Found primarily in lowland tropical forest, particularly where there is dense ground-level herbaceous growth, and in swamp forests. Staple foods are pith, leaves and shoots. Fruit component of the diet is generally high but varies with seasonal availability (Rogers et al. 2004). Gorillas live in groups averaging 10 and occasionally over 20 individuals, composed of at least one adult male, several adult females and their offspring. Each group?s home range may be as large as 20 km² and group ranges overlap extensively. The few precise life-history data available for Gorilla g. gorilla in the wild come from six years of observation of habituated groups at Lossi (prior to the Ebola epidemic) and from 6.5 years of observation at Mbeli Bai in the Nouabalé-Ndoki NP (RoC). Birth rates at Lossi and Mbeli Bai averaged 0.18 and 0.2 respectively with inter-birth-intervals of 4 to 6 years for six females whose first infant survived (Robbins et al. 2004). Infant mortality up to three years of age, in populations not affected by Ebola, was 22% and 65%, respectively, for Lossi and Mbeli (Robbins et al. 2004). Compared with the much larger demographic datasets from almost three decades of observation of mountain gorillas (Gorilla beringei beringei), it appears that western lowland gorillas reproduce more slowly due to longer inter-birth-intervals and higher infant mortality. Patterns of male and female emigration appear to be similar, but large groups (>20) containing more than one adult male are relatively uncommon in Gorilla g. gorilla (Robbins et al. 2004).

Two studies of G. g. diehli (at Afi and Kagwene) demonstrated flexible grouping patterns with groups ranging in size from 2 to 20. These grouping patterns likely occur for several reasons, including restricted habitat, feeding competition related to fruit consumption, high hunting pressure, and limited opportunities for male migration between nuclei (McFarland 2007). Each group?s home range may be as large as 20 km² and group ranges overlap extensively. Today, Cross River gorillas are restricted mostly to hilly areas, and range from lowland to submontane forest (Allen 1932, Oates et al. 2003, Sunderland-Groves et al. 2003), although they occasionally use lowland areas between hills (Oates et al. 2003, Bergl 2006).

Modify > Adapt/optimize > Adapt genotype 

Modify > Adapt/optimize > Adapt phenotype 

Modify > Modify physical state > Material characteristics 

Break down > Physically break down > Biotic materials 

Maintain physical integrity > Manage structural forces > Mechanical wear 

GBMA2473-09|D38114|Gorilla gorilla| GACCGCTGATTATTCTCTACAAACCATAAAGATATTGGAACACTATATCTACTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCCCTA---AGTCTCCTTATTCGAGCAGAACTTGGTCAACCAGGCAACCTTCTAGGTAAC---GATCACATCTATAATGTTATCGTCACAGCCCATGCGTTCGTAATAATTTTCTTCATAGTAATGCCTATCATAATCGGAGGCTTTGGCAACTGGCTAGTACCCTTAATA---ATTGGTGCCCCCGACATGGCATTCCCCCGCATAAACAACATAAGCTTCTGACTCCTTCCCCCTTCTTTCCTACTTCTGCTCGCATCCGCTATAGTAGAAGCCGGCGCAGGGACTGGTTGGACAGTCTACCCTCCCTTAGCAGGAAATTATTCCCACCCCGGAGCTTCTGTAGACCTA---ACCATTTTTTCCCTACACCTAGCAGGCATCTCCTCTATTCTAGGGGCCATCAACTTCATTACAACAATCATCAATATAAAACCCCCCGCCATAACCCAATACCAAACACCCCTTTTCGTCTGATCCGTCCTAATCACAGCAGTCTTACTTCTTCTATCTCTCCCAGTACTAGCTGCT---GGAATTACCATATTATTAACAGACCGTAACCTCAACACCACCTTTTTCGACCCAGCCGGAGGAGGAGATCCTATCCTATACCAACACTTATTCTGATTTTTTGGACACCCCGAAGTTTACATTCTAATCCTACCAGGCTTCGGAATAATCTCCCACATTGTAACTTATTACTCCGGAAAAAAA---GAACCATTCGGATATATAGGTATAGTCTGAGCTATAATATCAATTGGTTTCCTGGGATTTATTGTGTGAGCCCACCACATATTTACAGTAGGAATAG 
-- end --

Red List Category

Red List Criteria

Version

2008

Walsh, P.D., Tutin, C.E.G., Oates, J.F., Baillie, J.E.M., Maisels, F., Stokes, E.J., Gatti, S., Bergl, R.A., Sunderland-Groves, J. & Dunn. A.

Mittermeier, R.A., Williamson, E.A. & Butynski, T.M. (Primate Red List Authority)

Justification

History

• 2007
  Critically Endangered
• 2000
  Endangered
• 1996
  Endangered
• 1994
  Vulnerable
  (Groombridge 1994)
• 1990
  Vulnerable
  (IUCN 1990)
• 1988
  Vulnerable
  (IUCN Conservation Monitoring Centre 1988)
• 1988
  Vulnerable
• 1986
  Vulnerable
  (IUCN Conservation Monitoring Centre 1986)

Gorilla gorilla gorilla
Previous assessments have focused on habitat availability as the major predictor of gorilla abundance. Thus, the commonly cited figure of 95,000 western gorillas (Harcourt 1996) is based on an assumption that all intact habitat in Western Equatorial Africa contains gorillas at densities that were typical of Gabon in the early 1980s. However, habitat loss is not the major driver of ape decline in this region. Rather, recent surveys suggest that since the early 1980s, commercial hunting and outbreaks of the Ebola virus have virtually extirpated gorillas from a great deal of otherwise intact forest. Technical problems with the conversion of ape nest density to estimates of gorilla density preclude a rigorous estimate of range-wide gorilla abundance.

Gorilla gorilla diehli
Although gorillas in the Cross River region first became known to science in the early 20^th century, little attention was paid to their conservation status until the late 1980s (Harcourt et al. 1989). Early reports had referred to their precarious situation, but little had been done to thoroughly examine their distribution and abundance, or to protect the remaining population and habitat (Anon 1934, Critchley 1968, March 1957). Intensive surveys over the last decade have found that approximately 250 to 300 G. g. diehli persist in a forested area of roughly 8,000 km². This estimate is of uncertain accuracy and is based primarily on nest counts and estimated range size. The gorillas are found in at least 10 localities (Groves 2002, Beamont 2004, Bergl 2006, Bergl and Vigilant 2007). Though the localities where the gorillas are found are geographically distinct, the majority of these areas are connected by forested land. Recent genetic evidence suggests that three subpopulations are present, but that these subpopulations do have limited reproductive contact (Bergl and Vigilant 2007). These localities are primarily rugged highlands, typically in areas relatively less disturbed by human activity. While there may be an ecological component to this distribution, the gorilla?s concentration in highland areas is almost certainly strongly influenced by human hunting pressure, which is more intense in the lowlands. Ebola has not been reported in the G. g. diehli population, but their close proximity to dense human populations puts them at high potential risk of acquiring human pathogens (Oates et al. 2007).

Decreasing

Gorilla gorilla gorilla
There are two primary drivers of rapid western lowland gorilla decline: commercial hunting and the Ebola virus. Until the early 1980s, the interior of western lowland gorilla range included a series of vast, road-less blocks of forest where hunting access was extremely difficult and gorilla densities were high. Since then improvements in transportation infrastructure, devaluation of the regional currency, declining oil stocks, and timber depletion in other tropical regions have led to an explosion in mechanized logging. Regional timber production nearly doubled between 1991 and 2000 (Minnemeyer et al. 2002). Vast tracts of previously inaccessible forest have recently been penetrated by logging roads, which provide commercial hunters ready access to remote areas with high ape densities, and to markets. Logging vehicles are also used to transport bushmeat, and logging employees eat more bushmeat than do local villagers.

The gorillas? very low reproductive rates (3% maximum observed rate of population increase, Steklis and Gerald-Steklis 2001) mean that even low levels of hunting are enough to cause population decline. Consequently, the logging boom has caused a rapid crash in gorilla numbers. For example, Gabon experienced an estimated 56% decline in ape abundance from 1983 to 2000, most of which was attributed to hunting (Walsh et al. 2005). Given that Gabon is the least heavily human populated country in the region, hunting impact is likely as high or higher in other range states. The threat posed by logging promises to continue and even intensify in the foreseeable future. Rates of timber production in the region are increasing (Minnemeyer et al. 2002), in the case of Gabon exponentially (Figure 1). Profits in the industry are derived largely through exploitation of previously unlogged areas rather than sustainable harvesting in older concessions. The current trajectory predicts that the last remaining tracts of inaccessible forest will be opened to logging in the next 10 to 20 years.

Follow the link below for Figure 1: Roundwood production in Gabon (1980-2005).

The second major driver of rapid gorilla decline is disease, specifically the Ebola virus. Since the early 1990s, Ebola has caused a series of massive gorilla and chimpanzee die-offs in remote forest blocks at the heart of their range. Outbreaks were first noted in 1994 in the Minkébé forest block of northern Gabon (Huijbregts et al. 2003). Before Ebola?s arrival, what is now Minkébé National Park held what was probably the second largest protected gorilla and chimpanzee population in the world. In 1996 Ebola emerged in the Lopé Reserve (now National Park) in central Gabon, in 2001 in the Mwagné forest block of eastern Gabon, in 2002 to 2003 in the adjoining Lossi forest block of north-west Congo, and in 2003 to 2005 in the Odzala National Park in north-west Congo (Figure 2). The Ivindo forest block of central Gabon was not monitored during the outbreak period, but it lies directly adjacent to the 1996 human outbreak zone around Booué and recent observations suggest an ape die-off there too.

Follow the link below for Figure 2: Protected areas with important western lowland gorilla populations.

Both phylogenetic analyses of the Ebola virus genome and analyses of the spatio-temporal pattern of outbreaks in humans and wild apes (Walsh et al. 2005, Lahm et al. 2006) suggest that these outbreaks were not isolated events but part of a spreading epizootic of Ebola in its reservoir host (probably bats, Leroy et al. 2005). Moving at about 40 to 45 km/year, this epizootic has for the last decade spread in an east/north-easterly direction across the region. Although continued spread is not guaranteed, the epizootic?s past spread rate has been highly consistent, making it possible to accurately predict the timing of the Odzala die-off well before it occurred (Walsh et al. 2003, 2005).

During Ebola outbreaks, gorilla mortality rates have been extremely high. During three different outbreaks at two different study sites, individually known social groups containing almost 600 gorillas were monitored. In all three outbreaks about 95% of known individuals died (Caillaud et al. 2006, Bermejo et al. 2007). Higher survival rates amongst solitary individuals suggest that most of the remaining 5% may be individuals who were never infected rather than resistant survivors (Caillaud et al. 2006). Nest surveys at four different sites exhibit an ?all or none? pattern of Ebola impact. Areas of 10,000 km² or more showing 95% declines in abundance transition abruptly into areas with little or no mortality (Bermejo et al. 2007, WCS and Government of Congo MEF unpublished data). These low ape densities are not reasonably attributed to hunting pressure as most of the remote survey zones had high ape densities just a few years before the declines were detected and because densities of other preferred target species (e.g., elephants and duiker) were still high after the Ebola outbreaks (Walsh et al. 2003, Bermejo et al. 2007). The proportion of habitat in the 95% mortality class varied amongst outbreak sites, from little or none at Lopé to the entire Mwagné survey zone (Table 1a). In Odzala National Park, which held what were by far the largest protected populations of gorillas and chimpanzees in the world, the outbreak zone covered about 58% of the park.

Follow the link below for Table 1a: Estimates of percent decline in gorilla abundance in six survey zones.

Table 1a contains estimates of the percent decline in gorilla abundance in each survey zone. In the Lossi and Odzala zones, extensive survey data allowed a fairly precise mapping of outbreak and non-outbreak zones. Therefore, the number presented for these two zones is based on the proportion of the survey zone in each outbreak class (Outbreak vs. NonOutbreak) and the assumption of 95% mortality in outbreak areas. This approach was not possible for the Mwagné and Minkébé sites where virtually the entire populations were wiped out, or for the Ivindo site where survey intensity was not high enough to precisely map outbreak and non-outbreak zones. For these sites, nest encounter rates for surveys conducted before Ebola emergence are compared with nest encounter rates after Ebola emergence (Pre-Ebola vs. Post-Ebola). No attempt was made to estimate % decline for Lopé because it was the only zone to be logged before Ebola arrival and the only area in which a substantial proportion of the survey zone has experienced high rates of hunting. This makes it difficult to discriminate Ebola impact from hunting impact. Therefore, for the purposes of this analysis, Ebola is assumed to have had zero impact at Lopé. Estimated declines in gorilla abundance for the five zones for which estimates have been made range from 56% at Odzala to more than 95% at Mwagné and Minkébé. When decline rates are averaged across all six zones (with the contribution of each zone weighted by its surface area) the mean decline is 74% (weighting by relative abundance makes no significant difference; see Table 1b). The assumption of zero impact at Lopé has a conservative effect on this mean value (see Table 1a and 1b for comparison).

Follow the link below for Table 1b: Estimates of percent decline in gorilla abundance in five survey zones.

These six protected areas account for 45% of the total protected area habitat (67,250 km²) in which significant western lowland gorilla populations were found before Ebola emergence (Table 2). If we assume that all major protected areas had the same pre-Ebola density, this implies that 33% of the total protected area population of western lowland gorilla (100*(0.45*0.26+0.55*1) = 33%) has been killed by Ebola just over the last 13 to 14 years. This estimate is highly conservative in that pre-Ebola density estimates for protected areas with Ebola impact were typically much higher than for protected areas without recorded Ebola impact.

Follow the link below for Table 2: Protected areas holding significant pre-Ebola outbreak populations of western lowland gorilla, and Ebola-induced declines. Note: more detailed tabular data to support the calculations are available upon request.

If the Ebola epizootic continues at the same rate and trajectory, it could reach most of the remaining protected areas with large populations of western lowland gorillas within the next 5 to 10 years. Six major protected areas (Boumba Bek, Nki, and Lobéké Reserves in Cameroon, Dzanga-Ndoki National Park in C.A.R., Nouabalé-Ndoki National Park and Lac Télé Reserve in Congo) lie in the wave?s path and account for 44.6% of the protected area habitat where Ebola outbreaks have yet to be documented. All six areas lie inside a 275 km radius from the 2004 Lossi outbreak site at Odzala National Park. Thus, if the epizootic wave continues to spread at its past rate it may move through all six sites by about 2011 (calculated as 2004 + (275 km/43 km/yr)). If all sites suffered declines of a magnitude similar to previous parks (i.e. 74%), this would represent a 32.6% decline in the unaffected protected area population (calculated as: 100*((area of habitat affected*mortality rate)/total habitat)). Combined with previous impact, this would constitute a 45.4% Ebola-induced decline of Western Gorilla abundance in all protected areas (Table 2) in a period of just 20 years (i.e., from 1992 to 2011), or about one generation length*. This estimate is conservative in that these six protected areas are more remote than the other unaffected parks and are, therefore, likely to hold a higher proportion of the western gorilla population than is predicted by their area. The decline estimate is also independent of any decline caused by other factors (e.g., hunting), which, as already noted, was the primary reason for a 56% decline in ape abundance from 1983 to 2000 in Gabon alone.

Timber extraction is the major source of forest clearance in western lowland gorilla range, which retains the highest percentage of forest cover in equatorial Africa (Minnemeyer et al. 2002). Logging is selective, regional deforestation rates average only about 0.4% per year (FAO 2001), and gorillas do well in secondary forest if hunting is controlled. Thus, forest clearance alone should not become a major threat to western lowland gorillas for at least two or three decades, by which time other causes, if left unchecked, will already have greatly depleted populations. Forest clearance for agriculture is a major threat in heavily populated coastal regions, particularly in Cameroon. However, these areas harbour only a tiny fraction (probably <5%) of remaining western lowland gorillas.

Finally, there are hints that climate change may pose a serious future threat. Most of the western gorilla range receives rainfall only slightly higher than the amount necessary to maintain closed canopy forest. The last few decades have seen a decline in mean rainfall and a lengthening of dry seasons (Giannini et al. 2003), which increase the risk of forest fires. If this drying trend continues, there is a risk that large scale forest fires will cause dramatic forest loss, as seen recently in Southeast Asia and South America (Cochrane 2003). This risk will be magnified if regional climate trends are reinforced by local scale forest clearance for agriculture and timber (Baidya Roy et al. 2005).

Details on calculation of generation time can be found in Appendix 1 (follow the link below for Appendix 1).

Gorilla gorilla diehli
The remaining population of G. g. diehli is small and fragmented, occurs mostly outside of protected areas (especially in Cameroon) and is surrounded by some of the most densely populated human settlements in Africa. This subspecies is at risk from its small size and associated increases in inbreeding and loss of genetic diversity. The lack of strictly protected areas throughout much of the range of G. g. diehli makes the future of sizeable portions of gorilla habitat uncertain. Conversion of forest for agriculture and grazing is occurring rapidly in many parts of the gorillas? range and the largest current protected area in which Cross River gorillas occur (the Okwangwo Division of Nigeria?s Cross River National Park) contains enclaves of human settlements whose farmlands have spread beyond their legal boundaries and threaten to divide the park into two. The construction and improvement of roads in both Cameroon and Nigeria also threatens to increase subdivision of the population. Though legal prohibitions against the killing of gorillas exist in Nigeria and Cameroon, enforcement of wildlife laws is often lax, and most protected areas suffer from poorly-controlled poaching. Although recent conservation efforts have reduced hunting of Cross River gorillas to a low level, the threat remains and the small size of the G. g. diehli population means that almost any level of hunting off-take is likely to be unsustainable and have a significant negative effect on population size.

National and international laws controlling hunting or capture of gorillas exist in all habitat countries, but enforcement of protective legislation is almost non-existent. G. gorilla is listed under Appendix I of CITES and in Class A of the African Convention. Conservation areas exist in most gorilla range states and several National Parks have been created recently specifically to protect great apes and other large mammals. Strongholds identified as exceptional priority areas for ape conservation and not yet affected by Ebola are: the Dja Conservation complex and Boumba-Bek/Nki complex in Cameroon, the Loango/Moukalaba-Doudou/Gamba complex in Gabon, the Lac Télé Likouala complex in RoC, and the Sangha Trinational complex of the Republic of Congo, Central African Republic and Cameroon (Tutin et al. 2005). National Parks offer no protection from Ebola and only one of these remaining gorilla strongholds (Loango/Moukalaba-Doudou/Gamba) is remote from recent epidemics (P. Walsh, unpubl.).

Urgent conservation needs include the effective implementation of protection laws. Conservation areas must be adequately protected and managed, and some additional areas should be gazetted. Surveys of outlier populations in Cameroon, Cabinda and the Democratic Republic of Congo are needed, as are conservation education programmes. Extensive resources are required to identify appropriate conservation actions in the face of the spread of Ebola. A better understanding of the spatial and temporal spread of the disease between and within species may allow development of a pro-active campaign to protect at-risk great ape and human populations through vaccination and/or the reinforcement of effective physical barriers (Walsh et al. 2005). Recommendations for reducing the negative impacts of selective logging on large mammals, including gorillas, have been formulated and applied in pilot zones (Elkan et al. 2006, Morgan and Sanz 2007), but considerable efforts are needed to establish partnerships with the logging industry such that protective measures are enforced, and concessions bordering National Parks are a priority. Finally, the poor understanding of the current size of the population of western gorillas must be addressed. Much of the western lowland gorilla's range has not been surveyed recently and survey methods have not been consistently reliable. Older survey data are particularly unreliable as Ebola and commercial hunting are known to have caused dramatic and rapid declines in affected areas (Tutin et al. 2005). New surveys using consistent methods as well as regular monitoring of populations in protected areas are urgently needed throughout the western gorilla's range. This will enable the conservation community to design and implement optimal conservation strategies in the face of this potent cocktail of threats.

A series of three workshops has identified priority actions for the conservation of G. g. diehli, and these have been formulated into an IUCN Action Plan (Oates et al. 2007). There are several cross-cutting actions which require attention throughout Cross River gorilla range, notably increasing conservation education and awareness, fostering improved community participation in conservation issues, increasing trans-boundary conservation activities such as joint patrols to control timber and bushmeat between the two countries, and further research. The most urgently-needed actions identified, which must be undertaken for any longer-term measures to be effective, are habitat protection and the control of hunting. In Nigeria the majority of the G. g. diehli population occurs within formal protected areas (Cross River National Park and Afi Mountain Wildlife Sanctuary), but in Cameroon none of the population is as yet protected in this way (although two areas are in process of establishment: Takamanda National Park and Kagwene Gorilla Sanctuary). Further areas, including migration corridors, need to be brought under conservation management to increase the chances for the long-term survival of a viable population of Cross River gorillas, and the effectiveness of existing management improved.