Overview

Brief Summary

Biology

Bonobos are highly intelligent, social animals. They live in stable communities that may have up to 150 members, although these will usually split into smaller groups in order to forage or travel (2). Swellings on the rump advertise a female's receptivity to mating; there is no specific breeding season (5). A single offspring is born after around 8 months of gestation and will be cared for by its mother for almost 5 years (6). Bonobo society has some very marked differences to those of chimpanzees and this has fascinated researchers since their discovery. In both, males remain in their natal group whilst females disperse, but in contrast to the male-dominated chimpanzee society, females in bonobo groups develop strong relationships and males will often defer to them during feeding (2). The cooperative hunting and aggressive raids on neighbouring groups that male chimpanzees partake in have not been seen amongst bonobos and it may be that these differences are related to a more reliable and widely available food source (2). One of the other striking features of bonobo society is sex, which is commonly used for social communication in order to diffuse situations and create bonds (2). Males and females engage in these encounters with their own sex as well as the opposite sex (2). Bonobos spend virtually all of their time in the trees, foraging for fruit and sleeping in nests constructed in the branches; on the ground they travel by 'knuckle walking' (2). Fruit makes up a large part of the bonobo diet but they will also consume other plant materials and small vertebrates should the opportunity arise. This species appears to depend more on plant stems in its diet than chimpanzees do, perhaps again explaining the lack of aggression in bonobo groups (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Together with the chimpanzee (Pan troglodytes), the bonobo is man's closest living relative (2). Although a similar size to the better-known chimp, the bonobo is often referred to as the pygmy chimpanzee due to the more slender body shape of this species. Like chimpanzees, bonobos have longer forearms than legs, long fingers and mobile shoulder joints. The coat is black although it may turn grey with age and, in contrast to chimpanzees, the face is black, and the hair on the crown projects sideways, as opposed to backwards (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The bonobo has a discontinuous range in the low-lying central Congo Basin of Equatorial Africa, south of the Congo River. Their range extends from the Lualaba River in the East, to the Kasai/Sankuru Rivers in the South, and to the west as far as to the Bolobo village and around the Lake Tumba/Lac Ndombe area. Although the extent of their potential range is estimated at approximately 500,000 km² (Thompson et al. 2003), recent evidence of previously unsurveyed areas has detected bonobo presence throughout their historical area of distribution. Bonobos occur in small populations whose gene flow is determined by riverine barriers. Due to the bonobos’ dispersal patterns, the effective population size of males is smaller than that of females. Analyses of population genetics suggest that bonobo populations have a stable population history (Eriksson et al. 1999, 2004). Despite new surveys by various NGOs, the southern part of the Congo Basin, including the area south of the Kasai River, has not been surveyed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Bonobos (Pan paniscus) live in the forests located centrally in the Democratic Republic of the Congo (formerly Zaire). Bonobo habitat lies in the Congo Basin. This area is located south of an arc formed by the Congo River (formerly the Zaire River) and its headwater, the Lualaba River, and north of the Kasai Rver.

Biogeographic Regions: ethiopian (Native )

  • Kano, T. 1983. An ecological study of the pygmy chimpanzees (Pan paniscus) of Yalosidi, Republic of Zaire. International Journal of Primatology, 4/1: 1-31.
  • Kano, T. 1982. The social group of pygmy chimpanzees (Pan paniscus) of Wamba. Primates, 23/2: 171-188.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Zaire

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found only in the Democratic Republic of Congo in Central Africa; in an area bounded by the Congo River in the north, the Sankuru-Kasai in the south and west, and the Lualaba in the east (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Contrary to the implication of one of its common names, "pygmy chimpanzee," this species is not particularly diminutive when compared to common chimpanzees (Pan troglodytes). The "pygmy" modifier may instead refer to its location: it lives in an area inhabited by people often referred to as such.

Unlike its closest cousins (common chimpanzees), bonobos are not divided into subspecies. Bonobos are apes about two-thirds the size of humans, with dark hair covering their bodies. The hair is generally longer than in common chimpanzees, and is particularly noticeable on the cheeks, which are relatively hairless in P. troglodytes. The portions of body not covered with hair (i.e. mid-face, hands, feet) are darkly colored throughout life. This contrasts with common chimpanzees, which have lighter skin, particularly during the younger years.

Bonobos are primarily knuckle-walkers, although at times they walk bipedally and do so more frequently than P. troglodytes. Bonobos have longer extremities, particularly hind legs, as compared to common chimpanzees. Although sexual dimorphism exists with males around 30% heavier (37 to 61 kg, 45 kg average) than females (27 to 38 kg, 33.2 kg average), bonobos are less sexually dimorphic than many primates, and skeletons are nearly the same size. Average height is 119 cm for males and 111 cm for femals. Average cranial capacity is 350 cubic centimeters.

Range mass: 27 to 61 kg.

Average mass: 39 kg.

Range length: 104 to 124 cm.

Average length: 115 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Boesch, C. 2002. Behavioural diversity in Pan . Pp. 1-8 in C Boesch, G Hohmann, M Linda, eds. Behavioural Diversity in Chimpanzees and Bonobos. Cambridge, UK: The Press Cyndicate of the University of Cambridge.
  • Jungers, W., R. Susman. 1984. Body size and skeletal allometry in African apes. Pp. 131-177 in R Susman, ed. The Pygmy Chimpanzee: Evolutionary Biology and Behavior. New York, NY: Plenum Press.
  • Zihlman, A. 1984. Body build and tissue composition in Pan paniscus and Pan troglodytes, with comparisons to other hominoids. Pp. 179-200 in R Susman, ed. The Pygmy Chimpanzee: Evolutionary Biology and Behavior. New York, NY: Plenum Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The entire range of bonobo distribution is characterized by moderate variations in elevation (300 to 700 m). They inhabit a mosaic of primary and secondary forests, as well as seasonally inundated swamp forests, with a humid, stable climate. A single bonobo community (usually 30 to 80 individuals) occupies a home-range of 20 to 60 km² of forest, with extensive overlap between community ranges resulting in small core areas. Over 50% of their diet is comprised of fruits and seeds, with leaves, flowers, and piths, some of which provide considerable amounts of protein and other nutrients (Hohmann et al. 2006). Animal proteins deriving from both vertebrate (e.g., duikers) and invertebrate prey (e.g., termites, caterpillars) are also ingested. Nests are built in trees at heights between 5 and 50 m (Fruth 1995). Both habitat and nesting preferences are pronounced, and ground nests have been reported (Reinartz et al. 2006).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Within the Congo Basin, bonobos inhabit several vegetation types. The area generally is classified as tropical rainforest; however, local agriculture and areas reverted to forest from agriculture (“young” and “aged secondary forest”) are intermingled. Species composition, height, and density of trees are different in each, yet all are utilized by bonobos. In addition to the forested areas, swamp forests opening into marsh-grassland areas occur, which are also utilized. Foraging occurs in each type of habitat, while sleeping occurs in forested areas. Some bonobo populations may have a preference to sleep in relatively small (15 to 30 m tall) trees, particularly those found in secondary growth forests.

Range elevation: 299 to 479 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Wetlands: marsh

  • Fruth, B., G. Hohmann. 1993. Ecological and behavioral aspects of nest building in wild bonobos (Pan paniscus). Ethology, 94: 113-126.
  • Uehara, S. 1988. Grouping patterns of wild pygmy chimpanzees (Pan pansicus) observed at a marsh grassland amidst the tropical rain forest of Yalosidi, Republic of Zaire. Primates, 29/1: 41-52.
  • Uehara, S. 1990. Utilization patterns of a marsh grassland within the tropical rain forest by the bonobos (Pan paniscus) of Yalosidi, Republic of Zaire. Primates, 31/3: 311-322.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits humid primary and secondary lowland rainforest at elevations below 1,500 metres (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Fruit comprises the largest portion of the diet of P. paniscus, although bonobos incorporate a wide variety of other food items into their diet. Plant parts consumed include fruit, nuts, stems, shoots, pith, leaves, roots, tubers and flowers. Mushrooms are also occasionally consumed. Invertebrates form a small proportion of the diet and include termites, grubs, and worms. On rare occasions, bonobos have been known to eat meat. They have been directly observed eating flying squirrels (Anomalurus sp.), duiker (Cephalophus dorsalis and Cephalophus nigrifrons), and bats (Eidolon sp.).

Animal Foods: mammals; eggs; insects; terrestrial worms

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Other Foods: fungus

Primary Diet: herbivore (Frugivore )

  • Badrian, N., R. Malenky. 1984. Feeding ecology of Pan paniscus in the Lomako Forest, Zaire. Pp. 275-299 in R Susman, ed. The Pygmy Chimpanzee: Evolutionary Biology and Behavior. New York, NY: Plenum Press.
  • Kano, T., M. Mulavwa. 1984. Feeding ecology of the pygmy chimpanzees (Pan paniscus) of Wamba. Pp. 233-274 in R Susman, ed. The Pygmy Chimpanzee: Evolutionary Biology and Behavior. New York, NY: Plenum Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The quantity of fruit consumed by bonobos suggests that they may play a role in dispersal of the species eaten.

Ecosystem Impact: disperses seeds

Species Used as Host:

  • non known

Mutualist Species:

  • none known

Commensal/Parasitic Species:

  • none known

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The only verified predators of bonobos are humans. Although the hunting of bonobos is illegal, poaching is still common. It has been speculated that leopards and pythons, known to prey on common chimpanzees, may also feed on bonobos.

Known Predators:

  • Van Krunkelsven, E. 2001. Density estimation of bonobos (Pan paniscus) in Salonga National Park, Congo. Biological Conservation, 99: 387-391.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Bonobos communicate in a variety of ways. Females have a scream, but males bark, grunt, and pant-hoot. A bark may indicate alarm, whereas other vocalizations may indicate aggression, excitement, satisfaction, etc. The separate types of calls are used in multiple contexts, and cannot be thought of as "words".

In addition to this vocal communication, tactile communication is important. Social rank is communicated by GG rubbing, mounting, or rump contact. (See behavior section.) Other forms of tactile communication are seen between mothers and their offspring, and between rivals.

Visual communication also occurs. Bonobos often "peer" at another individual. This behavior indicates interest in the activity of the "peered at" individual. Peering may occur when oneother bonobo has a food item that is wanted, or it may be included in the courtship behavior of a male.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Some researchers have suggested that one difference between humans and chimpanzees is that only humans voluntarily share their food with others. Hare and Kwetuenda (2010) experimentally investigated voluntary food sharing in unrelated Bonobos. In their experiments one individual (the "subject") was given the choice of either monopolizing food or actively sharing it with another individual (the "recipient") by releasing the other individual from an adjoining room. This experimental design eliminated relatedness and harassment as motivating factors for sharing. The researchers found that subjects showed a significant preference to open the potential recipient’s door rather than another door to an empty room. Subjects released recipients to co-feed for the majority of the total feeding time during each trial. Compared to control trials in which subjects were presented with one empty room and another room with additional food but no other Bonobo, subjects opened the door to a room with a potential food recipient more quickly than they opened the door to a room with additional food. In a limited set of additional control trials, two test subjects more often released a recipient into a room with food rather than into an empty room, suggesting the possibility of striking altruism. Results from this set of experiments suggest that our own species’ propensity for voluntary food sharing may not be unique among the apes. (Hare and Kwetuenda 2010)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Limited information exists on bonobo longevity, and there has been no ongoing study that lasted longer than the expected bonobo lifespan. The longest semi-continuous study of bonobos began at Wamba in 1976. At that time, the age of each individual was estimated, and from extrapolation, a female that died in 1993 was in the 45 to 50 year age range when she died. This would make the lifespan of these animals comparable to that of common chimpanzees.

Range lifespan

Status: wild:
50 (high) years.

Average lifespan

Sex: male

Status: captivity:
35.0 years.

Average lifespan

Sex: female

Status: captivity:
48.0 years.

Average lifespan

Status: wild:
20.0 years.

  • Furuichi, T. 1989. Social interactions and the life history of female Pan paniscus in Wamba, Zaire. International Journal of Primatology, 10/3: 173-197.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 55 years (captivity) Observations: Longevity has not been studied in detail in these animals. One study in the wild estimated that one female could have died at 45-50 years of age (Furuichi et al. 1998). One wild born female has lived 50.1 years at Antwerp Zoo and could be up to 55 years old (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Bonobos are polygynandrous. Females may be approached by and copulate with, any male in the group except their sons. However, the mating system may be confused by the use of sexual activity in these animals as part of social bond formation.

Mating System: polygynandrous (promiscuous)

Basic life history traits of bonobos are under-researched. Some of the seminal studies of this species have noted that “bonobos have not yet been studied long enough to provide data on age at sexual maturity or birth interval” (Nishida and Hiraiwa-Hasegawa, 1987), the most frequently researched “Wamba and Lomako study populations lack long-term demographic data” (Thompson-Handler et al., 1984), and “information on the demography of wild bonobos is very limited compared to that for chimpanzees” (Furuichi et al., 1998).

Female bonobos undergo estrus, marked by distinctive swelling of the perineal tissue lasting 10 to 20 days. Matings are concentrated during the time of maximal swelling. Breeding occurs throughout the year. Postpartum amenorrhea lasts less than one year in bonobos. A female may resume external signs of estrus (i.e. swelling) within a year of giving birth. At this point, copulation may resume, although these copulations do not lead to conception, indicating that the female is probably not fertile. During this period, she continues to lactate until her offspring is weaned at around 4 years. The average interbirth interval is 4.6 years (4.8 if one only includes live births). Therefore, lactation may suppress ovulation, but not the outward signs of estrus. As no study has lasted longer than a bonobo lifespan, total number of offspring per female is unknown. However, at Wamba, many adult females had four offspring during the 20 year study length.

Adult female bonobos have an estrus period that is marked externally by physical changes in their genitalia. During this time, males of the group approache the female, displaying their erect penises. Females are generally receptive, and will move toward a male to allow copulation. There is no clear pattern of mate choice: females are courted by many males of the group during estrus, with the exception of their sons. Because of this, paternity is generally unknown to both partners.

Breeding interval: Breeding occurs nearly all the time in this species, however, a female may produce one offspring approximately every 5 years.

Breeding season: Bonobos have no marked breeding season.

Average number of offspring: 1.

Average gestation period: 240 days.

Average weaning age: 48 months.

Range time to independence: 7 to 9 years.

Range age at sexual or reproductive maturity (female): 13 to 15 years.

Range age at sexual or reproductive maturity (male): 13 to 15 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 1331 g.

Average gestation period: 232 days.

Average number of offspring: 1.

Information is limited on parental investment. However, bonobos are highly social mammals and live around 15 years before achieving full adult status. During this time, the mother provides most of the parenting, although the males may contribute indirectly (i.e. in alerting the group of danger, sharing food, and possibly helping to protect young).

Bonobo babies are born relatively helpless. They are dependent on mothers’ milk and cling to their mother for several months. Parental care is provided by the mother, as paternity is generally unclear. Weaning is a gradual process, and is usually commenced by the time the offspring is 4 years of age. Throughout the weaning process, mothers generally have their offspring feed by their side, allowing them to observe the feeding process and food choice, rather than providing them with food directly. Weaning may be enforced by a mother’s refusal to allow a juvenile into her nest, thereby encouraging it to build a nest of its own.

As adults, male bonobos typically remain in their natal social group, so they have contact with their mothers throughout her remaining years. Female offspring leave their natal group during late adolescence, so they do not maintain contact with their mothers in adulthood.

Parental Investment: altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning; inherits maternal/paternal territory; maternal position in the dominance hierarchy affects status of young

  • Furuichi, T. 1987. Sexual swelling, receptivity, and grouping of wild pygmy chimpanzee females at Wamba, Zaire. Primates, 23/3: 309-318.
  • Dahl, J. 1986. Cyclic perineal swelling during the intermenstrual intervals of captive female pygmy chimpanzees (Pan paniscus). Journal of Human Evolution, 15: 369-385.
  • Fruth, B., G. Hohmann. 1993. Ecological and behavioral aspects of nest building in wild bonobos (Pan paniscus). Ethology, 94: 113-126.
  • Furuichi, T., G. Idani, H. Ihobe, S. Kuroda, K. Kitamura, A. Mori, T. Enomoto, N. Okayasu, C. Hashimoto, T. Kano. 1998. Population dynamics of wild bonobos (Pan paniscus) at Wamba. International Journal of Primatology, 19/6: 1029-1043.
  • Horn, A. 1980. Some observations on the ecology of the bonobo chimpanzee (Pan paniscus, Schwarz 1929) Near Lake Tumba, Zaire. Folia primatologica, 34: 145-169.
  • Savage-Rumbaugh, E., B. Wilkerson. 1978. Socio-sexual behavior in Pan paniscus and Pan troglodytes: A comparative study. Journal of Human Evolution, 7: 327-344.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pan paniscus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0526-06|NC_001644|Pan paniscus| GACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTACTATTCGGCACATGAGCTGGAGTTCTGGGCACAGCCCTA---AGTCTCCTTATTCGAGCTGAATTAGGCCAACCAGGCAACCTTCTAGGTAAC---GACCACATCTATAATGTCATTGTCACAGCCCATGCGTTCGTAATAATCTTTTTCATAGTAATACCTATCATAATCGGAGGCTTCGGCAACTGGCTAGTTCCCTTGATA---ATTGGTGCCCCCGACATGGCATTCCCCCGTATAAACAACATAAGCTTCTGACTCCTACCCCCTTCTCTCCTACTTCTACTTGCATCTGCCATAGTAGAAGCCGGCGCCGGAACAGGTTGGACAGTCTACCCTCCCTTAGCAGGAAACTATTCGCATCCTGGAGCCTCCGTAGACCTA---ACCATCTTCTCCTTGCACCTGGCAGGCGTCTCCTCTATCCTAGGAGCCATTAACTTCATCACAACAATCATTAATATAAAACCTCCTGCCATAACCCAATACCAAACACCCCTTTTCGTCTGATCCGTCCTAATTACAGCAGTCTTACTTCTCCTATCCCTCCCAGTCCTAGCTGCT---GGCATCACCATACTATTAACAGATCGTAACCTCAACACTACCTTCTTCGACCCAGCTGGGGGAGGAGACCCTATTCTATATCAACACTTATTCTGATTTTTTGGCCACCCCGAAGTTTACATTCTTATCCTACCAGGCTTCGGAATAATTTCCCACATTGTAACTTATTACTCAGGAAAAAAA---GAACCATTCGGATACATAGGCATGGTTTGAGCTATAATATCAATTGGTTTCCTAGGGTTTATTGTGTGAGCACACCATATATTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pan paniscus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Species: 15
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A4cd

Version
3.1

Year Assessed
2008

Assessor/s
Fruth, B., Benishay, J.M., Bila-Isia, I., Coxe, S., Dupain, J., Furuichi, T., Hart, J., Hart, T., Hashimoto, C., Hohmann, G., Hurley, M., Ilambu, O., Mulavwa, M., Ndunda, M., Omasombo, V., Reinartz, G., Scherlis, J., Steel, L. & Thompson, J.

Reviewer/s
Mittermeier, R.A. & Williamson, E.A. (Primate Red List Authority)

Justification
Due to high levels of exploitation and loss of habitat and habitat quality due to expanding human activities, this species is estimated to have experienced a significant population reduction in the past 20 to 30 years (one generation is estimated to be 25 years; Myers Thompson 1997, Furuichi and Hashimoto 2003, T. Furuichi pers. comm. 2007) and it is thought that this reduction will continue for the next 45 to 55 years. The maximum population decline over a three-generation (i.e., 75 year) period from the 1970s to 2045 is thought to exceed 50%, hence qualifying this taxon for Endangered under criterion A4. The causes of the reduction, although largely understood, have certainly not ceased and are not easily reversible. The suspected future survival of bonobos will be determined by the rapidly increasing human population density in the region and the high degree of political instability in the range states.

History
  • 2007
    Endangered
  • 2000
    Endangered
  • 1996
    Endangered
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1988
    Vulnerable
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Bonobos are an endangered species according to both IUCN and US Federal Endangered Species lists. The IUCN criteria project a 50% or greater reduction in their numbers within three generations, due to both exploitation and habitat destruction. Bonobos face “a very high risk of extinction in the wild in the near future” according to the IUCN Red List criteria. Civil war and its aftermath have hampered conservation efforts. Population estimates vary widely as conflict has limited the ability of researchers to work in the region. Estimates range from 5,000 to 17,000 individuals left.

US Federal List: endangered

CITES: appendix i; appendix ii

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 10/19/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Pan paniscus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN A2cd) on the IUCN Red List 2002 (1), and listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
From studies based on nest counts along standardized line transects, population densities have been calculated for a number of areas (see Table 1).

Follow the link below for Table 1: population densities for Pan paniscus.

There are no substantive data concerning total numbers, although speculative estimates give numbers for a total population size between 29,500 (Myers Thompson 1997) and 50,000 (Dupain and Van Elsacker 2001). Recent surveys indicate that these numbers may still be underestimates. In any case, any number indicating total population size should be considered with the highest caution.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The collective threats impacting the wild bonobo population today include: commercial poaching (for bushmeat, pets or medicinal purpose); residue of civil warfare (military sanctioned hunting, availability of modern weaponry and ammunition); human population changes (growth and movement); habitat alteration (commercial logging and agriculture, traditional slash-and-burn agriculture, increase of fallow land); and lack of education (insufficient awareness among certain urban and rural populations, and national politicians).

Commercial poaching has to be considered the most prominent threat. In some areas local taboos against bonobo hunting still exist, in others they are disintegrating due to changing cultural values associated with transient and immigrant human populations. Although commercial hunting is targeted at large-bodied ungulates and monkeys, the growing predominance of bushmeat commerce as an income-generating activity has led to increases in the number of commercial bushmeat hunters. These hunters, aided by military and local administration, are active in all areas, including those with legally protected status such as Salonga National Park. The importance of Salonga National Park as a significant reservoir of bonobos will be rapidly compromised if current hunting trends continue. Between 2003 and 2006, Hart et al. (2007) recorded evidence of hunting across the park in 51% of survey grids. Hunting pressure was considered to be high in the north and east of the park, and bonobo mortalities as a direct consequence of hunting were recorded. Bonobos are slow-breeding and thus particularly susceptible to loss caused directly by poaching or indirectly by snaring.

Infectious diseases are yet to be quantified but are undoubtedly an important threat to wild bonobo populations, and of particular concern in areas where bonobos live side-by-side with humans. The risk of transmission increases with increasing human population density as well as increasing proximity with wildlife.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Bonobos are not as widespread as their chimpanzee cousins and are threatened by loss of habitat as large areas of rainforest are being cleared to make way for agriculture, for timber extraction and for development (1). Although traditionally not targeted by hunters as a result of local taboos (9), this species is today at risk from the bushmeat trade; the demand for which has recently increased, threatening much of Africa's wildlife (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Until recently, the only protected area harbouring bonobos was the 33,346 km² Salonga National Park (ICCN 2006). Although legally protected, law enforcement in the DRC is negligible, and conservation efforts are hampered by corruption, isolation as well as persistent political and economic instability. The only active and permanent presence on the ground is assured by NGOs and research projects. NGOs are working to strengthen ICCN’s limited capacity in Salonga National Park. Elsewhere, NGOs are using participatory approaches to guide local communities towards the sustainable use of natural resources for long-term conservation.

In the context of the Congo Basin (Congo Basin Forest Partnership (CBFP) 2005), an international project for the protection of forests, DRC possesses three landscapes important for bonobo conservation: Lac Tele-Lac Tumba Landscape (Congo and DRC); Maringa-Lopori-Wamba Landscape (DRC); and Salonga-Lukenie-Sankuru Landscape (DRC).

Within these landscapes are areas with established protection status such as Salonga National Park (since 1970) and Luo Scientific Reserve (since 1990). However, significant portions of bonobo habitat such as the Lomami-Lualaba and the Lomela-Sankuru areas are not included in the landscapes defined by CBFP.

Due to the combined efforts of the ICCN (DRC’s national conservation authority) and international NGOs, two additional areas obtained official protected status in 2006: Faunal Reserve of Lomako-Yokokala (RFLY) (Maringa-Lopori-Wamba Landscape), and Tumba-Lediima Natural Reserve (RTL) (Lac Tele-Lac Tumba Landscape). Others are under consideration and protected only by local commitments: Yasa-Bososandja wildlife sanctuary (1998) (Myers Thompson 2001), and Kokolopori (reserve to be gazetted in 2007) (BCI 2007).

Although these areas still harbour sizeable numbers of bonobos, the threats cited above put all populations at risk irrespective of the conservation status of the area. Conservation education programmes are essential to help curb poaching and illegal trade, not only in areas adjacent to wild populations but also in urban centres such as Kinshasa or Kisangani, where the demand for bushmeat and pets is generated. Lola Ya Bonobo, a sanctuary for confiscated bonobos in Kinshasa, welcomes 15,000 visitors per annum, half of which are school children, who can influence local attitudes (ABC 2006).

In sum, for effective protection of bonobos, commercial hunting must be halted, intensification rather than expansion of local agriculture must be supported, and local industries must be actively persuaded to support rather than subvert conservation. Additional surveys are needed to better determine the species’ overall distribution and abundance.

Despite the fact that bonobos breed well in captivity, and captive propagation programmes exist in North American and European zoos, only conservation measures in situ can be considered useful attempts to contribute to the species’ survival in the wild.

It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Bonobos are protected by law and international trade is prohibited by their listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (3). Ex-situ conservation measures cannot be relied upon as a safeguard for this species, as presently no self-sustaining captive population exists (2). The precise impact of the bushmeat trade is currently being investigated by the Bushmeat Working Group, part of the Convention on International Trade in Endangered Species (CITES) (7). The United Nations Environmental Program (UNEP) has recently recognised the urgent need to protect our closest relatives and has established a Great Ape Survival Project (GRASP) aimed at identifying the conservation initiatives required to secure the future of the apes and obtaining political support and funding to allow these to be achieved (8). The Bonobo Conservation Initiative is working in the Democratic Republic of Congo to raise awareness of the plight of this species (9). The main problem in terms of bonobo conservation is that they are only found in a single protected area (Salonga National Park), and even there they are intensively hunted both for their meat as well as for the making of charms (3). Concerted conservation efforts will therefore be required to secure the future of this fascinating ape.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Bonobos may eat sugarcane that is being grown for profit. However, direct references to this being a problem for humans have not been encountered in the literature.

Bonobos, similar to common chimpanzees, carry many of the same diseases that can afflict humans, such as polio.

Negative Impacts: injures humans (carries human disease); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Bonobos and their sister species, common chimpanzees, are the closest relatives to Homo sapiens. They are an invaluable source of information in studying human origins and diseases.

Bonobos are endearing to humans as 'charasmatic megafauna' and may be useful in encouraging conservation for habitat preservation.

Bonobos continue to be a source of bush meat for human consumption, and although hunting bonobos has been legally outlawed, poaching continues.

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bonobo

The bonobo (play /bəˈnb/ or /ˈbɒnəb/), Pan paniscus, previously called the pygmy chimpanzee and less often, the dwarf or gracile chimpanzee,[3] is a great ape and one of the two species making up the genus Pan; the other is Pan troglodytes, or the common chimpanzee. Although the name "chimpanzee" is sometimes used to refer to both species together, it is usually understood as referring to the common chimpanzee, while Pan paniscus is usually referred to as the bonobo. It is distinguished by relatively long legs, pink lips, dark face and tail-tuft through adulthood, and parted long hair on its head. The bonobo is found in a 500,000 km2 (190,000 sq mi) area of the Congo Basin in the Democratic Republic of the Congo, Central Africa. The species is omnivorous and inhabits primary and secondary forests, including seasonally inundated swamp forests.

The bonobo is popularly known for its high levels of sexual behavior. Sex functions in conflict appeasement, affection, social status, excitement, and stress reduction. It occurs in virtually all partner combinations and in a variety of positions. This is a factor in the lower levels of aggression seen in the bonobo when compared to the common chimpanzee and other apes. Bonobos are perceived to be matriarchal; females tend to collectively dominate males by forming alliances and use sexuality to control males. A male's rank in the social hierarchy is often determined by his mother's rank.

Along with the common chimpanzee, the bonobo is the closest extant relative to humans. Because the two species are not proficient swimmers, the formation of the Congo River 1.5–2 million years ago possibly led to the speciation of the bonobo. They live south of the river, and thereby were separated from the ancestors of the common chimpanzee, which live north of the river. There are no concrete data on population numbers, but the estimate is between 29,500 and 50,000 individuals. The species is listed as Endangered on the IUCN Red List and is threatened by habitat destruction and human population growth and movement, though commercial poaching is the most prominent threat. It typically lives 40 years in captivity, though its lifespan in the wild is unknown.

Contents

Etymology

Despite the alternative common name "pygmy chimpanzee", the bonobo is not especially diminutive when compared to the common chimpanzee. "Pygmy" may instead refer to the pygmy peoples who live in the same area.[4] The name "bonobo" first appeared in 1954, when Tratz and Heck proposed it as a new and separate generic term for pygmy chimpanzees. The name is thought to be a misspelling on a shipping crate from the town of Bolobo on the Congo River, which was associated with the collection of chimps in the 1920s.[5][6] The term has also been reported as being a word for "ancestor" in an extinct Bantu language.[6]

Evolutionary history

Fossils

Chimpanzee fossils were not described until 2005. Existing chimpanzee populations in West and Central Africa do not overlap with the major human fossil sites in East Africa. However, chimpanzee fossils have now been reported from Kenya. This would indicate that both humans and members of the Pan clade were present in the East African Rift Valley during the Middle Pleistocene.[7] According to A. Zihlman bonobo body proportions closely resemble those of Australopithecus.[8]

Taxonomy and phylogeny

German anatomist Ernst Schwarz is credited with having discovered the bonobo in 1928, based on his analysis of a skull in the Tervuren museum in Belgium that previously had been thought to have belonged to a juvenile chimpanzee. Schwarz published his findings in 1929.[9][10] In 1933, American anatomist Harold Coolidge offered a more detailed description of the bonobo, and elevated it to species status.[10][11] The American psychologist and primatologist Robert Yerkes was also one of the first scientists to notice major differences between bonobos and chimpanzees.[12] These were first discussed in detail in a study by Eduard Paul Tratz and Heinz Heck published in the early 1950s.[13]

While no official publication on the bonobo genome is publicly available, an initial analysis by the National Human Genome Research Institute confirmed that the bonobo genome is about 0.4% divergent from the chimpanzee genome.[14] In addition, Svante Pääbo's group at the Max Planck Institute for Evolutionary Anthropology is currently sequencing the genome of a female bonobo from the Leipzig zoo.[14] Initial genetic studies characterised the DNA of chimpanzees (common chimpanzee and bonobo, collectively) as being as much as 98% (99.4% in one study) identical to that of Homo sapiens.[15] Later studies showed that chimpanzees are more closely related to humans than to gorillas.[16] The most recent genetic analyses (published in 2006) of chimpanzee and human genetic similarity come from whole genome comparisons and have shown that the differences between the two species are more complex, both in extent and character, than the historical 98% figure suggests.[17]

In the seminal Nature paper reporting on initial genome comparisons, researchers identified 35 million single-nucleotide changes, five million insertion or deletion events, and a number of chromosomal rearrangements which constituted the genetic differences between chimpanzees and humans, covering 98% of the same genes.[18] While many of these analyses have been performed on the common chimpanzee rather than the bonobo, the differences between the two chimpanzee species are unlikely to be substantial enough to affect the Pan-Homo comparative data significantly.

There still is controversy, however. Scientists such as Jared Diamond in The Third Chimpanzee, and Morris Goodman[19] of Wayne State University in Detroit that the bonobo and common chimpanzee are so closely related to humans that their genus name also should be classified with the human genus Homo: Homo paniscus, Homo sylvestris, or Homo arboreus. An alternative philosophy suggests that the term Homo sapiens is the misnomer rather, and that humans should be reclassified as Pan sapiens, though this would violate the Principle of Priority, as Homo was named before Pan (1758 for the former, 1816 for the latter). In either case, a name change of the genus would have implications on the taxonomy of other species closely related to humans, including Australopithecus. The current line between Homo and non-Homo species is drawn about 2.5 million years ago, and chimpanzee and human ancestry converges only about 7 million years ago, nearly three times longer ago.

Recent DNA evidence suggests the bonobo and common chimpanzee species effectively separated from each other fewer than one million years ago.[20][21] The chimpanzee line split from the last common ancestor shared with humans approximately six to seven million years ago. Because no species other than Homo sapiens has survived from the human line of that branching, both Pan species are the closest living relatives of humans and cladistically are equally close to humans.

Physical description

Female bonobo

It is sometimes considered to be more gracile than the common chimpanzee, and females are somewhat smaller than males. Its head is smaller than that of the common chimpanzee with less prominent brow ridges above the eyes. It has a black face with pink lips, small ears, wide nostrils, and long hair on its head that forms a part. Females have slightly more prominent breasts, in contrast to the flat breasts of other female apes, although not so prominent as those of humans. The bonobo also has a slim upper body, narrow shoulders, thin neck, and long legs when compared to the common chimpanzee.

Bonobos are both terrestrial and arboreal. Most ground locomotion is characterized by quadrupedal knuckle walking. Bipedal walking has been recorded as less than 1% of terrestrial locomotion in the wild, a figure that decreased with habituation,[22] while in captivity there is a wide variation. Bipedal walking in captivity, as a percentage of bipedal plus quadrupedal locomotion bouts, has been observed from 3.9% for spontaneous bouts to nearly 19% when abundant food is provided.[23] These physical characteristics and its posture give the bonobo an appearance more closely resembling that of humans than that of the common chimpanzee. The bonobo also has highly individuated facial features, as humans do, so that one individual may look significantly different from another, a characteristic adapted for visual facial recognition in social interaction.

Multivariate analysis has shown bonobos are more neotenized than the common chimpanzee, taking into account such features as the proportionately long torso length of the bonobo.[24] This conclusion has been challenged by other researchers.[25]

Behaviour

Primatologist Frans de Waal states bonobos are capable of altruism, compassion, empathy, kindness, patience, and sensitivity.[3] How peaceful bonobos are has been disputed by some, however.[26]

Social behavior

Bonobo fishing for termites

Most studies indicate that females have a higher social status in bonobo society. Aggressive encounters between males and females are rare, and males are tolerant of infants and juveniles. A male's status is derived from the status of his mother.[27] The mother–son bond often stays strong and continues throughout life. While social hierarchies do exist, rank plays a less prominent role than in other primate societies.

The limited research on bonobos in the wild was taken to indicate that these matriarchal behaviors may be exaggerated by captivity, as well as by food provisioning by researchers in the field.[26] This view has recently been challenged, however, by Duke University's Vanessa Woods;[28] Woods noted in a radio interview[29] that she had observed bonobos in a spacious forested sanctuary in the DRC exhibiting the same sort of hypersexuality under these more naturalistic conditions; and, while she acknowledges a hierarchy among males, including an alpha male, these males are less dominant than the dominant female.

Bonobo party size tends to vary because the groups exhibit a fission–fusion pattern. A community of approximately 100 will split into small groups during the day while looking for food, and then will come back together to sleep. They sleep in nests that they construct in trees.

Sexual social behavior

Sexual intercourse plays a major role in bonobo society observed in captivity, being used as what some scientists perceive as a greeting, a means of forming social bonds, a means of conflict resolution, and postconflict reconciliation.[30] Bonobos are the only nonhuman animal to have been observed engaging in all of the following sexual activities: face-to-face genital sex (although a pair of western gorillas has been photographed performing face-to-face genital sex,[31]) tongue kissing, and oral sex.[32] In scientific literature, the female–female behavior of touching genitals together is often referred to as GG rubbing or genital–genital rubbing. The sexual activity happens within the immediate community and sometimes outside of it. Bonobos do not form permanent monogamous sexual relationships with individual partners. They also do not seem to discriminate in their sexual behavior by sex or age, with the possible exception of abstaining from sexual intercourse between mothers and their adult sons. When bonobos come upon a new food source or feeding ground, the increased excitement will usually lead to communal sexual activity, presumably decreasing tension and encouraging peaceful feeding.[33]

Group of bonobos

Bonobo males occasionally engage in various forms of male–male genital behavior.[33][34] In one form, two males hang from a tree limb face-to-face while "penis fencing".[33][35] This also may occur when two males rub their penises together while in face-to-face position. Another form of genital interaction ("rump rubbing") occurs to express reconciliation between two males after a conflict, when they stand back-to-back and rub their scrotal sacs together. Takayoshi Kano observed similar practices among bonobos in the natural habitat.

Bonobo females also engage in female–female genital behavior, possibly to bond socially with each other, thus forming a female nucleus of bonobo society. The bonding among females enables them to dominate bonobo society. Although male bonobos are individually stronger, they cannot stand alone against a united group of females.[33] Adolescent females often leave their native community to join another community. Sexual bonding with other females establishes these new females as members of the group. This migration mixes the bonobo gene pools, providing genetic diversity.

Bonobo reproductive rates are no higher than those of the common chimpanzee.[33] During oestrus, females undergo a swelling of the perineal tissue lasting 10 to 20 days. Most matings occur during the maximum swelling. The gestation period is on average 240 days. Postpartum amenorrhea (absence of menstruation) lasts less than one year and a female may resume external signs of oestrus within a year of giving birth, though the female is probably not fertile at this point. Female bonobos carry and nurse their young for four years and can give birth on average every 4.6 years.[4] Compared to common chimpanzees, bonobo females resume the genital swelling cycle much sooner after giving birth, enabling them to rejoin the sexual activities of their society. Also, bonobo females which are sterile or too young to reproduce still engage in sexual activity. The lifespan of a bonobo in captivity is about 40 years.[36] The lifespan in the wild is unknown.

Diet

This primate is mainly frugivorous, but supplements its diet with leaves and meat from small vertebrates, such as anomalures, flying squirrels and duikers,[37] and invertebrates.[38] In some instances, bonobos have been shown to consume lower-order primates.[39][40] Some claim bonobos have also been known to practise cannibalism in captivity, a claim disputed by others.[26][41] However, at least one confirmed report of cannibalism in the wild was reported by researchers Gottfried Hohmann and Andrew Fowler.[42]

Peacefulness

Observations in the wild indicate that the males among the related common chimpanzee communities are extraordinarily hostile to males from outside the community. Parties of males 'patrol' for the unfortunate neighbouring males that might be travelling alone, and attack those single males, often killing them.[43] This does not appear to be the behaviour of bonobo males or females in their own communities, where they seem to prefer sexual contact over violent confrontation with outsiders. In fact, the Japanese scientists who have spent the most time working with wild bonobos describe the species as extraordinarily peaceful, and De Waal has documented how bonobos may often resolve conflicts with sexual contact (hence the "make love – not war" characterization for the species). Between groups, social mingling may occur, in which members of different communities have sex and groom each other, behaviour which is unheard of among common chimpanzees. Conflict is still possible between rival groups of bonobos, but no official scientific reports of it exist. The ranges of bonobos and chimpanzees are separated by the Congo River, with bonobos living to the south of it, and chimpanzees to the north.[44][45] It has been hypothesised that bonobos are able to live a more peaceful lifestyle in part because of an abundance of nutritious vegetation in their natural habitat, allowing them to travel and forage in large parties.[46]

The popular image of the bonobo as a peaceful ape does not always apply to captive populations. Accounts exist of bonobos confined in zoos mutilating one another and engaging in bullying. These incidents may be due to the practice in zoos of separating mothers and sons, which is contrary to their social organization in the wild. Bonobo society is dominated by females, and severing the lifelong alliance between mothers and their male offspring may make them vulnerable to female aggression. De Waal has warned of the danger of romanticizing bonobos: "All animals are competitive by nature and cooperative only under specific circumstances" and that "when first writing about their behaviour, I spoke of 'sex for peace' precisely because bonobos had plenty of conflicts. There would obviously be no need for peacemaking if they lived in perfect harmony." There are no eyewitness accounts of lethal aggression among bonobos, neither in captivity nor in the wild.

Hohmann and Surbeck published in 2008 that bonobos sometimes do hunt monkey species. Five incidents were observed in a group of bonobos in Salonga National Park, which seemed to reflect deliberate cooperative hunting. On three occasions, the hunt was successful and infant monkeys were captured.

Similarity to humans

Bonobos are capable of passing the mirror-recognition test for self-awareness.[47] They communicate primarily through vocal means, although the meanings of their vocalizations are not currently known. However, most humans do understand their facial expressions[15] and some of their natural hand gestures, such as their invitation to play. Two bonobos at the Great Ape Trust, Kanzi and Panbanisha, have been taught how to communicate using a keyboard labeled with lexigrams (geometric symbols) and they can respond to spoken sentences. Kanzi's vocabulary consists of more than 500 English words[48] and he has comprehension of around 3,000 spoken English words.[49] Kanzi is also known for learning by observing people trying to teach his mother; Kanzi started doing the tasks that his mother was taught just by watching, some of which his mother had failed to learn. Some, such as philosopher and bioethicist Peter Singer, argue that these results qualify them for "rights to survival and life" — rights that humans theoretically accord to all persons. (See great Ape personhood.)

Instances in which nonhuman primates have expressed joy have been reported. One study analyzed and recorded sounds made by human babies and bonobos when they were tickled.[50] Although the bonobos' laugh was a higher frequency, the laugh was found to follow a similar spectrographic pattern to that of human babies.[50]

Habitat and distribution

Bonobos are found only south of the Congo River and north of the Kasai River (a tributary of the Congo),[51] in the humid forests of the Democratic Republic of Congo of central Africa.

Conservation status

Vanessa Woods with bonobo at Lola ya Bonobo sanctuary in Congo

The IUCN Red List classifies bonobos as an endangered species, with conservative population estimates ranging from 29,500 to 50,000 individuals.[2] Major threats to bonobo populations include habitat loss and hunting for bushmeat, the latter activity having increased dramatically during the first and second Congo wars in the Democratic Republic of Congo due to the presence of heavily armed militias even in remote "protected" areas such as Salonga National Park. This is part of a more general trend of ape extinction.

As the bonobos' habitat is shared with people, the ultimate success of conservation efforts will rely on local and community involvement. The issue of parks versus people[52] is salient in the Cuvette Centrale the bonobos' range. There is strong local and broad-based Congolese resistance to establishing national parks, as indigenous communities have often been driven from their forest homes by the establishment of parks. In Salonga National Park, the only national park in the bonobo habitat, there is no local involvement, and surveys undertaken since 2000 indicate the bonobo, the African forest elephant, and other species have been severely devastated by poachers and the thriving bushmeat trade.[53] In contrast, areas exist where the bonobo and biodiversity still thrive without any established parks, due to the indigenous beliefs and taboos against killing bonobos.

The port town of Basankusu is situated on the Lulonga River, at the confluence of the Lopori and Maringa Rivers, in the north of the country, making it well placed to receive and transport local goods to the cities of Mbandaka and Kinshasa. With Basankusu being the last port of substance before the wilderness of the Lopori Basin and the Lomako River – the bonobo heartland, conservation efforts for the bonobo,[54] use the town as a base.[55][56]

In 1995, concern over declining numbers of bonobos in the wild led the Zoological Society of Milwaukee, in Milwaukee, Wisconsin, with contributions from bonobo scientists around the world, to publish the Action Plan for Pan paniscus: A Report on Free Ranging Populations and Proposals for their Preservation. The Action Plan compiles population data on bonobos from 20 years of research conducted at various sites throughout the bonobo's range. The plan identifies priority actions for bonobo conservation and serves as a reference for developing conservation programs for researchers, government officials, and donor agencies.

Acting on Action Plan recommendations, the ZSM developed the Bonobo and Congo Biodiversity Initiative. This program includes habitat and rain-forest preservation, training for Congolese nationals and conservation institutions, wildlife population assessment and monitoring, and education. The Zoological Society has conducted regional surveys within the range of the bonobo in conjunction with training Congolese researchers in survey methodology and biodiversity monitoring. The Zoological Society’s initial goal was to survey Salonga National Park to determine the conservation status of the bonobo within the park and to provide financial and technical assistance to strengthen park protection. As the project has developed, the Zoological Society has become more involved in helping the Congolese living in bonobo habitat. The Zoological Society has built schools, hired teachers, provided some medicines, and, as of 2007, started an agriculture project to help the Congolese learn to grow crops and depend less on hunting wild animals.

During the wars in the 1990s, researchers and international non-governmental organizations (NGOs) were driven out of the bonobo habitat. In 2002, the Bonobo Conservation Initiative initiated the Bonobo Peace Forest Project in cooperation with national institutions, local NGOs, and local communities. The Peace Forest Project works with local communities to establish a linked constellation of community-based reserves, managed by local and indigenous people. Although there has been only limited support from international organizations, this model, implemented mainly through DRC organizations and local communities, has helped bring about agreements to protect over 5,000 square miles (13,000 km2) of the bonobo habitat. According to Dr. Amy Parish, the Bonobo Peace Forest "is going to be a model for conservation in the 21st century."[57]

This initiative has been gaining momentum and greater international recognition and it recently[when?] has gained greater support through Conservation International, the Global Conservation Fund, United States Fish and Wildlife Service's Great Ape Conservation Fund, and the United Nations' Great Apes Survival Project.

With grants from the United Nations, USAID, the U.S. Embassy, the World Wildlife Fund, and many other groups and individuals, the Zoological Society also has been working to:

  • Survey the bonobo population and its habitat to find ways to help protect these apes
  • Develop antipoaching measures to help save apes, forest elephants, and other endangered animals in Congo's Salonga National Park, a UN World Heritage site
  • Provide training, literacy education, agricultural techniques, schools, equipment, and jobs for Congolese living near bonobo habitats so that they will have a vested interest in protecting the great apes - As of 2007, the ZSM started an agriculture project to help the Congolese learn to grow crops and depend less on hunting wild animals.
  • Model small-scale conservation methods that can be used throughout Congo

Starting in 2003, the U.S. government allocated $54 million to the Congo Basin Forest Partnership. This significant investment has triggered the involvement of international NGOs to establish bases in the region and work to develop bonobo conservation programs. This initiative should improve the likelihood of bonobo survival, but its success still may depend upon building greater involvement and capability in local and indigenous communities.[58]

The Congo is setting aside more than 11,000 square miles (28,000 km2) of rain forest to help protect the endangered bonobo, in this central African country. U.S. agencies, conservation groups, and the Congolese government have come together to set aside 11,803 square miles (30,570 km2) of tropical rain forest, the U.S.-based Bonobo Conservation Initiative. The area amounts to just over 1% of the vast Congo – but that means a park larger than the state of Massachusetts.

The bonobo population is believed to have declined sharply in the last 30 years, though surveys have been hard to carry out in war-ravaged central Congo. Estimates range from 60,000 to fewer than 50,000 living, according to the World Wildlife Fund.

In addition, concerned parties have addressed the crisis on several science and ecological websites. Organizations such as the World Wide Fund for Nature, the African Wildlife Foundation, and others, are trying to focus attention on the extreme risk to the species. Some have suggested that a reserve be established in a more stable part of Africa, or on an island in a place such as Indonesia. Awareness is ever increasing, and even nonscientific or ecological sites have created various groups to collect donations to help with the conservation of this species.

See also

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 183. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ a b Fruth, B., Benishay, J.M., Bila-Isia, I., Coxe, S., Dupain, J., Furuichi, T., Hart, J., Hart, T., Hashimoto, C., Hohmann, G., Hurley, M., Ilambu, O., Mulavwa, M., Ndunda, M., Omasombo, V., Reinartz, G., Scherlis, J., Steel, L. & Thompson, J. (2008). Pan paniscus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ a b de Waal, Frans; Lanting, Frans (1997). Bonobo: The Forgotten Ape. University of California Press. 
  4. ^ a b Williams, A.; Myers, P. (2004). "Pan paniscus". Animal Diversity Web. http://animaldiversity.ummz.umich.edu/site/accounts/information/Pan_paniscus.html. Retrieved 6 January 2012. 
  5. ^ Savage-Rumbaugh, Sue; Lewin, Roger (1994). Kanzi: the ape at the brink of the human mind. John Wiley & Sons. p. 97. ISBN 0-385-40332-1. 
  6. ^ a b de Waal, Frans (2005). Our Inner Ape. Riverhead Books. ISBN 1-57322-312-3. 
  7. ^ McBrearty, Sally; Jablonski, Nina G. (1 September 2005). "First fossil chimpanzee". Nature 437 (7055): 105–8. doi:10.1038/nature04008. PMID 16136135. 
  8. ^ Zihlman AL, Cronin JE, Cramer DL, Sarich VM. 1978, Pygmy chimpanzee as a possible prototype for the common ancestor of humans, chimpanzees and gorillas. Nature. 275: 744-6.. PMID 703839
  9. ^ Schwarz, Ernst (April 1, 1929). "Das Vorkommen des Schimpansen auf den linken Kongo-Ufer" (in German). Revue de zoologie et de botanique africaines 16: 425–426. 
  10. ^ a b Coolidge, Harold Jefferson Jr. (July/September 1933). "Pan paniscus. Pigmy chimpanzee from south of the Congo river". American Journal of Physical Anthropology 18 (1): 1–59. doi:10.1002/ajpa.1330180113.  Coolidge's paper contains a translation of Schwarz's earlier report.
  11. ^ Herzfeld, Chris (2007). "L’invention du bonobo" (in French). Bulletin d’histoire et d’épistémologie des sciences de la vie 14 (2): 139–162. http://www.chrisherzfeld.com/userfiles/publications/BONOBO.pdf. Retrieved 21 December 2011. 
  12. ^ Savage-Rumbaugh, Sue (21 June 2010). "Bonobos have a secret". New Scientist. http://www.newscientist.com/blogs/culturelab/2010/06/bonobos-have-a-secret.html. Retrieved 21 December 2011. 
  13. ^ de Waal, Frans B. M. (2002). Tree of Origin: What Primate Behavior Can Tell Us About Human Social Evolution. Harvard University Press. pp. 51. 
  14. ^ a b Karow, Julia (May 13, 2008). "Neandertal, bonobo genomes may shed light on human evolution; MPI, 454 preparing drafts". In Sequence. Genome Web. http://www.genomeweb.com/sequencing/neandertal-bonobo-genomes-may-shed-light-human-evolution-mpi-454-preparing-draft. Retrieved 2011-12-08. 
  15. ^ a b "Colombus Zoo: Bonobo". Archived from the original on 2006-05-02. http://web.archive.org/web/20060502101116/http://www.colszoo.org/animalareas/aforest/bonobo.html. Retrieved 2006-08-01. 
  16. ^ Takahata, N.; Satta, Y.; Klein, J. (1995). "Divergence time and population size in the lineage leading to modern humans". Theoretical Population Biology 48 (2): 198–221. doi:10.1006/tpbi.1995.1026. PMID 7482371. 
  17. ^ Minkel, J.R. (December 19, 2006). "Human-chimp gene gap widens from tally of duplicate genes". Scientific American. http://www.scientificamerican.com/article.cfm?id=human-chimp-gene-gap-wide. Retrieved 2010-02-25. 
  18. ^ The Chimpanzee Sequencing and Analysis Consortium (1 September 2005). "Initial sequence of the chimpanzee genome and comparison with the human genome". Nature 437 (7055): 69–87. doi:10.1038/nature04072. PMID 16136131. 
  19. ^ Hecht, Jeff (19 May 2003). "Chimps are human, gene study implies". New Scientist. http://www.newscientist.com/article/dn3744-chimps-are-human-gene-study-implies.html. Retrieved 2011-12-08. 
  20. ^ Won, Yong-Jin; Hey, Jody (13 October 2004). "Divergence population genetics of chimpanzees". Molecular Biology & Evolution 22 (2): 297–307. doi:10.1093/molbev/msi017. PMID 15483319. 
  21. ^ Fischer, Anne; Wiebe, Victor; Pääbo, Svante; Przeworski, Molly (12 February 2004). "Evidence for a complex demographic history of chimpanzees". Molecular Biology & Evolution 21 (5): 799–808. doi:10.1093/molbev/msh083. PMID 14963091. 
  22. ^ Doran (1993). "Comparative locomotor behavior of chimpanzees and bonobos: the influence of morphology on locomotion". Am J Phys Anthropol. 91 (1):  :83–98. doi:10.1002/ajpa.1330910106. PMID 8512056. 
  23. ^ D’Août, K.; Vereecke, E.; Schoonaert, K.; De Clercq, D.; Van Elsacker, L.; Aerts, P. (2004). "Locomotion in bonobos (Pan paniscus): differences and similarities between bipedal and quadrupedal terrestrial walking, and a comparison with other locomotor modes". Journal of Anatomy 204 (5): 353–361. doi:10.1111/j.0021-8782.2004.00292.x. PMC 1571309. PMID 15198700. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1571309. 
  24. ^ Shea, B.T. (1983) Paedomorphosis and neoteny in the pygmy chimpanzee. Science 4 November 1983: 521-522
  25. ^ Godfrey L, Sutherland M. Paradox of peramophic paedomorphosis: heterochrony and human evolution. Am J Phys Anthropol. 1996;99:17–42
  26. ^ a b c Parker, Ian (July 30, 2007). "Swingers". Our Far-Flung Correspondents. The New Yorker. http://www.newyorker.com/reporting/2007/07/30/070730fa_fact_parker?printable=true. Retrieved 2011-12-08. 
  27. ^ White F. 1996. Comparative socio-ecology of Pan paniscus. In: McGrew WC, Marchant LF, Nishida T, editors. Great ape societies. Cambridge, England: Cambridge Univ Pr; p 29-41.
  28. ^ Research, Vanessa Woods
  29. ^ #61 Bonobo Handshake. Skepticallyspeaking.com. Retrieved on 2011-02-15.
  30. ^ Aggression topics from the University of New Hampshire
  31. ^ Tuan C. Nguyen, "Gorillas Caught in Very Human Act" in Live Science (February 13, 2008) http://www.livescience.com/2298-gorillas-caught-human-act.html
  32. ^ Manson, J.H.; Perry, S.; Parish, A.R. (1997). "Nonconceptive Sexual Behavior in Bonobos and Capuchins". International Journal of Primatology 18 (5): 767–86. doi:10.1023/A:1026395829818. 
  33. ^ a b c d e de Waal, Frans B. M. (March 1995). "Bonobo Sex and Society" (pdf). Scientific American 272 (3): 58–64. http://www.biozentrum.uni-wuerzburg.de/uploads/media/Bonobo_sex_01.pdf. Retrieved 21 December 2011. 
  34. ^ "Courtney Laird, "Social Organization"". Bio.davidson.edu. 2004. http://www.bio.davidson.edu/people/vecase/Behavior/Spring2004/laird/Social%20Organization.htm. Retrieved 2009-07-03. 
  35. ^ Frans B. M. de Waal (2001). "Bonobos and Fig Leaves". The ape and the sushi master : cultural reflections by a primatologist. Basic Books. ISBN 84-493-1325-2. 
  36. ^ Rowe N. Pictural Guide to the Living Primates. Pogonias Press, 1996. East Hampton. 263pp (ISBN 0-9648825-1-5)
  37. ^ Ihobe H (1992). "Observations on the meat-eating behavior of wild bonobos (Pan paniscus) at Wamba, Republic of Zaire". Primates 33 (2): 247–250. doi:10.1007/BF02382754. http://www.springerlink.com/content/h7145027g60n708l/. 
  38. ^ Rafert, J. and E.O. Vineberg (1997). "Bonobo Nutrition – relation of captive diet to wild diet," Bonobo Husbandry Manual, American Association of Zoos and Aquariums
  39. ^ Surbeck M, Fowler A, Deimel C, Hohmann G (2008). "Evidence for the consumption of arboreal, diurnal primates by bonobos (Pan paniscus)". American Journal of Primatology 71 (2): 171–4. doi:10.1002/ajp.20634. PMID 19058132. http://www3.interscience.wiley.com/journal/121543963/abstract. 
  40. ^ Surbeck M, Hohmann G (14 October 2008). "Primate hunting by bonobos at LuiKotale, Salonga National Park". Current Biology 18 (19): R906–7. doi:10.1016/j.cub.2008.08.040. PMID 18957233. http://www.current-biology.com/content/article/abstract?uid=PIIS0960982208011172. 
  41. ^ de Waal, Frans (2009-10-18). "Was "Ardi" a Liberal?". The Huffington Post. http://www.huffingtonpost.com/frans-de-waal/was-ardi-perhaps-liberal_b_325201.html. Retrieved 2009-10-18. 
  42. ^ "Bonobo 'cannibalises' own infant". BBC News. 2010-02-01. http://news.bbc.co.uk/earth/hi/earth_news/newsid_8487000/8487138.stm. 
  43. ^ "Chimpanzee behavior: Killer instincts". The Economist. June 24, 2010. http://www.economist.com/node/16422404. Retrieved 2011-12-08. 
  44. ^ The Smart and Swinging Bonobo|Science & Nature|Smithsonian Magazine. Smithsonianmag.com. Retrieved on 2011-02-15.
  45. ^ Caswell JL, Mallick S, Richter DJ, et al (2008). McVean, Gil. ed. "Analysis of Chimpanzee History Based on Genome Sequence Alignments". PLoS Genet. 4 (4): e1000057. doi:10.1371/journal.pgen.1000057. PMC 2278377. PMID 18421364. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2278377. 
  46. ^ White & Wrangham (1988) "Feeding competition and patch size in the chimpanzee species Pan paniscus and Pan troglodytes." Behaviour 105:148-164.
  47. ^ Best, Steven (Spring 2009). "Minding the Animals: Ethology and the Obsolescence of Left Humanism". The International Journal of Inclusive Democracy 5 (2). http://www.inclusivedemocracy.org/journal/vol5/vol5_no2_best_minding_animals_PRINTABLE.htm. Retrieved 2012-02-08. 
  48. ^ "Meet our Great Apes: Kanzi". Archived from the original on 2008-06-30. http://web.archive.org/web/20080630201101/http://www.greatapetrust.org/bonobo/meet/kanzi.php. Retrieved 2008-09-28. 
  49. ^ Raffaele, P. (2006). "Speaking Bonobo". Smithsonian. http://www.smithsonianmag.com/science-nature/10022981.html. Retrieved 2008-09-28. 
  50. ^ a b Beale, B. (2003). "Where Did Laughter Come From?". ABC Science Online. http://dsc.discovery.com/news/afp/20031006/laughter.html. Retrieved 2008-08-10. 
  51. ^ Dawkins, Richard (2004). "Chimpanzees". The Ancestor's Tale. Houghton Mifflin. ISBN 1-155-16265-X. 
  52. ^ Reid, John, Parks and people, not parks vs. people, San Francisco Chronicle, June 15, 2006
  53. ^ Bonobo and large mammal survey Zoological Society of Milwaukee.
  54. ^ Searching for Bonobo – Dr Therese Hart
  55. ^ Lola Ya Bonobo (Bonobo Heaven)
  56. ^ Bonobo Reintroduction in the Democratic Republic of Congo
  57. ^ The Make Love, Not War Species, Living on Earth, (July 2006), National Public Radio
  58. ^ Chapin, Mac, (November/December 2004), Vision for a Sustainable World, WORLDWATCH magazine

Further reading

Books

Articles

Journal articles

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!