the wild belongs to one 55 year-old female, though there are unverified reports suggesting a longer lifespan (Hill et al. 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Chimpanzee reproduction is very complex, and many misconceptions arose early in the study of these animals about the nature of their mating system. Both males and females are known to mate with multiple partners, so they can be considered polygynandrous. However, at times a male may control sexual access to a female, preventing other males from mating with her. A male may do this either through force and dominance in a group mating situation, or by taking the female on a consortship away from other males and thereby securing exclusive sexual access to her. Each of these situations will be discussed at length below.

It is important to note that copulation may serve a number of social functions in this species. Females and males mate more often than would be necessary to ensure impregnation. Copulation may help to develop bonds between males and females. It may funtion in establishing and maintaining group unity.

Females have an estrus cycle which lasts approximately 36 days. During the course of this cycle, as her hormone levels change, a female experiences changes is the size, shape, and color of her genital skin. As circulating estrogens increase during the follicular phase of the cycle, the size of the swelling increases. When the anogenital skin is fully engorged, it is typically bright pink, and can measure from 938 to 1400 cc. The state of maximal tumescence is of variable length in different individuals and at different stages of maturity, but lasts an average of 6.5 days. It is during this time that females are sexually receptive and that the bulk of copulations with mature males occur.

The anogenital swelling of females is very important in the sexual behavior of these animals. Most copulations involving mature males and females (96.2%) seen at the Gombe Stream National Park in Tanzania were observed with females who were maximally tumescent. Of the few copulations observed when females were not maximally swollen, almost 75% were performed by one of two adult males, indicating that the propensity to copulate with females who are not at their peak swelling may be something of an individual idiosynchracy.

The role of the anogenital swelling is many-fold. First, it serves as a signal, visible to males from a great distance, that a female is sexually receptive. Since females tend to be relatively solitary, advertizement of their sexual state to potential mates is essential for reproduction to occur. Males are very interested in the condition of the genitals of each female they encounter. Second, the anogenital swelling may aid females in obtaining food resources including meat. Females who are maximally swollen are often able to supplant more dominant animals at a food source, and are more successful at begging food from males than are unswollen females. Finally, because the males find sexual swellings so attractive, having a maximally engorged genital region may help stranger females to interact peacefully with unfamiliar males as they disperse into new areas.

There are several possible mating scenarios that males and females may encounter. Each of these is based in part on the phase of the female’s cycle. A female may experience one or more of these scenarios during a particular cycle. The types of situations she encounters depend upon a female’s popularity as a sexual partner, how many other females are in estrus at the same time, how popular those females are, and how attractive the female is to the dominant male.

First, during early tumescence, females are mated by infants, juveniles and early adolescents. Infants and juveniles are probably gaining experience through the copulation, they are unlikely to sire offspring. Mature males do not typically copulate with females until they are maximally tumescent, although exceptions to this rule have been observed.

In the second sexual scenario, a female who has achieved maximal tumescence becomes the nucleus of a multi-male party. Other estrus females may travel in the same sexual party. These parties can include some or all of community males. During this phase of a female’s cycle, mating can be promiscuous. The males are typically not comepetitive in this situation, and different males may mate with the female in rapid succession.

The third situation a female might encounter occurs during the second half of maximal tumescence. As the timing of ovulation approaches, dominant males may become possessive and prevent subordinates from copulating with the female. This may involve outright conflicts or, because the dominance relationship between males is well established, may be as simple as the dominant male maintaining close proximity to the female, thereby communicating to his subordinates that the female is no longer up for grabs. Inhibition of the copulations of other males may also occur through threats or attacks. Interestingly, these attacks and threats are often directed at the female, should she express sexual interest in another male. Directing aggression toward the female benefits the male in several ways: 1) it prevents potentially costly fights with other large males, 2) it teaches the female not to copulate with anybody else, and 3) it prevents a third male from mating with the female while the possessive male is punishing another sexual rival. If the possesive male is the highest ranking male in a party, he can inhibit copulations between the female and all other males.

The result of this restriction of mates late in the course of maximal tumescence has the effect of reducing the number of potential sires for any offspring conceived during that estrus cycle. Since sperm remain viable in the fallopian tubes for 48 hours, only males copulating with a female during the last four days of her swelling could fertilize an egg. Even though a female may mate with many males during any particular cycle, not all of these matings have the potential of resulting in impregnation.

The fourth sexual mating situation is the consortship. During a consortship, the female may be led away from the group by a particular male. When consorting, male/female pairs often move to the periphery of the community range. Pairs can stay together up to 3 months. During consortship, both members of the pair maintain relative vocal silence, helping to avoid the attention of other community members, as well as attention from the males of neighboring communities who might behave with hostility toward the pair. Consortships inherently involve the cooperation of female.

Whether males engage in any of these sexual scenarios is highly variable among individuals. A male's preference for, or success in, group mating versus consortships may change depending upon the rise and fall of his fortunes in the constant struggle for dominance between community males. Males who are actively moving up the dominance heirarchy may not spend time away from other males frequently, as in doing so, they may sacrifice social status. Such males, who are in their prime, are more likely to be able to monopolize sexual access to a female in a group situation. High ranking males, especially the alpha male, may take females on consortships, but because of the need to maintain their social standing, these consortships tend to be short in duration.

It may benefit lower-ranking males to initiate consortships when possible, as in consortships there is no mating competition from other males. This may represent the most likely chance the male has to sire offspring. However, it is harder to entice a female to come on a consortship if she is close to ovulation because of competition/possessiveness of other males. A female may benefit from consortships by being able to choose the male with whom she mates. There may also be better access to food and reduced aggression during a consortship as compared to a group mating situation. However, these benefits must be weighed against the potential cost of encountering hostile neighboring chimpanzee groups when spending time in the periphery of the range.

Most consortships (40%) at Gombe Stream National Park were initiated when a female was maximally swollen. Only 16% of consortships were intiated when the female was at variable tumescence, and even fewer consortships began when females were flabby (12%) or pregnant (12%).

To initiate a consortship, a male may gaze toward the female he desires to consort with. This is often accompanied by piloerection (fluffed-out hair), branch shaking, arm stretching, and rocking. If the male succeeds in getting the female to follow him away from the group, he will often walk while looking over his shoulder to make sure she’s still tagging along. This sequence of behaviors may be repeated until the female follows him. If the female does not comply with the male’s wishes, he may become hostile, using aggression to force her to follow him.

During just over half of fertile cycles, females are confined to multi-male groups. About 21% of fertile cycles occur on consortships. The remaining 15% of cycles occur when young females visit males in other communities. In spite of the numbers of fertile cycles which fall under each mating situation, females are disproportionately likely to conceive during consortships. The exact mechanism of this is not understood.

Male mate choice

Because males become possesive of females only late in the course of maximal tumescence, it appears that they have some ability to discern the fertile period of females. The ability of male chimpanzees to gauge the potential fertility of a given female can unquestionably be inferred from patterns of copulations. The increase in the copulation frequency of dominant or older males as ovulation approaches demonstrates that males do not respond the same to females throughout the duration of maximal tumescence. Copulations increase as fertilization and impregnation become more likely. In addition, females who were presumed to be undergoing nonfertile cycles (such as during pregnancy and early in the postpartum period) are typically not sexually popular with mature males.

Aside from potential fertility, one characteristic involved in male mate choice is the age of the female. When presented with two receptive females, males typically show a preference for copulating with the older of the two. Personality traits of individual females may also contribute to males favoring them. A female who is relaxed in the presense of males may be prefered over a more skittish female. Novelty can also play a role in attracting males, since they seem to prefer unfamiliar females over those with whom they have longstanding relationships.

Female mate choice

Females have some ability to choose the males with whom they mate. They may choose to accept or decline a male’s invitation to consortship. This may allow a female to ensure that a particular male who is low in dominance standing, and therefore is less successful in group mating competitions, sires her offspring. The characteristics of males with whom females consort may vary. It seems that the overall “friendliness” of a female’s relationship with a male may play some role in her choice of him as a consortship partner. Whether the male has played with her, groomed her, or engaged in other friendly behaviors with her as she matured or when she is not maximally swollen, may play some role.

Although consenting to a consortship clearly demonstrates choice on the part of the female, it should not be assumed that by staying in a multi-male mating party as ovulation approaches, a female is relinquishing her mate choice. She may be choosing to mate with particular dominant individuals. Or, she may be enhancing her social status and familiarity to all the community males by remaining in the group.

That females discriminate between various males in mating situations is clear. Females avoid copulations with their mature sons and their brothers. There is also some evidence that young females avoid copulations with the older males in their communities (who may potentially have sired them). Although matings do occur between siblings, and occasionally between mothers and their mature sons, the frequency of such matings is much less than would be expected by random pairings of adults within the community.

Initiating a copulation

Copulations are typically initiated by males. The male sits in what is called the “male invite” posture, with his legs flexed and slightly splayed. This displays his erect penis to a potential mate. A male chimpanzee’s penis is bright pink, thin, and tapered to a point. It is very visible against the black hair and pale skin on the male’s lower abdomen and thighs. The value of the erect penis as a signal may be enhanced as the male “flicks” it-- causing the penis to make a rapid “tapping” movement.

In addition to displaying his penis, a courting male may show piloerection (fluffed-out hair). A male may gaze directly at a female. Such a gaze directed at a male rival is an unambiguous threat, but in a sexual context appears to serve as an invitation. He may place his raised hand on a branch overhead, and he may shake the branch. This is all a low-key invitation to the female to present her hindquarters to the male for copulation. If he fails to attract the notice of the female, he may incorporate one or more of the following behaviors into his display: arms outstretched toward the female, a bipedal swagger, a sitting hunch, side to side rocking, swaying of vegetation, or stamping with the foot or knuckes.

Copulation usually occurs in a squatting position after the female crouches and presents her rump to the male. Often, there is no contact between the participants in the mating except at their genitals, although sometimes the male may hold the female.

Ejaculation is usually achieved within 8.8 thrusts. The copulation is ended as the male scoots back or the female darts forward. Males and females have been seen to clean themselves with leaves after copulating. Females not infrequently consume the vaginal plug (congealed semen) after mating.

Mating System: polygynandrous (promiscuous) ; cooperative breeder

There is no clear seasonality in the reproduction of chimpanzees. Females cycle throughout the year, and males copulate with them when they are receptive. Females may have infertile cycles, such as are seen during the period of adolescent sterility, during pregnancy, and early in the postpartum period. Males copulate with females during infertile cycles as well as during fertile cycles. This indicates that there are social functions other than reproduction related to sexual behavior in these animals.

The female reproductive cycle lasts an average of 36 days. As hormone levels change during their cycle, so does the size of the female’s anogenital swelling. There are four main phases to the cycle, including inflation, as the size of the swelling increases, maximal tumescence. when the sexual skin is fully distended, detumescence, when the previously swollen skin looses all turgidity, and flat, when there is no sign of swelling in the anogenital area. Menstruation occurs about nine days after detumescence begins, and lasts for about three days. Ovulation typically occurs on the last day of maximal tumescence.

Females do not reproduce frequently. There is a prolonged period of juvenile dependence during which the offspring relies on the mother for milk, protection, and education. Becuse of the care required by a single offpspring, females cannot produce offspring frequently. The duration of the interbirth interval varies from population to population. Some of the variability may be due to ecological factors (highly productive habitats may allow females to wean their young sooner, or may result in higher rates of infant survival, both of which would affect interbirth intervals). Because different populations may also represent different subspecies, genetic differences in the timing of reproduction may also be involved.

Average interbirth intervals range between 3 and 6 years. Gestation lasts from 202 to 260 days, with a mean of 230 days. Typically, a single young is born, weighing about 2 kg. Twinning is rare, but may be more common than in humans. The infant is carried ventrally by the mother for about 3 to 6 months, after which infants may either ride on their mother’s ventrum or on her back. As the young chimp grows, it increasingly rides on its mother’s back during travel. Although young chimps sometimes walk on their own, they regularly ride on mom until the time of weaning at 3.5 to 4.5 years.

The age of independece is somewhat difficult to judge in this very social species. Young chimps can survive without their mother after they are weaned. However, orphaned chimps are often “adopted” by an older sibling or another close relative, who provides the young chimp with care similar to that which the mother would provide. Young typically travel all the time with their mother until they reach puberty. At puberty, females may become the focus of sexual parties, and males become very interested in establishing themselves in the dominance hierarchy. The activities of maturing chimps around the age of 10 years lead to the parting of ways between a mother and her son.

Females and males enter puberty around the age of 7 years. Females experience a period of adolescent sterility of about three years, during which they cycle, but do not ovulate. During this period, females may transfer into a neighboring chimpanzee community.

As in humans, there is a great deal of variability between different populations and between individuals within populations in the timing of first birth. Female chimpanzees in the wild give birth to their first offspring between the ages of 11 and 23 years. In Tanzania, the average age at which a female first gives birth is between 14.5 and 15 years. Captive chimpanzees reach sexual maturity at younger ages, and have been known to have babies at ages as young a 7.5 years. However, even for well-fed captive animals, the average age at which a female has her first offspring is between 10.5 and 11.15 years.

Like females, males enter puberty around the age of 7 years. Males of any age, including infants, may mate with females, but these copulations are unlikely to result in impregnation of the female. It is not until males attain social maturity that they can effectively compete for access to females who are fertile. In the wild, males are first seen to ejaculate around the age of 9 years. They do not reach adult weight and social maturity until they are about 15 years of age.

In general, chimpanzees can be classified into age categories that represent developmental stages. Until the age of 5 years, chimpanzees are infants. From 5 to 7 years of age, chimpanzees are called juveniles. From 7 to 10 years of age, females are called adolescents. Similarly aged males, from 7 to 12 years are also called adolescents. Females aged 10 to 13 years are considered subadults, as are males aged 12 to 15 years. Females are considered fully adult around the age of 13 years, whereas males reach maturity later, around 15 years.

Breeding interval: The breeding interval varies. Female cycles last about 36 days, and females mate during each cycle. However, if pregnancy ensues, a female may not begin cycling again for 2.5 to 5.5 years.

Breeding season: Chimpanzees may breed throughout the year.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 202 to 260 days.

Average gestation period: 230 days.

Range weaning age: 30 to 54 months.

Average time to independence: 6 years.

Range age at sexual or reproductive maturity (female): 10 to 13 years.

Range age at sexual or reproductive maturity (male): 12 to 15 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 1821 g.

Average number of offspring: 1.

As is true for most mammals, females provide the bulk of parental care. They carry their offspring, groom them, nurse them, and provide them with opportunites to learn all of the complex behavioral patterns of the species. Young are completely dependent upon their mother until weaning at 3 to 4 years of age, but continue to travel with her and rely heavily upon her for support until they reach adulthood. Bonds with the mother extend throughout an individual’s life. In spite of having achieved independence, both males and females may maintain social bonds with their mother for the remainder of their lives. Although females sometimes emmigrate into a new community of chimpanzees, thereby severing ties with their mother, females may also stay in their natal community as adults. In this case, they may occasionally travel with their mother. Males often use their mother for emotional support when establishing themselves in the male dominance hierarchy. When things are not going particularly well for them, some males may seek the comfort, stability, and quiet that only their natal family can provide.

Because multiple young of different ages may be traveling with their mother at any time, bonds between siblings are also strong. These bonds may remain strong during adulthood, and brothers are frequent allies in intragroup intrigues. Older siblings frequently help to carry infants and play with infants. If the mother should die, older siblings will often assume the care of their immature, weaned siblings.

Males do not provide any direct parental care for young, although they can be quite gentle and playful with young members of their community, especially those still possessing a white tail tuft. Males may indirectly provide protection for their young. Adult males in the community engage in border patrols, which may help to protect the young from potentially dangerous stanger males.

The relationship between a mother and her offspring can have many repercussions during the life of the offspring. Although rank is not technically inherited from the mother, the rank of a female does affect her offspring. A mother who has a high rank, who is confident and relaxed in dealing with other chimpanzees, is likely to have offspring who behave in a similar fashion. Nervous mothers may produce offspring who are fearful of other chimpanzees, and who may not do well in dominance competition.

Because young males do not emmigrate at maturity, they inherit the home range of dominant males. There is no certainty of paternity in this polygynandrous species, so transmission is not directly from father to son and it is unlikely that such relatives would recognize one another as such. Females may remain in their natal community also, although they may transfer to a different chimpanzee social unit upon reaching maturity.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning; inherits maternal/paternal territory; maternal position in the dominance hierarchy affects status of young

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
  • Goodall, J. 1986. The Chimpanzees of Gombe: Patterns of Behavior. Cambridge, Massachusetts: The Belknap Press of Harvard University Press.
  • deWaal, F. 1982. Chimpanzee Politics: Power and Sex among Apes. New York: Harper and Row.
  • Jones, C., C. Jones, J. Jones, Jr., D. Wilson. 1996. Pan troglodytes. Mammalian Species, 529: 1-9.
  • Nishida, T., M. Hiraiwa-Hasegawa. 1986. Chimpanzees and Bonobos: Cooperative Relationships among Males. Pp. 165-177 in B Smuts, D Cheyney, R Seyfarth, R Wrangham, T Struhsaker, eds. Primate Societies. Chicago and London: The University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Self-medicating with plants: chimpanzees
 

Chimpanzees protect against pathogens by self-medicating with various plants.

       
  "Perhaps the most famous example of an animal herbalist is the common chimpanzee (Pan troglodytes). Those living in Tanzania's Gombe National Park are often seen pulling leaves off any of three species of Aspilia, a genus of bushy plant related to the sunflower. Instead of simply chewing the leaves, the apes roll them around their mouths for a while, rather like humans sucking medicinal pills, before swallowing them whole.

"Humans living in this area do precisely the same with Aspilia leaves (which taste far too unpleasant to chew, anyway), as they are effective in killing harmful bacteria and fungi because they contain thiarubine A, a powerful antibiotic. They also rid the intestinal tract of parasitic nematodes. In addition, scientists believe that these leaves act as a stimulant for the chimps, since they tend to eat them first thing in the morning, just as humans often drink coffee or tea shortly after waking to benefit from the stimulating effect of caffeine…Another herbal remedy employed by Tanzanian chimps is the bitter-tasting pith of the aptly named bitterleaf shrub (Vernonia amygdalina). This is popularly used by native tribes to counter both parasites and stomach pains, and has been proven to help the recovery of sick chimps." (Shuker 2001:214)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
  • Wrangham R; Nishida T. 1983. Aspilia spp. Leaves: A puzzle in the feeding behavior of wild chimpanzees. Primates. 24(2): 276-282.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Eating leaves to control reproduction: chimpanzees
 

Chimpanzees may induce abortions by eating leaves from certain Ziziphus and Combretum plant species.

   
  "Dr. Joan Garey from New York's Mount Sinai School of Medicine has also observed these chimps eating leaves from certain Ziziphus (jujub) and Combretum species, which are used by the local women to induce abortions. Consequently, in a paper presented at the annual meeting of the American Society of Primatologists in 1997, Garey speculated that the chimps may use these plants deliberately for the same purpose, as a means of reducing the size of the local chimp population if it has become too large." (Shuker 2001:214)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pan troglodytes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGTCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTACTATTCGGCGCATGGGCTGGAGTCCTGGGCACAGCCCTAAGTCTCCTTATTCGGGCTGAACTAGGCCAACCAGGCAACCTTCTAGGTAATGACCACATCTACAATGTCATCGTCACAGCCCATGCATTCGTAATAATCTTCTTCATAGTAATGCCTATCATAATCGGAGGCTTTGGCAACTGGCTAGTCCCCTTGATAATTGGTGCCCCCGACATGGCATTCCCCCGCATAAACAACATAAGCTTCTGACTCCTACCCCCTTCTCTCCTACTTCTACTTGCATCTGCCATAGTAGAAGCCGGCGCCGGAACAGGTTGAACGGTCTACCCTCCCTTAGCGGGAAACTACTCACATCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTGCATCTGGCAGGCGTCTCCTCTATCCTAGGAGCCATTAACTTCATCACAACAATTATTAATATAAAACCTCCTGCCATAACCCAATACCAAACACCCCTCTTCGTCTGATCCGTCCTAATCACAGCAGTCTTACTTCTCCTATCCCTCCCAGTCCTAGCTGCTGGCATCACCATACTATTGACAGATCGTAACCTCAACACTACCTTCTTCGATCCAGCCGGGGGAGGAGACCCTATTCTATATCAGCACTTATTCTGATTTTTTGGCCACCCCGAAGTTTATATTCTTATCCTACCAGGCTTCGGAATAATTTCCCACATTGTAACTTATTACTCCGGAAAAAAAGAACCATTTGGATATATAGGCATGGTTTGAGCTATAATATCAATTGGTTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTAGACACACGAGCCTATTTCACCTCCGCTACCATAATCATTGCTATTCCTACCGGCGTCAAAGTATTCAGCTGACTCGCTACACTTCACGGAAGCAATATGAAATGATCTGCCGCAGTACTCTGAGCCCTAGGGTTCATCTTTCTCTTTACCGTAGGTGGCCTAACCGGCATTGTACTAGCAAACTCATCATTAGACATCGTGCTACACGACACATACTACGTCGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCTGTATTCGCCATCATAGGAGGCTTCATCCACTGATTTCCCCTATTCTCAGGCTATACCCTAGACCAAACCTATGCCAAAATCCAATTTGCCATCATGTTCATCGGCGTAAACCTAACCTTCTTCCCACAACACTTCCTTGGCCTATCTGGGATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAATGTCCTATCATCCGTAGGCTCATTCATCTCCCTGACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTTGCTTCAAAACGAAAAGTCCTAATAGTAGAAGAGCCTTCCACAAACCTGGAATGACTGTATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAATCTAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pan troglodytes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 147
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A4cd

Version
3.1

Year Assessed
2008

Assessor/s
Oates, J.F., Tutin, C.E.G., Humle, T., Wilson, M.L., Baillie, J.E.M., Balmforth, Z., Blom, A., Boesch, C., Cox, D., Davenport, T., Dunn, A., Dupain, J., Duvall, C., Ellis, C.M., Farmer, K.H., Gatti, S., Greengrass, E., Hart, J., Herbinger, I., Hicks, C., Hunt, K.D., Kamenya, S., Maisels, F., Mitani, J.C., Moore, J., Morgan, B.J., Morgan, D.B., Nakamura, M., Nixon, S., Plumptre, A.J., Reynolds, V., Stokes, E.J. & Walsh, P.D.

Reviewer/s
Mittermeier, R.A., Butynski, T.M. & Williamson, E.A. (Primate Red List Authority)

Contributor/s

Justification
Although Chimpanzees are the most abundant and widespread of the apes, with many populations in protected areas, the declines that have occurred are expected to continue to occur, satisfy the criteria for ranking as Endangered (Oates 2006). Due to high levels of exploitation, loss of habitat and habitat quality due to expanding human activities, this species is estimated to have experienced a significant population reduction in the past 20 to 30 years (one generation is estimated to be 20 years; Boesch and Boesch-Achermann 2000, Emery Thompson et al. in prep., Gombe long-term records, unpubl.) and it is suspected that this reduction will continue for the next 30 to 40 years. The maximum population reduction over a three-generation (i.e., 60 year) period from the 1970s to 2030 is suspected to exceed 50%, hence qualifying this taxon for Endangered under criterion A4. The causes of the reduction, although largely understood, have certainly not ceased and are not easily reversible. The suspected future continuation of the population reduction is a precautionary approach based on the rapidly increasing human population density in the region, the spread of diseases such as Ebola, and the degree of political instability in some range states.

History
  • 2007
    Endangered
  • 2000
    Endangered
  • 2000
    Endangered
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chimpanzee populations are jeopardized by human expansion into rainforests and mixed forest environments. Humans destroy habitats required by chimpanzees for survival and hunt them for bushmeat. They are listed as an Appendix I species by CITES, and are considered endangered by IUCN redlist. The United States Fish and Wildlife Service consideres the species endangered in the wild, and threatened in captivity outside of the natural range.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 10/19/1976
Lead Region: Foreign (Region 10) 
Where Listed: the wild

Status: Threatened
Date Listed: 03/12/1990
Lead Region: Foreign (Region 10) 
Where Listed: captive


Population detail:

Population location: Wherever found in the wild
Listing status: E

Population location: Wherever found in captivity
Listing status: T

For most current information and documents related to the conservation status and management of Pan troglodytes , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (3). Subspecies: western or masked chimpanzee (P. t. verus); central or black-faced chimpanzee (P. t. troglodytes); eastern or long-haired chimpanzee (P. t. schweinfurthii); eastern Nigeria chimpanzee (P. t. vellerosus) are all classified as Endangered (EN) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Little recent survey work has been carried out over much of the chimpanzee’s range, and so population estimates are crude. The most recent estimate of total population size is 172,700 to 299,700 (Butynski 2003). Approximately 6,400 to 9,600 eastern chimpanzees were estimated to occur outside the DRC, with about 5,000 in Uganda. DRC was estimated to have 70,000 to 110,000. Central African chimpanzees were estimated to number 70,000 to 116,500. In the west, P. t. verus is patchily distributed and number between 21,300 and 55,600 with the greatest number estimated to be found in Guinea (Kormos et al. 2003); P. t. ellioti is the least numerous taxon with a total population of less than 6,500 individuals remaining (B. Morgan and J. Oates pers. comm. 2006). The only relatively large and secure population of P. t. ellioti is in Gashaka-Gumti National Park in Nigeria, with an estimated population of up to 1,500 (Oates et al. 2003).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The four subspecies face similar threats but to varying degrees in different regions.

Major threats include:
1. Habitat destruction and degradation, with varying impacts on populations and caused mainly by:
(a) slash and burn agriculture: deforestation across West and Central Africa has severely reduced chimpanzee habitats. It is estimated that more than 80% of the region’s original forest cover has been lost (Kormos et al. 2003). Rapid growth in human populations across Africa is expected to lead to continued widespread conversion of forest and woodland to agricultural land.
(b) Logging, oil and gas mining: increased accessibility to remote areas through road building poses a risk to chimpanzee populations through habitat degradation and fragmentation and potential increased poaching in areas previously not seriously impacted by such anthropogeniic pressures. In western Central Africa deforestation rates are low but selective logging is, or will be, carried out in the majority of forests outside of national parks. Logging generally, but not always, has a negative impact on chimpanzee density due to habitat alteration (removal of important food trees) and disturbance (Plumptre and Johns 2001, White and Tutin 2001).

2. Poaching. Due to low population densities and slow reproductive rates, hunting often leads to the rapid local extirpation of chimpanzee populations. The main reasons for hunting are:
(a) for meat: Chimpanzees currently constitute 1 to 3% of bushmeat sold in urban markets in Côte d’Ivoire (Caspary et al. 2001), and commercial hunting, often facilitated by logging, has caused declines in chimpanzee populations in some areas (Wilkie and Carpenter 1999, Tutin et al. 2005).
(b) pet trade: Although the pet trade is illegal in all range countries that are signatories to CITES, it persists illegally across Africa. The capture of an infant chimpanzee usually implies the death of its mother and often other members of the community.
(c) medicinal purposes: In some localities, chimpanzees are hunted traditionally for medicinal purposes. Some range countries, such as Guinea, still officially permit the capture of chimpanzees for scientific research.
(d) snares/crop-protection: People kill chimpanzees intentionally to protect their crops (S. Kamenya pers. comm. 2007). Chimpanzees may also be maimed or killed unintentionally when caught in snares set for other animals, such as baboons or cane rats (e.g., Reynolds 2005, C. Duvall pers. comm. 2007).

3. Disease. The main cause of death in chimpanzees at Gombe, Mahale and Taï is infectious disease (e.g., Goodall 1986, Nishida et al. 2003, Hanamura et al. 2006). Because chimpanzees and humans are so similar, chimpanzees succumb to many diseases that afflict humans (Butynski 2001). The frequency of encounters between chimpanzees and humans and/or human waste is increasing as human populations expand, leading to higher risks of disease transmission between humans and chimpanzees. If not properly managed, research and tourism also presents a risk of disease transmission between humans and chimpanzees. In the past 15 years, Ebola haemorrhagic fever has killed chimpanzees in Côte d’Ivoire (Formenty 1999), and repeated epidemics have caused dramatic declines of ape populations in remote protected areas in Gabon and the Republic of Congo (Huijbregts et al. 2003; Walsh et al. 2005, P. Walsh, unpubl.). While recent surveys have not always distinguished between the nests of chimpanzees and gorillas, the pooled density of apes in several large areas has declined by 50 to 90% following Ebola epidemics (Maisels et al. 2004, Tutin et al. 2005, Bermejo et al. 2006, Lahm et al. 2006, P. Walsh, unpubl.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat loss from mining, forestry and agriculture is one of the major threats to wildlife in equatorial Africa at present (8). Deforestation in west Africa is most severe and remaining pockets of undisturbed forest are home to highly fragmented populations of chimpanzees (8). The demand for bushmeat has recently exploded due in part to the growing human population, more accessible forests and the increased availability of firearms (4); some conservationists believe this trade is currently the biggest threat to species' survival in the area. Exposure to human diseases presents a further threat to the chimpanzee (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Chimpanzees are listed under Appendix I of CITES and as Class A under the African Convention. Chimpanzees are protected by law in most countries and they are present in numerous national parks throughout their range, although many populations occur outside protected areas. Nonetheless, stricter enforcement of wildlife laws, and more effective management of protected areas are urgently needed. Engagement with the extractive industries are predominant in Central Africa towards curtailing the bushmeat trade is essential. Some marked success in co-management and other arrangements have been implemented and these should be duplicated and extended (Morgan and Sanz in prep.).

Conservation education and promotion of economic alternatives to hunting and land-extensive agriculture should also be supported. Major resources are required to identify appropriate conservation actions in the face of the spread of Ebola (Walsh et al. 2005). Finally, a combination of factors has led to a poor understanding of the current population status of Pan troglodytes. Much of the range has not been surveyed, survey methods have been inconsistent, and many of the surveys are now out of date. Older survey data are particularly unreliable as Ebola, commercial hunting and extractive industries are known to have caused dramatic declines in some areas (Tutin et al. 2005). New surveys using consistent methods are greatly needed throughout most of the range of Pan troglodytes (Kuehl et al. in prep.). These will enable the conservation community to better understand the true impact of Ebola, the bushmeat trade, habitat degradation and destruction, and to effectively set priorities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Chimpanzees are protected by law throughout their range although this is often poorly enforced. The precise impact of the bushmeat trade is currently being investigated by the Bushmeat Working Group, part of the Convention on International Trade in Endangered Species (CITES) (9). The United Nations Environmental Program (UNEP) has recently recognised the urgent need to protect our closest relatives and has established a Great Ape Survival Project (GRASP) aimed at identifying the conservation initiatives required to secure the future of the apes and obtaining political support and funding to allow these to be achieved (10). The Jane Goodall Institute, amongst other organisations, is involving local people in chimp conservation in the form of sanctuaries and education programmes (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Chimpanzees have been known to prey upon young humans when the opportunity arises, although the propensity for this behavior is closely related to the presence of waste from human beer-making facilities. Chimpanzees eat these attractive, fermented leavings and become intoxicated, making them more likely to become aggressive. When frightened or aggressive chimpanzees can be dangerous, even to adult humans. In addition, because of their biological similarity to humans, they may serve as a reservoir or host for diseases that affect humans.

Negative Impacts: injures humans (bites or stings, carries human disease)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Chimpanzees, being among our closest living relatives, are of tremendous importance in medical research. They are also heavily used in studies of behavior, both in captivity and in the wild. They are the focus of valuable ecotourism enterprises and are popular in zoos. Finally, there is some illegal pet trade in chimpanzees and they are hunted for bushmeat.

Positive Impacts: pet trade ; food ; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common chimpanzee

The common chimpanzee (Pan troglodytes), also known as the robust chimpanzee, is a species of great ape. Colloquially, the common chimpanzee is often called the chimpanzee (or "chimp"), though this term can be used to refer to both species in the genus Pan: the common chimpanzee and the closely related bonobo, formerly called the pygmy chimpanzee. Evidence from fossils and DNA sequencing show both species of chimpanzees are the sister group to the modern human lineage.

The common chimpanzee is covered in coarse black hair, but has a bare face, fingers, toes, palms of the hands and soles of the feet. It is considered more robust than the bonobo, weighing between 40 and 65 kg (88 and 140 lb) and measuring approximately 1.3 to 1.6 m (4 ft 3 in to 5 ft 3 in) from head to tail. Its gestation period is eight months. The infant is weaned at about three years old, but usually maintains a close relationship with its mother for several more years; it reaches puberty at the age of eight to 10, and its lifespan in captivity is about 50 years.

The common chimpanzee lives in groups which range in size from 15 to 150 members, although individuals travel and forage in much smaller groups during the day. The species lives in a male-dominated, strict hierarchy, which means disputes can generally be settled without the need for violence. Nearly all chimpanzee populations have been recorded using tools, modifying sticks, rocks, grass, and leaves and use them for acquiring honey, termites, ants, nuts, and water. The species has also been found creating sharpened sticks to spear Senegal bushbabies out of small holes in trees.

The common chimpanzee is listed on the IUCN Red List as an endangered species. Between 170,000 and 300,000 individuals are estimated across its range in the forests and savannahs of West and Central Africa. The biggest threats to the common chimpanzee are habitat destruction, poaching and disease.

Contents

Etymology [edit]

The species name troglodytes, Greek for "cave-dweller", was coined by Johann Friedrich Blumenbach in his book De generis humani varietate nativa liber ("[Book] on the natural varieties of the human genus") published in 1776,[3][4] This book was based on his dissertation presented one year before (it had a date 16 Sep 1775 printed on its title page) to the University of Göttingen for internal use only,[5] thus the dissertation did not meet the conditions for published work in the sense of zoological nomenclature.[6]

The English name chimpanzee came from a Bantu language of Angola.[7]

Evolutionary history [edit]

Despite a large number of Homo fossil finds, chimpanzee fossils (genus Pan) were not described until 2005. Existing chimpanzee populations in West and Central Africa do not overlap with the major human fossil sites in East Africa. However, chimpanzee fossils have now been reported from Kenya. This would indicate that both humans and members of the Pan clade were present in the East African Rift Valley during the Middle Pleistocene.

According to John Gribbin and Jeremy Cherfas in their books The Monkey Puzzle: Reshaping the Evolutionary Tree and The First Chimpanzee: In Search of Human Origins, chimps and bonobos may be descended from Australopithecus. Chimpanzees were amongst the animals affected during the Toba eruption, hinting that Toba ash extended far west as Africa.

Taxonomy [edit]

DNA evidence suggests the bonobo and common chimpanzee species separated from each other less than one million years ago (similar in relation between Homo sapiens and Neanderthals).[8][9] The chimpanzee line split from the last common ancestor of the human line approximately six million years ago. As no species other than Homo sapiens has survived from the human line of that branching, both chimpanzee species are the closest living relatives of humans. The chimpanzee's genus, Pan, diverged from the gorilla's genus about seven million years ago.

Four subspecies of the common chimpanzee have been recognized:[10]

Physical description [edit]

The adult male common chimpanzee weighs between 40 and 60 kg (88 and 130 lb), the female weighs 32 to 47 kg (71 to 100 lb),.[11] However, large wild males can weigh up to 70 kg (150 lb) and males in captivity, such as Travis the Chimp, have reached 91 kg (200 lb).[12][13][14] Head-body length (from the nose to the rump while on all fours) ranges from 63 to 94 cm (25 to 37 in).[14][15] Males can measure up to 1.6 m (5 ft 3 in) tall while standing and females up to 1.3 m (4 ft 3 in) tall. Their bodies are covered by coarse black hair, except for the face, fingers, toes, palms of the hands and soles of the feet. Researchers report their "muscles [are] five times as dense as a man's. So dense they can't swim."[16]


Both its thumbs and big toes are opposable, allowing a precise grip. The common chimpanzee is both arboreal and terrestrial and spends its nights in the trees, while most daylight hours are spent on the ground.[17] Its habitual gait is quadrupedal, using the soles of its feet and resting on its knuckles, but it can walk upright for short distances. The common chimpanzee is a 'knuckle walker', like the gorilla and the bonobo,[17] in contrast to the quadrupedal locomotion of the orangutan, a 'palm walker' that uses the outside edge of its palms.

Ecology [edit]

Chimpanzee in a tree with a kill.

The common chimpanzee is a highly adaptable species. It lives in a variety of habitats, including dry savanna, evergreen rainforest, montane forest, swamp forest, and dry woodland-savanna mosaic.[18][19] In Gombe, the chimpanzee lives in subalpine moorland, open woodland, semideciduous forest, evergreen forest, and grassland with scattered trees.[19] At Bossou, the chimpanzee inhabits multistage secondary deciduous forests, which have grown after shifting cultivation, as well as primary forests and grasslands.[20] At Taï, it can be found in the last remaining tropical rainforest in Côte d'Ivoire.[21]

The chimpanzee has an advanced cognitive maps of its home range and can repeatedly find food.[19] The chimpanzee makes a night nest in a tree in a new location every night, with every chimpanzee in a separate nest other than infants or small chimpanzees, which sleep with their mothers.[22] When confronted by a predator, the chimpanzee will react with loud screams and use any object it can against the threat. Leopard predation is apparently a significant cause of mortality in chimpanzees at Taï and Lopé National Parks.[21][23]

In some cases, the common chimpanzee has been documented killing leopard cubs,[24] an act which primarily seems to be a protective effort. Lions may have also preyed on the chimpanzees at Mahale Mountains National Park, where at least four chimpanzees could have fallen prey to them.[25] Although no other instances of lion predation on chimpanzees have been recorded, the larger group sizes of savanna chimps may have developed as a response to threats from these big cats.[25] Isolated cases of cannibalism have also been documented.[26]

Diet and foraging [edit]

Chimpanzee eating fruit.

The chimpanzee is an omnivorous frugivore. It prefers fruit above all other food items and will even seek out and eat them when they are not abundant. It will also eat leaves and leaf buds. Seeds, blossoms, stems, pith, bark and resin, insects and meat make up the rest of its diet.[19][27] While the common chimpanzee is mostly herbivorous, it does eat honey, soil, insects, birds and their eggs, and small to medium-sized mammals, including other primates.[19][28] The western red colobus ranks at the top of preferred mammal prey. Other mammalian prey include, red-tailed monkeys, yellow baboons, blue duikers, bushbucks and warthogs.[29] Jane Goodall documented many occasions within Gombe Stream National Park of chimpanzees and western red colobus monkeys ignoring each other within close proximity.[30][31]

When hunting small monkeys such as the red colobus, the chimpanzee hunts where the forest canopy is interrupted or irregular.[32] This allows it to easily corner the monkeys when chasing them in the appropriate direction. Chimps may also hunt as a coordinated team, so that they can corner their prey even in a continuous canopy.[32] During an arboreal hunt, each chimp in the hunting groups has a role. "Drivers" serve to keep the prey running in a certain direction and follow them without attempting to make a catch.

"Blockers" are stationed at the bottom of the trees and will climb up to block prey that take off an a different direction. "Chasers" move quickly and try to make a catch. Finally, "ambushers" hide and position themselves where no prey had reached yet and rush out when a monkey nears.[32] Both adult and infants are taken. However, adult male black-and-white colobus monkeys will attack the hunting chimps. In Gombe, the chimpanzee also fears adult colobus monkeys.[19] It prefers to snatch infants from their mother's bellies without harming the mothers. Male chimps hunt more than females. When caught and killed, the meal is distributed to all hunting party members and even bystanders.[32]

Behavior [edit]

Group structure [edit]

Chimpanzees grooming one another.

Common chimpanzees live in communities that typically range from 20 to more than 150 members, but spend most of their time travelling in small, temporary groups consisting of a few individuals, "which may consist of any combination of age and sex classes."[22] Both males and females will sometimes travel alone.[22] The common chimpanzee lives in a fission-fusion society and may be found in groups of the following types: all-male, adult females and offspring, consisting of both sexes, or one female and her offspring. Chimpanzees have complex social relationships and spend a large amount of time grooming each other.[33]

At the core of social structures are males, which roam around, protect group members, and search for food. Males remain in their natal communities, while females generally emigrate at adolescence. As such, males in a community are more likely to be related to one another than females are to each other. Among males, there is generally a dominance hierarchy and males are dominant over females.[34] However, this unusual fission-fusion social structure, "in which portions of the parent group may on a regular basis separate from and then rejoin the rest,"[19] is highly variable in terms of which particular individual chimpanzees congregate at a given time. This is mainly due to chimpanzees having a high level of individual autonomy within their fission-fusion social groups. Also, communities have large ranges that overlap with those of other groups.

As a result, individual chimpanzees often forage for food alone, or in smaller groups (as opposed to the much larger "parent" group, which encompasses all the chimpanzees which regularly come into contact and congregate into parties in a particular area). As stated, these smaller groups also emerge in a variety of types, for a variety of purposes. For example, an all-male troop may be organized to hunt for meat, while a group consisting of lactating females serves to act as a "nursery group" for the young.[35] An individual may encounter certain individuals quite frequently, but have run-ins with others almost never or only in large-scale gatherings. Due to the varying frequency at which chimpanzees associate, the structure of their societies is highly complicated.

Male chimpanzees in Mahale National Park, Tanzania.

Male chimpanzees exist in a linear dominance hierarchy. Top-ranking males tend to be aggressive even during dominance stability.[36] This is likely due to the chimp’s fission-fusion society, with male chimps leaving groups and returning after extended periods of time. With this, a dominant male is unsure if there has been any "political maneuvering" and must re-establish his dominance. Thus, a large amount of aggression occurs 5–15 minutes after a reunion.[36][37] During aggressive encounters, displays are preferred over attacks.[36][37]

Males maintain and improve their social ranks by forming coalitions. These coalitions have been characterized as "exploitive" and are based on an individual’s influence in agonistic interactions.[38] Being in a coalition allows males to dominate a third individual when they could not by themselves, as politically apt chimps can exert power over aggressive interactions regardless of their rank. Coalitions can also give an individual male the confidence to challenge a dominant male. The more allies a male has, the better his chance of becoming dominant. However, most changes in hierarchical rank are caused by dyadic interactions.[36] Chimpanzee alliances can be very fickle and one member may turn on another if it serves him.[39]

Low ranking males commonly switch sides in disputes between more dominant individuals. Low ranking males benefit from an unstable hierarchy and have increased sexual opportunities.[38][39] In addition, conflicts between dominant males causes them to focus on each other rather than the lower ranking males. Social hierarchies among adult females tend to be weaker. Nevertheless, the status of an adult female may be important for her offspring.[40] Females in Taï have also been recorded to form alliances.[41] Social grooming appears to be important in the formation and maintenance of coalitions.[42] It is more common among adult males than adult females.

Chimpanzees have been described as highly territorial and are known to kill other chimps,[43] although Margaret Power wrote in her 1991 book The Egalitarians that the field studies from which the aggressive data came, Gombe and Mahale, use artificial feeding systems that increased aggression in the chimpanzee populations studied, so might not reflect innate characteristics of the species as a whole.[44] In the years following her artificial feeding conditions at Gombe, Jane Goodall described groups of male chimps patrolling the borders of their territory brutally attacking chimps which had split off from the Gombe group. A study published in 2010 found that the chimpanzees wage wars over land, not mates.[45] Patrol parties from smaller groups are more likely to avoid contact with their neighbors. Patrol parties from large groups will even take over a smaller group's territory, gaining access to more resources, food and females.[19][39]

Mating and parenting [edit]

Common chimpanzee infant and mother

Chimpanzees mate throughout the year, although the number of females in estrus varies seasonally in a group.[21][46] Female chimps are more likely to come into estrus when food is readily available. Estrous females exhibit sexual swellings. Chimp mating tends to be promiscuous, with females mating with multiple males in her community during estrus.[19] As such, males have large testicles for sperm competition. However, other forms of mating also exist. A community's dominant males sometimes restrict reproductive access to females. A male and female can form consortship and mate outside their community. In addition, females sometimes leave their communities and mate with males from neighboring communities.[19][47]

These alternative mating strategies give females more mating opportunities without losing the support of the males in their community.[47] Infanticide has been recorded in chimp communities in Gombe, Mahale, and Kibale National Parks. Male chimps practice infanticide on unrelated young to shorten the interbirth intervals in the females. There are also accounts of infanticide by females. There are questions whether cases of female infanticide are related to the dominance hierarchy in females or are simply isolated pathological behaviors.[19][40]

Care for the young is provided mostly by their mothers. The survival and emotional health of the young is dependent on maternal care.[19] Mothers provide their young with food, warmth, and protection, and teach them certain skills. In addition, a chimp’s future rank may be dependent on its mother’s status.[19][21] For their first 30 days, infants cling to their mother's bellies. Newborn chimps are helpless; their grasping reflex is not strong enough to support them for more than a few seconds. Infants are unable to support their own weight for their first two months and need their mothers' support.[48]

When they reach five to six months, infants ride on their mothers’ backs. They remain in continual contact for the rest of their first year. When they reach two years of age, they are able to move and sit independently.[48] By three years, infants will move further away from their mothers. By four to six years, chimps are weaned and infancy ends.[48]

The juvenile period for chimps lasts from their sixth to ninth years. Juveniles remain close to their mothers, but they also have more interactions with other members of their community. Adolescent females move between groups and are supported by their mothers in agonistic encounters. Adolescent males spend time with adult males in social activities like hunting and boundary patrolling.[48]

Communication [edit]

Chimpanzees use a variety of facial expressions, postures and sounds to communicate with each other.[19] Chimps have expressive faces which are important in close-up communications. When frightened, a "full closed grin" causes nearby individuals to be fearful, as well. Other facial expressions include the "lip flip", "pout", "sneer", and "compressed-lips face".[19] When sumitting to a conspecific, a chimp will crunch, bob and extend a hand. When in an aggressive mode, a chimp will swagger bipedally, hunched over and arms waving, in an attempt to exaggerate its size.[19] Chimps will beat their hands and feet against the trunks of large tree, an act known as "drumming".[49]

Vocalizations are also important in chimp communication. The most common and important call in adults is the "pant-hoot". These calls are made when individuals are excited.[19] Pant-hoots are made of four parts, starting with soft "hoos" that get louder and louder and climax into screams and sometimes barks; the former die down to soft "hoos" again as the call ends.[49] Submissive individuals will make "pant-grunts" towards their superiors.[19][40] Chimps use distance calls to draw attention to danger, food sources or other community members.[19] "Barks" may be made as "short barks" when hunting and "tonal barks" when sighting large snakes.[49]

Tool use [edit]

Nearly all chimpanzee populations have been recorded using tools. They will modify sticks, rocks, grass, and leaves and use them when foraging for honey, termites, ants, nuts, and water. Despite the lack of complexity, there does seem to be forethought and skill in making these tools and should be considered such.[50] While it has been known since Jane Goodall's 1960s discovery that modern chimpanzees use tools, research published in 2007 indicates that chimpanzee stone tool use dates to at least 4,300 years ago.[51]

A common chimpanzee from the Kasakela chimpanzee community was the first non-human animal observed making a tool, by modifying a twig to use as an instrument for extracting termites from their mound.[52][53][54] At Taï, chimps simply use their hands to extract termites.[50] When foraging for honey, chimps will use modified short sticks to scoop the honey out of the hive, that is, if the bees are stingless. For hives of the dangerous African honeybees, chimps use longer and thinner sticks to extract the honey.[55] Chimps will also fish for ants using the same tactic.[19][50]

Ant dipping is difficult and some chimps never master it. West African chimps will crack open hard nuts with stones or branches.[21][50] There seems to be some forethought in his activity as these items are not found together or near a source of nuts. Nut cracking is also difficult and must be learned.[21] Chimps will also use leaves as sponges or spoons to drink water.[56]

A recent study revealed the use of such advanced tools as spears, which West African chimpanzees in Senegal sharpen with their teeth, being used to spear Senegal bushbabies out of small holes in trees.[57] An eastern chimpanzee has been observed using a modified branch as a tool to capture a squirrel.[58]

Chimpanzees and humans [edit]

Field study [edit]

Jane Goodall undertook the first long-term field study of the common chimpanzee, begun in Tanzania at Gombe Stream National Park in 1960. Other long-term study sites begun in 1960 include A. Kortlandt in eastern Democratic Republic of the Congo and Junichiro Itani in Mahale Mountains National Park in Tanzania.[59] Current understanding of the species' typical behaviors and social organization are formed largely from Goodall's ongoing 50-year Gombe research study.[44]

Genome Project [edit]

Relationships among apes. The numbers in this diagram are branch lengths, a measure of evolutionary distinctness. Based on protein electrophoresis data of Goldman et al.[60]

Human and common chimpanzee DNA are very similar. After the completion of the Human Genome Project, a Chimpanzee Genome Project was initiated. In December 2003, a preliminary analysis of 7600 genes shared between the two genomes confirmed that certain genes, such as the forkhead-box P2 transcription factor which is involved in speech development, have undergone rapid evolution in the human lineage. A draft version of the chimpanzee genome was published on September 1, 2005, in an article produced by the Chimpanzee Sequencing and Analysis Consortium.[61]

The DNA sequence differences between humans and chimpanzees is about thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements. Typical human and chimp protein homologs differ in only an average of two amino acids. About 30% of all human proteins are identical in sequence to the corresponding chimp protein. Duplications of small parts of chromosomes have been the major source of differences between human and chimp genetic material; about 2.7% of the corresponding modern genomes represent differences, produced by gene duplications or deletions, during the approximately four to six million years since humans and chimps diverged from their common evolutionary ancestor. Results from human and chimp genome analyses, currently being conducted by geneticists including David Reich, should help in understanding the genetic basis of some human diseases.

Attacks [edit]

Common chimpanzees have been known to attack humans on occasion.[62][63] There have been many attacks in Uganda by chimpanzees against human children; the results are sometimes fatal for the children. Some of these attacks are presumed to be due to chimpanzees being intoxicated (from alcohol obtained from rural brewing operations) and mistaking human children[64] for the Western red colobus, one of their favorite meals.[65] The dangers of careless human interactions with chimpanzees are only aggravated by the fact that many chimpanzees perceive humans as potential rivals.[66]

With up to five times the upper body strength of a human, an angered chimpanzee could easily overpower and potentially kill even a fully grown man, as shown by the attack on and near death of former NASCAR driver St. James Davis.[67][68] Another example of chimpanzee to human aggression occurred February 2009 in Stamford, Connecticut, when a 200-pound (91 kg), 14-year-old pet chimp named Travis attacked his owner's friend, who lost her hands, eyelids, nose and part of her upper jaw/sinus area from the attack.[69][70] There are at least six documented cases of chimpanzees snatching and eating human babies.[71]

Link with human immunodeficiency virus type 1 [edit]

This Cameroonian chimpanzee was brought to a rescue centre after its mother was killed by poachers.

Two types of human immunodeficiency virus (HIV) infect humans: HIV-1 and HIV-2. HIV-1 is the more virulent and easily transmitted, and is the source of the majority of HIV infections throughout the world; HIV-2 is largely confined to west Africa.[72] Both types originated in west and central Africa, jumping from primates to humans. HIV-1 has evolved from a simian immunodeficiency virus (SIVcpz) found in the common chimpanzee subspecies, Pan troglodytes troglodytes, native to southern Cameroon.[73][74] Kinshasa, in the Democratic Republic of Congo, has the greatest genetic diversity of HIV-1 so far discovered, suggesting the virus has been there longer than anywhere else. HIV-2 crossed species from a different strain of SIV, found in the sooty mangabey monkeys in Guinea-Bissau.[72]

Status and conservation [edit]

Chimpanzee are a legally protected species in most of their range and can be found both in and outside national parks.[2] There is thought to between 172,700 to 299,700 individuals living in the wild.[2]

The biggest threats to the common chimpanzee are habitat destruction, poaching and disease.[2] Chimpanzee habitats have been limited by deforestation in both West and Central Africa. Road building has caused habitat degradation and fragmentation of chimpanzee populations and may allow poachers more access to areas that have not been seriously impacted by humans.[2] While deforestation rates are low in western Central Africa, selective logging may be done outside national parks.[2]

Chimpanzee are a common target for poachers. In Côte d’Ivoire, chimpanzees make up 1–3% of bushmeat sold in urban markets.[2] They are also taken in pet trades despite it being illegal in many countries where they live.[2] Chimpanzees are also hunted for medicinal purposes in some areas.[2] Capturing chimpanzees for scientific research is still allowed in some countries, such as Guinea.[2] People will kill any chimpanzee that threatens their crops.[2] Chimps may also be unintentionally maimed or killed by snares meant for other animals.

Infectious diseases are a main cause of death for chimpanzees. Chimpanzees succumb to many diseases that afflict humans since the two species are so similar.[2] As human populations grow, so does the risk of disease transmission between humans and chimpanzees.[2]

See also [edit]

General:

References [edit]

  1. ^ Groves, C. P. (2005). In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. p. 183. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ a b c d e f g h i j k l m Oates, J.F., Tutin, C.E.G., Humle, T., Wilson, M.L., Baillie, J.E.M., Balmforth, Z., Blom, A., Boesch, C., Cox, D., Davenport, T., Dunn, A., Dupain, J., Duvall, C., Ellis, C.M., Farmer, K.H., Gatti, S., Greengrass, E., Hart, J., Herbinger, I., Hicks, C., Hunt, K.D., Kamenya, S., Maisels, F., Mitani, J.C., Moore, J., Morgan, B.J., Morgan, D.B., Nakamura, M., Nixon, S., Plumptre, A.J., Reynolds, V., Stokes, E.J. & Walsh, P.D. (2008). Pan troglodytes. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 January 2009. Database entry includes justification for why this species is endangered
  3. ^ p. 37 in Blumenbach, J. F. 1776. De generis hvmani varietate nativa liber. Cvm figvris aeri incisis. – pp. [1], 1–100, [1], Tab. I-II [= 1–2]. Goettingae. (Vandenhoeck).
  4. ^ AnimalBase species taxon summary for troglodytes Blumenbach, 1776 described in Simia, version 11 June 2011
  5. ^ Kroke, c. 2010. Johann Friedrich Blumenbach. Bibliographie seiner Schriften. Göttingen: Universitätsverlag, No. 1 and 2.
  6. ^ Ride, W.D.L. et al. (eds.) (1999) Art. 8.1.1. International Code of Zoological Nomenclature, 4th ed., The International Trust for Zoological Nomenclature, ISBN 0853010064.
  7. ^ Chimpanzee. Online Etymology Dictionary: Etymonline.com. Retrieved on 2013-04-18.
  8. ^ Won YJ, Hey J (February 2005). "Divergence population genetics of chimpanzees". Mol. Biol. Evol. 22 (2): 297–307. doi:10.1093/molbev/msi017. PMID 15483319. 
  9. ^ Fischer A, Wiebe V, Pääbo S, Przeworski M (May 2004). "Evidence for a complex demographic history of chimpanzees". Mol. Biol. Evol. 21 (5): 799–808. doi:10.1093/molbev/msh083. PMID 14963091. 
  10. ^ Hof, Jutta; Sommer, Volker: Apes Like Us: Portraits of a Kinship, Edition Panorama , Mannheim 2010, ISBN 978-3-89823-435-1, p. 114.
  11. ^ Cawthon Lang, K. A. (13 April 2006). "Primate Factsheets: Chimpanzee (Pan troglodytes)". Retrieved 29 January 2012. 
  12. ^ "Chimpanzee Attack Revives Calls for Federal Primate Law". Fox News. 18 February 2009. Retrieved 28 January 2012. 
  13. ^ Eskeletons. Eskeletons.org Retrieved on 2013-04-18.
  14. ^ a b Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  15. ^ WCMC Species sheets
  16. ^ Yerkes: Link to the Past, Hope for the Future. Whsc.emory.edu. Retrieved on 2013-04-18.
  17. ^ a b Janssen, Ellen and Paul (2006). "Chimpanzee Fact File". African Wildlife Foundation. Retrieved 23 September 2012. 
  18. ^ Poulsen JR, Clark CJ (2004). "Densities, distributions, and seasonal movements of gorillas and chimpanzees in swamp forest in northern Congo". Int J Prim 25 (2): 285–306. doi:10.1023/B:IJOP.0000019153.50161.58. 
  19. ^ a b c d e f g h i j k l m n o p q r s t Goodall, Jane (1986). The Chimpanzees of Gombe: Patterns of Behavior. ISBN 0-674-11649-6. 
  20. ^ Sugiyama Y, Koman J (1987). "A preliminary list of chimpanzees' alimentation at Bossou, Guinea". Primates 28 (1): 133–47. doi:10.1007/BF02382192. 
  21. ^ a b c d e f Boesch C, Boesch-Achermann H. (2000) The chimpanzees of the Taï Forest: behavioral ecology and evolution. Oxford, England: Oxford Univ Pr.
  22. ^ a b c Van Lawick-Goodall, Jane (1968). "The Behaviour of Free-Living Chimpanzees in the Gombe Stream Reserve". Animal Behaviour Monographs (Rutgers University) 1 (3): 167.
  23. ^ Henschel P, Abernethy KA, White LJT (2005). "Leopard food habits in the Lopé National Park, Gabon, Central Africa". Afr J Ecol 43 (1): 21–8. doi:10.1111/j.1365-2028.2004.00518.x. 
  24. ^ "Aggression toward Large Carnivores by Wild Chimpanzees of Mahale Mountains National Park, Tanzania". Content.karger.com. 2008-09-11. Retrieved 2009-07-03. 
  25. ^ a b Tsukahara T (10 September 1992). "Lions eat chimpanzees: The first evidence of predation by lions on wild chimpanzees". American Journal of Primatology 29 (1): 1–11. doi:10.1002/ajp.1350290102. 
  26. ^ Goodall, J. (1977). "Infant killing and cannibalism in free-living chimpanzees". Folia Primatologica (Basel) 28 (4): 259–289. doi:10.1159/000155817. 
  27. ^ Guernsey, Paul. "WHAT DO CHIMPS EAT?". All About Wildlife. Retrieved 22 April 2013. 
  28. ^ Isabirye-Basuta G. (1989) "Feeding ecology of chimpanzees in the Kibale Forest, Uganda", pp. 116–27 in: Heltne PG, Marquardt LA (eds.). Understanding chimpanzees. Cambridge, (MS): Harvard Univ Press, ISBN 0674920910.
  29. ^ Boesch C, Uehara S, Ihobe H. (2002) "Variations in chimpanzee-red colobus interactions", pp. 221–30 in: Boesch C, Hohmann G, Marchant LF, editors. Behavioral diversity in chimpanzees and bonobos. Cambridge, England: Cambridge Univ Press, ISBN 0521006139.
  30. ^ "Chimps on the hunt". BBC Wildlife Finder. 1990-10-24. Retrieved 2009-09-22. 
  31. ^ Van Lawick-Goodall, Jane (1968). "The Behaviour of Free-Living Chimpanzees in the Gombe Stream Reserve". Animal Behaviour Monographs (Rutgers University) 1 (3): 191. 
  32. ^ a b c d Leipzig G (2002). "Cooperative hunting roles among Taï chimpanzees". Human Nature 13 (1): 27–46. doi:10.1007/s12110-002-1013-6. 
  33. ^ The Chimpanzees of Tanzania". Wild Kingdom. December 31, 1976.
  34. ^ Goldberg TL, Wrangham RW (1997). "Genetic correlates of social behavior in wild chimpanzees: evidence from mitochondrial DNA". Anim Beh 54 (3): 559–70. doi:10.1006/anbe.1996.0450. 
  35. ^ Pepper JW, Mitani JC, Watts DP (1999). "General gregariousness and specific social preferences among wild chimpanzees". Int J Prim 20 (5): 613–32. doi:10.1023/A:1020760616641. 
  36. ^ a b c d Muller, MN. (2002) "Agonistic relations among Kanyawara chimpanzees", pp. 112–124 in: Boesch C, Hohmann G, Marchant LF, editors. Behavioural diversity in chimpanzees and bonobos. Cambridge: Cambridge University Press, ISBN 0521006139.
  37. ^ a b Bygott, JD. (1979) "Agonistic behavior, dominance, and social structure in wild chimpanzees of the Gombe National Park", pp. 73–121 in: Hamburg, DA, McCown, ER (eds.) The great apes. Menlo Park: Benjamin-Cummings, ISBN 0805336699.
  38. ^ a b de Waal, FBM. (1987) "Dynamic of social relationships", pp. 421–429 in: Smuts BB, Cheney DL, Seyfarth RM, Wrangham RW, Struhsaker TT (eds.) Primate societies, Chicago: University of Chicago Press, ISBN 0226767167.
  39. ^ a b c Nishida, T., M. Hiraiwa-Hasegawa. (1986) "Chimpanzees and Bonobos: Cooperative Relationships among Males". pp. 165–177 in B.B. Smuts, D.L. Cheyney, R.M. Seyfarth, R.W. Wrangham, T.T. Struhsaker (eds.) Primate Societies. Chicago and London: The University of Chicago Press, ISBN 0226767167.
  40. ^ a b c Pusey AE, Williams J, Goodall J (1997). "The influence of dominance rank on the reproductive success of female chimpanzees". Science 277 (5327): 828–831. doi:10.1126/science.277.5327.828. PMID 9242614. 
  41. ^ Stumpf, R. (2007) "Chimpanzees and bonobos: Diversity within and between species", pp. 321–344 in: Campbell CJ, Fuentes A, Mackinnon KC, Pancer M, Bearder SK (eds.) Primates in perspective. New York: Oxford University Press, ISBN 0195390431.
  42. ^ Watts DP (2001). "Reciprocity and interchange in the social relationships of wild male chimpanzees". Behaviour 139 (2): 343–370. doi:10.1163/156853902760102708. 
  43. ^ Walsh, Bryan (2009-02-18). "Why the Stamford Chimp Attacked". TIME. Retrieved 2009-06-06. 
  44. ^ a b Power, Margaret (December 1993). "Divergence population genetics of chimpanzees". American Anthropologist 95 (4): 1010–11. 
  45. ^ "Killer Instincts". The Economist. 2010-06-24. 
  46. ^ Wallis J. (2002) "Seasonal aspects of reproduction and sexual behavior in two chimpanzee populations: a comparison of Gombe (Tanzania) and Budongo (Uganda)", pp. 181–91 in: Boesch C, Hohmann G, Marchant LF (eds.) Behavioural diversity in chimpanzees and bonobos. Cambridge (England): Cambridge Univ Press, ISBN 0521006139.
  47. ^ a b Gagneux P, Boesch C, Woodruff DS (1999). "Female reproductive strategies, paternity and community structure in wild West African chimpanzees". Anim Beh 57: 19–32. doi:10.1006/anbe.1998.0972. 
  48. ^ a b c d Bard KA. (1995) "Parenting in primates", pp. 27–58 in: Bornstein MH, editor. Handbook of parenting. Volume 2, Biology and ecology of parenting. Mahwah (NJ): L Erlbaum Associates, ISBN 0805837795.
  49. ^ a b c Crockford C, Boesch C (2005). "Call combinations in wild chimpanzees". Behaviour 142 (4): 397–421. doi:10.1163/1568539054012047. 
  50. ^ a b c d Boesch C, Boesch H. (1993) "Diversity of tool use and tool-making in wild chimpanzees", pp. 158–87 in: Berthelet A, Chavaillon J (eds.) The use of tools by human and non-human primates. Oxford, England: Oxford Univ Press, ISBN 0198522630.
  51. ^ Mercader J, Barton H, Gillespie J, et al. (2007). "4,300-year-old chimpanzee sites and the origins of percussive stone technology". Proc. Natl. Acad. Sci. U.S.A. 104 (9): 3043–8. Bibcode:2007PNAS..104.3043M. doi:10.1073/pnas.0607909104. PMC 1805589. PMID 17360606. 
  52. ^ Goodall, J. (1986). The Chimpanzees of Gombe: Patterns of Behavior. The Belknap Press of Harvard University Press. pp. 535–539. ISBN 0-674-11649-6. 
  53. ^ Goodall, J. (1971). In the Shadow of Man. Houghton Mifflin. pp. 35–37. ISBN 0-395-33145-5. 
  54. ^ "Gombe Timeline". Jane Goodall Institute. Archived from the original on 2008-01-25. Retrieved 2009-03-05. 
  55. ^ Stanford CB, Gamaneza C, Nkurunungui JB, Goldsmith ML (2000). "Chimpanzees in Bwindi-Impenetrable National Park, Uganda, use different tools to obtain different types of honey". Primates 41 (3): 337–41. doi:10.1007/BF02557602. 
  56. ^ Sugiyama Y (1995). "Drinking tools of wild chimpanzees at Bossou". Am J Prim 37 (1): 263–9. doi:10.1002/ajp.1350370308. 
  57. ^ Fox, M. (2007-02-22). "Hunting chimps may change view of human evolution". Archived from the original on 2007-02-24. Retrieved 2007-02-22. 
  58. ^ Huffman MA, Kalunde MS (January 1993). "Tool-assisted predation on a squirrel by a female chimpanzee in the Mahale Mountains, Tanzania" (PDF). Primates 34 (1): 93–8. doi:10.1007/BF02381285. 
  59. ^ Cohen, Joel E. (Winter 1993). "Going Bananas". American Scholar. pp. 154–157. 
  60. ^ Goldman D, Giri PR, O'Brien SJ (1987). "A molecular phylogeny of the hominoid primates as indicated by two-dimensional protein electrophoresis". Proc. Natl. Acad. Sci. U.S.A. 84 (10): 3307–11. Bibcode:1987PNAS...84.3307G. doi:10.1073/pnas.84.10.3307. PMC 304858. PMID 3106965. 
  61. ^ Chimpanzee Sequencing and Analysis Consortium (September 2005). "Initial sequence of the chimpanzee genome and comparison with the human genome". Nature 437 (7055): 69–87. Bibcode:2005Natur.437...69.. doi:10.1038/nature04072. PMID 16136131. 
    Cheng Z, Ventura M, She X, et al. (September 2005). "A genome-wide comparison of recent chimpanzee and human segmental duplications". Nature 437 (7055): 88–93. Bibcode:2005Natur.437...88C. doi:10.1038/nature04000. PMID 16136132. 
  62. ^ Osborn, Claire (2006-04-27). "Texas man saves friend during fatal chimp attack". The Pulse Journal. Retrieved 2006-06-27. 
  63. ^ "Chimp attack kills cabbie and injures tourists". London: The Guardian. 2006-04-25. Retrieved 2006-06-27. 
  64. ^ "'Drunk and Disorderly' Chimps Attacking Ugandan Children". 2004-02-09. Retrieved 2006-06-27. 
  65. ^ Waterman, Tara (1999). "Ebola Cote D'Ivoire Outbreaks". Stanford University. Retrieved 2008-03-24. 
  66. ^ "Chimp attack doesn’t surprise experts". MSNBC. 2005-03-05. Retrieved 2006-06-27. 
  67. ^ "Birthday party turns bloody when chimps attack". USATODAY. 2005-03-04. Retrieved 2006-06-27. 
  68. ^ Argetsinger, Amy (2005-05-24). "The Animal Within". The Washington Post. Retrieved 2006-06-27. 
  69. ^ Sandoval, Edgar (2009-02-18). "911 tape captures chimpanzee owner's horror as 200-pound ape mauls friend". New York: Nydailynews.com. Retrieved 2009-06-06. 
  70. ^ Gallman, Stephanie (2009-02-18). "Chimp attack 911 call: 'He's ripping her apart'". CNN. Retrieved 2009-06-06. 
  71. ^ "Online Extra: Frodo @ National Geographic Magazine". Ngm.nationalgeographic.com. 2002-05-15. Retrieved 2009-06-06. 
  72. ^ a b Reeves JD, Doms RW (June 2002). "Human immunodeficiency virus type 2". J. Gen. Virol. 83 (Pt 6): 1253–65. doi:10.1099/vir.0.18253-0. PMID 12029140. 
  73. ^ Keele BF, Van Heuverswyn F, Li Y, et al. (July 2006). "Chimpanzee reservoirs of pandemic and nonpandemic HIV-1". Science 313 (5786): 523–6. Bibcode:2006Sci...313..523K. doi:10.1126/science.1126531. PMC 2442710. PMID 16728595. 
  74. ^ Gao F, Bailes E, Robertson DL, et al. (February 1999). "Origin of HIV-1 in the chimpanzee Pan troglodytes troglodytes". Nature 397 (6718): 436–41. Bibcode:1999Natur.397..436G. doi:10.1038/17130. PMID 9989410. 
General references
  • Johann Friedrich Blumenbach, De Generis Humani Varietate Nativa, 1775.
  • Tutin CEG, McGrew WC, Baldwin PJ (1983). "Social organization of savanna-dwelling chimpanzees, Pan troglodytes verus, at Mt. Assirik, Senegal". Primates 24 (2): 154–173. doi:10.1007/BF02381079. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!