Overview

Brief Summary

Biology

Western gorillas live in groups that vary in size between 2 and 20 individuals, composed of at least one male, several females and their offspring (2). A dominant male silverback heads the group, with younger males usually leaving the group when they reach maturity. Females transfer to another group before breeding, which begins at eight to nine years old; they care for their young infant for the first four to five years of its life (2). There is therefore a long interval between births, which partly explains the slow population growth rates that make the western gorilla so vulnerable to poaching (6). Due to the long gestation time, long period of parental care, and infant mortality, a female gorilla will only give birth to an offspring that survives to maturity every four to six years. Gorillas are long-lived and may survive for as long as 40 years in the wild (4). Fruit forms a large part of the western gorilla's diet and they will travel further each day in search of fruiting trees than their eastern relatives (2). The distance that gorillas travel each day while they are searching for fruit trees varies between one and four kilometres. A group's home range may be as large as 30 square kilometres (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Western gorillas are exceptionally large and powerful primates, with male gorillas averaging 180 kg (396 lbs), and females at almost half that weight. Gorillas have jet black skin and hair. Adult males earn the name “silverbacks” as the hair on their back and rump grows grey with age.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The gorilla is a heavily built primate and is the largest of the living apes. Until recently it was considered a single species, but DNA evidence has led to the recognition of the eastern and western populations as distinct species: Gorilla beringei and Gorilla gorilla, respectively (4). Gorillas have a characteristic body shape with a broad chest, heavy neck and strong hands and feet. They have a fine, brownish coat, often with a red or auburn tinge on the crown, and mature males are known as 'silverbacks' due to the silvery-white saddle of hair extending from the back to the rump and thighs (2). Male gorillas have a larger skull crest than females and other apes, together with larger canines and a more pronounced ridge above the eyes (2). Western gorillas are smaller and lighter bodied than eastern gorillas, because they must be agile climbers in order to reach fruits in the trees (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The western gorilla Gorilla gorilla is found in Cameroon, Central African Republic (CAR), mainland Equatorial Guinea (Rio Muni), Gabon, Nigeria, Republic of Congo (RoC), Cabinda (Angola), and possibly in the Democratic Republic of Congo (DRC). The core population had until recently an almost continuous distribution in suitable habitat from southern CAR to the Congo River and west to the coast. Small outlying populations remain on the Nigeria-Cameroon border at the headwaters of the Cross River and in the Ebo/Ndokbou forest in Cameroon, just north of the lower Sanaga River. The species may also persist in the Maiombe region of Democratic Republic of Congo contiguous with Cabinda.

Two subspecies are currently recognized. G. g. gorilla (Savage and Wyman, 1847) occurs in Cameroon (south of the Sanaga River), south to the Congo River mouth, and east across the Sangha River, to the Oubangi River. The subspecies G. g. diehli (Matschie, 1903) occurs in a small area on the Nigeria-Cameroon border, extending a short distance on either side of the border in the forests on the upper drainage of the Cross River.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Western or lowland gorillas inhabit the forests of equatorial Africa from the western lowlands near the Cameroon coast through the Central African Republic, Equatorial Guinea, Gabon, Nigeria, Republic of Congo, Angola, and possibly the Democratic Republic of Congo. There are two recognized subspecies, G. gorilla, western lowland gorilla, occurs in Cameroon south to the Congo River and east to the Oubangi River. Gorilla gorilla diehli, eastern lowland gorilla, is found in a small part of the Nigerian/Cameroon border in the upper drainage of the Cross River.

Biogeographic Regions: ethiopian (Native )

  • Deblase, A., R. Martin. 1981. A Manual of Mammalogy with Keys to Families of the World, Second Edition,. Dubuque, Iowa: Wm. C. Brown Co. Publishers.
  • IUCN, 2008. "Gorilla gorilla" (On-line). 2008 IUCN Red List of Threatened Species. Accessed October 07, 2008 at http://redlist.org/details/9404.
  • MacDonald, D. 1987. The Encyclopedia of Mammals. New York: Facts on File Publications.
  • Wilson, D., D. Reeder. 1993. Mammal Species of the World: A Taxonomic and Geographic Reference, Second Edition. Washington & London: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Central and western Africa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The two subspecies of western gorilla differ markedly in their range and abundance. The Cross River gorilla (Gorilla gorilla diehli) is the most restricted of the gorillas, being found only in a few isolated populations on the Nigerian-Cameroon border (5). In contrast, the western lowland gorilla (Gorilla gorilla gorilla) is the most widespread, being found in areas of Cameroon, the Central African Republic, Congo, Gabon, Equatorial Guinea, and the Cabinda enclave of Angola (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Western gorillas are exceptionally large and powerful primates. They have no tails and jet black skin. Facial features include short muzzles, a prominent brow ridge, large nostrils, and small eyes and ears. Western gorillas have large jaw muscles and broad, strong teeth. Coarse, dark hair covers the entire body except for the face, ears, hands, and feet. Generally, the hair on the back and rump of older males grows grey and is lost with age. This coloration pattern has resulted in older males being known as "silverbacks". Western gorillas have a slightly more brown/grey coat color with shorter hair and are usually slightly smaller than mountain gorillas (G. beringei).

Males are usually larger than females, reaching weights up to 275 kg in captivity. In the wild, male gorillas average 180 kg, with females often almost half that weight. Male gorillas have stocky bodies standing usually 1.75 meters in height with bent knees. On average, females are only 1.25 meters tall. This marked sexual dimorphism is critical in group structure and mating. Large males, with large body size, canines, and jaw musculature, have increased physical and social power within the group.

Hands are proportionately large with nails on all digits and very large thumbs. Western gorillas frequently stand upright, but walk in a hunched, quadrupedal fashion, with hands curled and knuckles touching the ground. Walking quadrupedally requires long arms, and the armspan of gorillas is larger than their standing height. Limbs are plantigrade and pentadactyl.

Range mass: 275 (high) kg.

Average mass: 180 kg.

Average wingspan: males 175 cm; females 125 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

  • Walker, E. 1975. Mammals of the World , Third Edition, Volume I. Baltimore & London: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found primarily in lowland tropical forest, particularly where there is dense ground-level herbaceous growth, and in swamp forests. Staple foods are pith, leaves and shoots. Fruit component of the diet is generally high but varies with seasonal availability (Rogers et al. 2004). Gorillas live in groups averaging 10 and occasionally over 20 individuals, composed of at least one adult male, several adult females and their offspring. Each group?s home range may be as large as 20 km² and group ranges overlap extensively. The few precise life-history data available for Gorilla g. gorilla in the wild come from six years of observation of habituated groups at Lossi (prior to the Ebola epidemic) and from 6.5 years of observation at Mbeli Bai in the Nouabalé-Ndoki NP (RoC). Birth rates at Lossi and Mbeli Bai averaged 0.18 and 0.2 respectively with inter-birth-intervals of 4 to 6 years for six females whose first infant survived (Robbins et al. 2004). Infant mortality up to three years of age, in populations not affected by Ebola, was 22% and 65%, respectively, for Lossi and Mbeli (Robbins et al. 2004). Compared with the much larger demographic datasets from almost three decades of observation of mountain gorillas (Gorilla beringei beringei), it appears that western lowland gorillas reproduce more slowly due to longer inter-birth-intervals and higher infant mortality. Patterns of male and female emigration appear to be similar, but large groups (>20) containing more than one adult male are relatively uncommon in Gorilla g. gorilla (Robbins et al. 2004).

Two studies of G. g. diehli (at Afi and Kagwene) demonstrated flexible grouping patterns with groups ranging in size from 2 to 20. These grouping patterns likely occur for several reasons, including restricted habitat, feeding competition related to fruit consumption, high hunting pressure, and limited opportunities for male migration between nuclei (McFarland 2007). Each group?s home range may be as large as 20 km² and group ranges overlap extensively. Today, Cross River gorillas are restricted mostly to hilly areas, and range from lowland to submontane forest (Allen 1932, Oates et al. 2003, Sunderland-Groves et al. 2003), although they occasionally use lowland areas between hills (Oates et al. 2003, Bergl 2006).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Africa's tropical secondary forests, where the open canopy allows much light to reach the forest floor, provide the best habitat for western gorillas.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Lowland Gorillas inhabit the tropical forests in Cameroon south to the Congo River and east to the Oubangi River. Secondary forests, where the open canopy allows much light to reach the forest floor, offer the best habitat for Western Lowland Gorillas.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The western gorilla inhabits primary, secondary, and swamp forests (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Wild gorillas are herbivores, subsisting mainly on juicy stemmed plants. They will also consume leaves, berries, ferns and fibrous bark. Usually gorillas feed during the morning and afternoon. Western gorillas climb trees up to 15 meters in height in search of food.  Gorillas never completely strip vegetation from a single area. The rapid regrowth of the vegetation they consume allows them to stay within a reasonably confined home range for extended periods of time.

Plant Foods: leaves; wood, bark, or stems; fruit

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The roles these animals play within their ecosystem has not been described.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predation upon gorillas is probably not common, due to their imposing size. Young animals may fall prey to raptors or large carnivores. Also, gorillas that have not yet been weaned are subject to infanticide by males of their species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Gorillas communicate using calls, facial expressions and physical postures, and through tactile means. Scents may play some role in communication in these animals.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wild gorillas are herbivores, subsisting mainly on juicy-stemmed plants. They will also consume leaves, berries, ferns and fibrous bark. Usually gorillas feed during the morning and afternoon and may climb trees up to 15 meters in height in search of food.

Gorillas live groups of 5 to 15 individuals made up of adult females with young and a single dominant“silverback” male. In some cases, a smaller pack of less dominant males will associate on the periphery of the group. Dominant males hold their position until they die or are displaced by a rival.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Wild gorillas live between 35 and 40 years with some captive gorillas living almost 50 years.

Range lifespan

Status: wild:
35 to 40 years.

Range lifespan

Status: captivity:
50 (high) years.

Average lifespan

Sex: female

Status: captivity:
47.0 years.

Average lifespan

Status: captivity:
39.3 years.

Average lifespan

Status: wild:
47.0 years.

Average lifespan

Status: captivity:
40.0 years.

Average lifespan

Status: wild:
50.0 years.

Average lifespan

Status: captivity:
54.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 55.4 years (captivity) Observations: Little is known about ageing in gorillas. One wild born female was about 53.5 years when she died in captivity (Richard Weigl 2005). The record longevity, however, appears to belong to a female called "Jenny" that died at Dallas Zoo from an inoperable stomach tumour at 55.4 years of age. She showed early signs of cataracts.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Typically one dominant male within a gorilla troup mates with the females in that group. The dominant male, because of his superior fighting prowess and the perceived ability to better protect females and their offspring, is preferred by the females.

Mating System: polygynous

As in humans, there is no fixed breeding season for gorillas, and females menstruate every 28 days. A single young, weighing approximately 2 kg, is born after nine months of gestation. Young gorillas nurse for 3 to 4 years. Females give birth at about four-year intervals, beginning when they are approximately ten years of age. However, a high mortality rate means surviving offspring are produced only once every 6 to 8 years. Males, because of physical competition for mates, only rarely breed before the age of 15.

Breeding interval: Females give birth at about four-year intervals.

Breeding season: Gorillas breed year round.

Average number of offspring: 1.

Average gestation period: 9 months.

Range weaning age: 36 to 48 months.

Range time to independence: 3 to 4 years.

Average age at sexual or reproductive maturity (female): 10 years.

Average age at sexual or reproductive maturity (male): 15 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 2061.4 g.

Average gestation period: 256 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
4015 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
2829 days.

Infants are suckled for 3 to 4 years. In the case of multiple young, the mother, who must carry the infants, finds it difficult to care for two and frequently allows one to die. Young grow at approximately twice the rate of human babies and are able to crawl and cling to their mother by the age of 3 months. They remain dependent upon the mother for 3 to 4 years.

Females provide the young with transportation, food, and socialization. They protect their young within the group. Males do not typically interact much with the young, although they do protect their offspring by defending the social group against potentially infanticidal males who might wish to take over control of the group.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Protecting: Male, Female); extended period of juvenile learning

  • MacDonald, D. 1987. The Encyclopedia of Mammals. New York: Facts on File Publications.
  • Walker, E. 1975. Mammals of the World , Third Edition, Volume I. Baltimore & London: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Teeth adapted to changing environments: great apes
 

The teeth of great apes help them survive times of food scarcity because they are diverse in type and material characteristics, allowing consumption of fallback foods.

           
  "Lucas and colleagues recently proposed a model based on fracture and  deformation concepts to describe how mammalian tooth enamel may be  adapted to the mechanical demands of diet (Lucas et al.: Bioessays 30  2008 374-385). Here we review the applicability of that model by  examining existing data on the food mechanical properties and enamel  morphology of great apes (Pan, Pongo, and Gorilla). Particular attention  is paid to whether the consumption of fallback foods is likely to play a  key role in influencing great ape enamel morphology. Our results  suggest that this is indeed the case. We also consider the implications  of this conclusion on the evolution of the dentition of extinct  hominins." (Constantino et al. 2009:653)
  Learn more about this functional adaptation.
  • Constantino PJ; Lucas PW; Lee JJ; Lawn BR. 2009. The influence of fallback foods on great ape tooth enamel. Am J Phys Anthropol. 140(4): 653-60.
  • 2009. Among apes, teeth are made for the toughest times. EurekAlert! [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gorilla gorilla

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2473-09|D38114|Gorilla gorilla| GACCGCTGATTATTCTCTACAAACCATAAAGATATTGGAACACTATATCTACTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCCCTA---AGTCTCCTTATTCGAGCAGAACTTGGTCAACCAGGCAACCTTCTAGGTAAC---GATCACATCTATAATGTTATCGTCACAGCCCATGCGTTCGTAATAATTTTCTTCATAGTAATGCCTATCATAATCGGAGGCTTTGGCAACTGGCTAGTACCCTTAATA---ATTGGTGCCCCCGACATGGCATTCCCCCGCATAAACAACATAAGCTTCTGACTCCTTCCCCCTTCTTTCCTACTTCTGCTCGCATCCGCTATAGTAGAAGCCGGCGCAGGGACTGGTTGGACAGTCTACCCTCCCTTAGCAGGAAATTATTCCCACCCCGGAGCTTCTGTAGACCTA---ACCATTTTTTCCCTACACCTAGCAGGCATCTCCTCTATTCTAGGGGCCATCAACTTCATTACAACAATCATCAATATAAAACCCCCCGCCATAACCCAATACCAAACACCCCTTTTCGTCTGATCCGTCCTAATCACAGCAGTCTTACTTCTTCTATCTCTCCCAGTACTAGCTGCT---GGAATTACCATATTATTAACAGACCGTAACCTCAACACCACCTTTTTCGACCCAGCCGGAGGAGGAGATCCTATCCTATACCAACACTTATTCTGATTTTTTGGACACCCCGAAGTTTACATTCTAATCCTACCAGGCTTCGGAATAATCTCCCACATTGTAACTTATTACTCCGGAAAAAAA---GAACCATTCGGATATATAGGTATAGTCTGAGCTATAATATCAATTGGTTTCCTGGGATTTATTGTGTGAGCCCACCACATATTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gorilla gorilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Species: 30
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A4cde

Version
3.1

Year Assessed
2008

Assessor/s
Walsh, P.D., Tutin, C.E.G., Oates, J.F., Baillie, J.E.M., Maisels, F., Stokes, E.J., Gatti, S., Bergl, R.A., Sunderland-Groves, J. & Dunn. A.

Reviewer/s
Mittermeier, R.A., Williamson, E.A. & Butynski, T.M. (Primate Red List Authority)

Contributor/s

Justification
This taxon is classified as Critically Endangered under criterion A4, a population reduction of more than 80% over three generations (where a generation is estimated as 22 years, D. Caillaud unpubl.). The listing is based on exceptionally high levels of hunting and disease-induced mortality (over 90% in some large remote areas, including the second largest protected population at Minkébé), which combined are estimated to have caused its abundance to decline by more than 60% alone over the last 20 to 25 years. Most protected areas have serious poaching problems and almost half of the habitat under protected status has been hard hit by Ebola. Commercial hunting and Ebola induced mortality are both continuing (even accelerating), threats that are not readily mitigated. If the current Ebola epizootic continues at the same rate and trajectory, then the decline in Western Gorilla abundance in all protected areas is projected to be on the order of 45% just for the 20-year period spanning 1992 to 2011 (not accounting for other threat factors such as hunting). Furthermore, gorilla reproductive rates are extremely low (maximum intrinsic rate of increase about 3%, Steklis and Gerald-Steklis 2001). Therefore, even an immediate cessation of Ebola mortality and a drastic reduction in the rate of hunting (neither of which seem likely) would not result in rapid population recovery. Rather, under the most optimistic scenarios, population recovery would require on the order of 75 years (Walsh et al. 2003). Much sooner, perhaps 20 to 30 years into the future, habitat loss and degradation from agriculture, timber extraction, mining, and possibly climate change will become a major threat. Thus, a population reduction of more than 80% over three generations (i.e., 66 years, 1980 to 2046) is likely.

History
  • 2007
    Critically Endangered
  • 2000
    Endangered
  • 1996
    Endangered
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1988
    Vulnerable
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Western gorillas are critically endangered in the wild. Population estimates for G. gorilla are unavailable, but are almost certainly less than the often cited figure of 95,000. Estimates of G. gorilla diehli populations are from 250 to 300 individuals.

Even though all eight countries with wild gorilla (Gorilla) populations have laws governing their capture and hunting, in none of them are the laws strictly enforced. As recently as fifteen years ago, there was active trade in gorilla skulls from the Volcano National Park in Rwanda. Today, countries such as Rwanda are implementing educational, conservation, and tourism programs in an effort to demonstrate to the local population the value of the native flora and fauna. Still, long-term ecological stability is sacrificed for shorter term economical gain in many areas. Nevertheless, hunting is a relatively minor concern compared to deforestation and the effects of political unrest.

The forests which the gorillas depend on in Africa are slowly being cut down for timber and to make way for agricultural and, in some cases, industrial development. As a case in point, Nigeria was home to gorillas twenty-five years ago. Today, gorillas have become extinct there and cattle-ranches cover what used to be gorilla habitat. Until human population growth is curbed in central Africa, particularly DRC, gorilla habitat is in danger of shrinking yet further and becoming dangerously scarce.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

  • October 11, 1999. "Convention on International Trade in Endangered Species of Wild Fauna and Flora" (On-line). Accessed November 9, 1999 at http://www.wcmc.org.uk:80/CITES/english/eap2fauna.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Gorilla gorilla , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Gorilla gorilla gorilla
Previous assessments have focused on habitat availability as the major predictor of gorilla abundance. Thus, the commonly cited figure of 95,000 western gorillas (Harcourt 1996) is based on an assumption that all intact habitat in Western Equatorial Africa contains gorillas at densities that were typical of Gabon in the early 1980s. However, habitat loss is not the major driver of ape decline in this region. Rather, recent surveys suggest that since the early 1980s, commercial hunting and outbreaks of the Ebola virus have virtually extirpated gorillas from a great deal of otherwise intact forest. Technical problems with the conversion of ape nest density to estimates of gorilla density preclude a rigorous estimate of range-wide gorilla abundance.

Gorilla gorilla diehli
Although gorillas in the Cross River region first became known to science in the early 20th century, little attention was paid to their conservation status until the late 1980s (Harcourt et al. 1989). Early reports had referred to their precarious situation, but little had been done to thoroughly examine their distribution and abundance, or to protect the remaining population and habitat (Anon 1934, Critchley 1968, March 1957). Intensive surveys over the last decade have found that approximately 250 to 300 G. g. diehli persist in a forested area of roughly 8,000 km². This estimate is of uncertain accuracy and is based primarily on nest counts and estimated range size. The gorillas are found in at least 10 localities (Groves 2002, Beamont 2004, Bergl 2006, Bergl and Vigilant 2007). Though the localities where the gorillas are found are geographically distinct, the majority of these areas are connected by forested land. Recent genetic evidence suggests that three subpopulations are present, but that these subpopulations do have limited reproductive contact (Bergl and Vigilant 2007). These localities are primarily rugged highlands, typically in areas relatively less disturbed by human activity. While there may be an ecological component to this distribution, the gorilla?s concentration in highland areas is almost certainly strongly influenced by human hunting pressure, which is more intense in the lowlands. Ebola has not been reported in the G. g. diehli population, but their close proximity to dense human populations puts them at high potential risk of acquiring human pathogens (Oates et al. 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Gorilla gorilla gorilla
There are two primary drivers of rapid western lowland gorilla decline: commercial hunting and the Ebola virus. Until the early 1980s, the interior of western lowland gorilla range included a series of vast, road-less blocks of forest where hunting access was extremely difficult and gorilla densities were high. Since then improvements in transportation infrastructure, devaluation of the regional currency, declining oil stocks, and timber depletion in other tropical regions have led to an explosion in mechanized logging. Regional timber production nearly doubled between 1991 and 2000 (Minnemeyer et al. 2002). Vast tracts of previously inaccessible forest have recently been penetrated by logging roads, which provide commercial hunters ready access to remote areas with high ape densities, and to markets. Logging vehicles are also used to transport bushmeat, and logging employees eat more bushmeat than do local villagers.

The gorillas? very low reproductive rates (3% maximum observed rate of population increase, Steklis and Gerald-Steklis 2001) mean that even low levels of hunting are enough to cause population decline. Consequently, the logging boom has caused a rapid crash in gorilla numbers. For example, Gabon experienced an estimated 56% decline in ape abundance from 1983 to 2000, most of which was attributed to hunting (Walsh et al. 2005). Given that Gabon is the least heavily human populated country in the region, hunting impact is likely as high or higher in other range states. The threat posed by logging promises to continue and even intensify in the foreseeable future. Rates of timber production in the region are increasing (Minnemeyer et al. 2002), in the case of Gabon exponentially (Figure 1). Profits in the industry are derived largely through exploitation of previously unlogged areas rather than sustainable harvesting in older concessions. The current trajectory predicts that the last remaining tracts of inaccessible forest will be opened to logging in the next 10 to 20 years.

Follow the link below for Figure 1: Roundwood production in Gabon (1980-2005).

The second major driver of rapid gorilla decline is disease, specifically the Ebola virus. Since the early 1990s, Ebola has caused a series of massive gorilla and chimpanzee die-offs in remote forest blocks at the heart of their range. Outbreaks were first noted in 1994 in the Minkébé forest block of northern Gabon (Huijbregts et al. 2003). Before Ebola?s arrival, what is now Minkébé National Park held what was probably the second largest protected gorilla and chimpanzee population in the world. In 1996 Ebola emerged in the Lopé Reserve (now National Park) in central Gabon, in 2001 in the Mwagné forest block of eastern Gabon, in 2002 to 2003 in the adjoining Lossi forest block of north-west Congo, and in 2003 to 2005 in the Odzala National Park in north-west Congo (Figure 2). The Ivindo forest block of central Gabon was not monitored during the outbreak period, but it lies directly adjacent to the 1996 human outbreak zone around Booué and recent observations suggest an ape die-off there too.

Follow the link below for Figure 2: Protected areas with important western lowland gorilla populations.

Both phylogenetic analyses of the Ebola virus genome and analyses of the spatio-temporal pattern of outbreaks in humans and wild apes (Walsh et al. 2005, Lahm et al. 2006) suggest that these outbreaks were not isolated events but part of a spreading epizootic of Ebola in its reservoir host (probably bats, Leroy et al. 2005). Moving at about 40 to 45 km/year, this epizootic has for the last decade spread in an east/north-easterly direction across the region. Although continued spread is not guaranteed, the epizootic?s past spread rate has been highly consistent, making it possible to accurately predict the timing of the Odzala die-off well before it occurred (Walsh et al. 2003, 2005).

During Ebola outbreaks, gorilla mortality rates have been extremely high. During three different outbreaks at two different study sites, individually known social groups containing almost 600 gorillas were monitored. In all three outbreaks about 95% of known individuals died (Caillaud et al. 2006, Bermejo et al. 2007). Higher survival rates amongst solitary individuals suggest that most of the remaining 5% may be individuals who were never infected rather than resistant survivors (Caillaud et al. 2006). Nest surveys at four different sites exhibit an ?all or none? pattern of Ebola impact. Areas of 10,000 km² or more showing 95% declines in abundance transition abruptly into areas with little or no mortality (Bermejo et al. 2007, WCS and Government of Congo MEF unpublished data). These low ape densities are not reasonably attributed to hunting pressure as most of the remote survey zones had high ape densities just a few years before the declines were detected and because densities of other preferred target species (e.g., elephants and duiker) were still high after the Ebola outbreaks (Walsh et al. 2003, Bermejo et al. 2007). The proportion of habitat in the 95% mortality class varied amongst outbreak sites, from little or none at Lopé to the entire Mwagné survey zone (Table 1a). In Odzala National Park, which held what were by far the largest protected populations of gorillas and chimpanzees in the world, the outbreak zone covered about 58% of the park.

Follow the link below for Table 1a: Estimates of percent decline in gorilla abundance in six survey zones.

Table 1a contains estimates of the percent decline in gorilla abundance in each survey zone. In the Lossi and Odzala zones, extensive survey data allowed a fairly precise mapping of outbreak and non-outbreak zones. Therefore, the number presented for these two zones is based on the proportion of the survey zone in each outbreak class (Outbreak vs. NonOutbreak) and the assumption of 95% mortality in outbreak areas. This approach was not possible for the Mwagné and Minkébé sites where virtually the entire populations were wiped out, or for the Ivindo site where survey intensity was not high enough to precisely map outbreak and non-outbreak zones. For these sites, nest encounter rates for surveys conducted before Ebola emergence are compared with nest encounter rates after Ebola emergence (Pre-Ebola vs. Post-Ebola). No attempt was made to estimate % decline for Lopé because it was the only zone to be logged before Ebola arrival and the only area in which a substantial proportion of the survey zone has experienced high rates of hunting. This makes it difficult to discriminate Ebola impact from hunting impact. Therefore, for the purposes of this analysis, Ebola is assumed to have had zero impact at Lopé. Estimated declines in gorilla abundance for the five zones for which estimates have been made range from 56% at Odzala to more than 95% at Mwagné and Minkébé. When decline rates are averaged across all six zones (with the contribution of each zone weighted by its surface area) the mean decline is 74% (weighting by relative abundance makes no significant difference; see Table 1b). The assumption of zero impact at Lopé has a conservative effect on this mean value (see Table 1a and 1b for comparison).

Follow the link below for Table 1b: Estimates of percent decline in gorilla abundance in five survey zones.

These six protected areas account for 45% of the total protected area habitat (67,250 km²) in which significant western lowland gorilla populations were found before Ebola emergence (Table 2). If we assume that all major protected areas had the same pre-Ebola density, this implies that 33% of the total protected area population of western lowland gorilla (100*(0.45*0.26+0.55*1) = 33%) has been killed by Ebola just over the last 13 to 14 years. This estimate is highly conservative in that pre-Ebola density estimates for protected areas with Ebola impact were typically much higher than for protected areas without recorded Ebola impact.

Follow the link below for Table 2: Protected areas holding significant pre-Ebola outbreak populations of western lowland gorilla, and Ebola-induced declines. Note: more detailed tabular data to support the calculations are available upon request.

If the Ebola epizootic continues at the same rate and trajectory, it could reach most of the remaining protected areas with large populations of western lowland gorillas within the next 5 to 10 years. Six major protected areas (Boumba Bek, Nki, and Lobéké Reserves in Cameroon, Dzanga-Ndoki National Park in C.A.R., Nouabalé-Ndoki National Park and Lac Télé Reserve in Congo) lie in the wave?s path and account for 44.6% of the protected area habitat where Ebola outbreaks have yet to be documented. All six areas lie inside a 275 km radius from the 2004 Lossi outbreak site at Odzala National Park. Thus, if the epizootic wave continues to spread at its past rate it may move through all six sites by about 2011 (calculated as 2004 + (275 km/43 km/yr)). If all sites suffered declines of a magnitude similar to previous parks (i.e. 74%), this would represent a 32.6% decline in the unaffected protected area population (calculated as: 100*((area of habitat affected*mortality rate)/total habitat)). Combined with previous impact, this would constitute a 45.4% Ebola-induced decline of Western Gorilla abundance in all protected areas (Table 2) in a period of just 20 years (i.e., from 1992 to 2011), or about one generation length*. This estimate is conservative in that these six protected areas are more remote than the other unaffected parks and are, therefore, likely to hold a higher proportion of the western gorilla population than is predicted by their area. The decline estimate is also independent of any decline caused by other factors (e.g., hunting), which, as already noted, was the primary reason for a 56% decline in ape abundance from 1983 to 2000 in Gabon alone.

Timber extraction is the major source of forest clearance in western lowland gorilla range, which retains the highest percentage of forest cover in equatorial Africa (Minnemeyer et al. 2002). Logging is selective, regional deforestation rates average only about 0.4% per year (FAO 2001), and gorillas do well in secondary forest if hunting is controlled. Thus, forest clearance alone should not become a major threat to western lowland gorillas for at least two or three decades, by which time other causes, if left unchecked, will already have greatly depleted populations. Forest clearance for agriculture is a major threat in heavily populated coastal regions, particularly in Cameroon. However, these areas harbour only a tiny fraction (probably <5%) of remaining western lowland gorillas.

Finally, there are hints that climate change may pose a serious future threat. Most of the western gorilla range receives rainfall only slightly higher than the amount necessary to maintain closed canopy forest. The last few decades have seen a decline in mean rainfall and a lengthening of dry seasons (Giannini et al. 2003), which increase the risk of forest fires. If this drying trend continues, there is a risk that large scale forest fires will cause dramatic forest loss, as seen recently in Southeast Asia and South America (Cochrane 2003). This risk will be magnified if regional climate trends are reinforced by local scale forest clearance for agriculture and timber (Baidya Roy et al. 2005).

Details on calculation of generation time can be found in Appendix 1 (follow the link below for Appendix 1).

Gorilla gorilla diehli
The remaining population of G. g. diehli is small and fragmented, occurs mostly outside of protected areas (especially in Cameroon) and is surrounded by some of the most densely populated human settlements in Africa. This subspecies is at risk from its small size and associated increases in inbreeding and loss of genetic diversity. The lack of strictly protected areas throughout much of the range of G. g. diehli makes the future of sizeable portions of gorilla habitat uncertain. Conversion of forest for agriculture and grazing is occurring rapidly in many parts of the gorillas? range and the largest current protected area in which Cross River gorillas occur (the Okwangwo Division of Nigeria?s Cross River National Park) contains enclaves of human settlements whose farmlands have spread beyond their legal boundaries and threaten to divide the park into two. The construction and improvement of roads in both Cameroon and Nigeria also threatens to increase subdivision of the population. Though legal prohibitions against the killing of gorillas exist in Nigeria and Cameroon, enforcement of wildlife laws is often lax, and most protected areas suffer from poorly-controlled poaching. Although recent conservation efforts have reduced hunting of Cross River gorillas to a low level, the threat remains and the small size of the G. g. diehli population means that almost any level of hunting off-take is likely to be unsustainable and have a significant negative effect on population size.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Even though all eight countries with wild gorilla populations have laws governing their capture and hunting, the laws are not strictly enforced. The habitat of Western Lowland Gorillas is increasingly destroyed for timber, agricultural land and, in some cases, industrial development.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The decline in gorilla numbers is mainly attributed to the loss and degradation of their forest habitat, which has been relentlessly cleared to make way for agricultural and logging practices, and to the Ebola virus (6). From 1992 to 2007, it is thought that around one third of the total population found in protected areas was killed by this lethal virus (1). Increasingly, the trade in bushmeat is posing more of a threat to the survival of the species and cleared forests are ever more accessible to hunters. The demand for meat has increased from both road labourers and a growing urban market (7). Western gorillas are very susceptible to the illegal bushmeat trade, as gorilla meat is viewed as a symbol of wealth and prestige (8). Male gorillas will actively defend their females and offspring if their group encounters a threat, and this increases their chances of being killed by a hunter (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
National and international laws controlling hunting or capture of gorillas exist in all habitat countries, but enforcement of protective legislation is almost non-existent. G. gorilla is listed under Appendix I of CITES and in Class A of the African Convention. Conservation areas exist in most gorilla range states and several National Parks have been created recently specifically to protect great apes and other large mammals. Strongholds identified as exceptional priority areas for ape conservation and not yet affected by Ebola are: the Dja Conservation complex and Boumba-Bek/Nki complex in Cameroon, the Loango/Moukalaba-Doudou/Gamba complex in Gabon, the Lac Télé Likouala complex in RoC, and the Sangha Trinational complex of the Republic of Congo, Central African Republic and Cameroon (Tutin et al. 2005). National Parks offer no protection from Ebola and only one of these remaining gorilla strongholds (Loango/Moukalaba-Doudou/Gamba) is remote from recent epidemics (P. Walsh, unpubl.).

Urgent conservation needs include the effective implementation of protection laws. Conservation areas must be adequately protected and managed, and some additional areas should be gazetted. Surveys of outlier populations in Cameroon, Cabinda and the Democratic Republic of Congo are needed, as are conservation education programmes. Extensive resources are required to identify appropriate conservation actions in the face of the spread of Ebola. A better understanding of the spatial and temporal spread of the disease between and within species may allow development of a pro-active campaign to protect at-risk great ape and human populations through vaccination and/or the reinforcement of effective physical barriers (Walsh et al. 2005). Recommendations for reducing the negative impacts of selective logging on large mammals, including gorillas, have been formulated and applied in pilot zones (Elkan et al. 2006, Morgan and Sanz 2007), but considerable efforts are needed to establish partnerships with the logging industry such that protective measures are enforced, and concessions bordering National Parks are a priority. Finally, the poor understanding of the current size of the population of western gorillas must be addressed. Much of the western lowland gorilla's range has not been surveyed recently and survey methods have not been consistently reliable. Older survey data are particularly unreliable as Ebola and commercial hunting are known to have caused dramatic and rapid declines in affected areas (Tutin et al. 2005). New surveys using consistent methods as well as regular monitoring of populations in protected areas are urgently needed throughout the western gorilla's range. This will enable the conservation community to design and implement optimal conservation strategies in the face of this potent cocktail of threats.

A series of three workshops has identified priority actions for the conservation of G. g. diehli, and these have been formulated into an IUCN Action Plan (Oates et al. 2007). There are several cross-cutting actions which require attention throughout Cross River gorilla range, notably increasing conservation education and awareness, fostering improved community participation in conservation issues, increasing trans-boundary conservation activities such as joint patrols to control timber and bushmeat between the two countries, and further research. The most urgently-needed actions identified, which must be undertaken for any longer-term measures to be effective, are habitat protection and the control of hunting. In Nigeria the majority of the G. g. diehli population occurs within formal protected areas (Cross River National Park and Afi Mountain Wildlife Sanctuary), but in Cameroon none of the population is as yet protected in this way (although two areas are in process of establishment: Takamanda National Park and Kagwene Gorilla Sanctuary). Further areas, including migration corridors, need to be brought under conservation management to increase the chances for the long-term survival of a viable population of Cross River gorillas, and the effectiveness of existing management improved.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The western gorilla is listed on Appendix I of the Convention on International Trade in Endangered Species (CITES) (3), and there has been a decline in international trade of the species (4). The United Nations Environmental Program (UNEP) has recognised the urgent need to protect our closest relatives and has established a Great Ape Survival Project (GRASP) aimed at identifying the conservation initiatives required to secure the future of the apes and at obtaining political support and funding to allow these to be achieved (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Western gorillas have been known to raid native plantations, destroying the crops and are considered a crop pest in western Africa.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Western gorillas have been used in medical study of human diseases and behavioral, linguistic, and psychological studies. The mental capacity of gorillas is still being explored. Western gorillas show more persistence and memory retention in problem solving studies than do their, more excitable, near relatives, chimpanzees (Pan). Western gorillas are more likely to perform a task out of interest than to earn a reward. After some success with chimpanzees, researchers in the mid-1970s turned their attention to communicating with gorillas using sign language, and one gorilla, Koko, mastered more than 1000 signs.

Western gorillas are also hunted illegally in Africa for their skins and their meat, which is served in restaurants of large towns. In addition, the capture and sale of gorillas for zoos, while reprehensible to many, is undoubtedly economically profitable.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Western gorilla

The western gorilla (Gorilla gorilla) is a great ape and the most populous species of the genus Gorilla.[3]

Contents

Taxonomy

Nearly all of the individuals of this taxon belong to the western lowland gorilla subspecies (G. g. gorilla) whose population is approximately 95,000 individuals.[2] There are thought to be between 250 and 300 of the only other western gorilla subspecies, the Cross River gorilla (G. g. diehli).[4][5]

Physical description

Compared to its eastern cousin, the western gorilla is slightly smaller, weighs less, has a more slender form, and has lighter colored fur. The western lowland gorilla can be brown or greyish with a yellowish forehead. It also has an overhanging tip on its nose, which the eastern gorilla does not have. Males measure 160–170 cm and weigh 140 kg[6]. Females measure 120–140 cm and weigh 60–80 kg. The western gorilla is the smaller species of the gorilla. The Cross River gorilla differs from the western lowland gorilla in both skull and tooth dimensions. It is also about 10–15 cm taller and 20–35 kg heavier, but still smaller and lighter than the mountain gorilla and the eastern lowland gorilla, latter the largest subspecies of the gorilla and the largest living primate.

A skull of a male
Male western gorilla

Behavior and ecology

Western gorillas live in groups that vary in size between 2 and 20 individuals, composed of at least one male, several females and their offspring. A dominant male silverback heads the group, with younger males usually leaving the group when they reach maturity. Females transfer to another group before breeding, which begins at eight to nine years old; they care for their young infant for the first three to four years of its life. There is therefore a long interval between births, which partly explains the slow population growth rates that make the western gorilla so vulnerable to poaching. Due to the long gestation time, long period of parental care, and infant mortality, a female gorilla will only give birth to an offspring that survives to maturity every six to eight years. Gorillas are long-lived and may survive for as long as 40 years in the wild. A group's home range may be as large as 30 square kilometres but is not actively defended. Wild western gorillas are known to use tools.[7]

Western gorillas have a diet high in fiber, including leaves, stems, fruit, piths, flowers, bark, invertebrates, and soil. The frequency of which each of these are consumed depend on the particular gorilla group and the season. Furthermore, different groups of gorillas eat differing numbers and species of plants and invertebrates, suggesting they have a food culture. Fruit comprises most of the gorillas' diet when it is abundant, directly influencing the western gorillas foraging and ranging patterns. Fruits of the generas Tetrapleura, Chrysophyllum, Dialium, and Landolphia are favored by the gorillas. Low-quality herbs, such as leaves and woody vegetation, are only eaten when fruit is scarce. In the dry season from January to March, when fleshy fruits are few and far between, more fibrous vegetation such as the leaves and bark of the low-quality herbs Palisota and Aframomum are consumed. Of the invertebrates consumed by the gorillas, termites and ants make up the majority. Caterpillars, grubs, and larvae are also consumed in rarity.

Some ethnographic and pharmacological studies have suggested a possible medicinal value in particular foods consumed by the western gorilla. The fruit and seeds of multiple Cola (plant) species are consumed. Given the low protein content, the main reason for their consumption may be the stimulating effect of the caffeine in them. Western gorillas inhabiting Gabon have been observed consuming the fruit, stem, and root of Tabernanthe iboga, which due to the compound ibogaine in it that acts on the central nervous system, produces hallucinogenic affects. It also has effects comparable to caffeine. [8] There is also evidence for medicinal value for the seed pods of Aframomum melegueta in lowland gorilla's diets, which seem to have some sort of cardiovascular health benefit for lowland gorillas, and are a known part of the natural diet for many wild populations.[9]

A study published in 2007 in the American Journal of Primatology announced the discovery of the fighting back against possible threats from humans.[10] They "found several instances of gorillas throwing sticks and clumps of grass.[11]" This is unusual, because gorillas usually flee and rarely charge when encountered by humans.

Conservation status

The World Conservation Union lists the western gorilla as critically endangered, the most severe denomination next to global extinction, on its 2007 Red List of Threatened Species. It is thought that the Ebola virus might be depleting western gorilla populations to a point where it might become impossible for them to recover, and the virus decimated populations in protected areas by one-third from 1992 to 2007.[2][3] Poaching, commercial logging and civil wars in the countries that compose the western gorillas' habitat are also threats.[3] It is projected that it will decline by >80% over three generations streching from past to present: 1980–2046, giving the species generation length of 22 years.[citation needed]

In the 1980s, a census taken of the gorilla populations in equatorial Africa was thought to be 100,000.[12] Researchers adjusted the figure after years of poaching and deforestation had reduced the population to approximately 50,000.[12] Surveys conducted by the Wildlife Conservation Society in 2006 and 2007 found more than 100,000 previously unreported gorillas have been living in the swamp forests of Lake Tele Community Reserve and in neighbouring Marantaceae (dryland) forests in the Republic of the Congo.[12] With the new discovery, the current population of western lowland gorillas could be around 150,000–200,000. However, the gorilla remains vulnerable to Ebola, deforestation, and poaching.[12]

Estimates on the number of Cross River gorillas remaining is 250–300 in the wild, concentrated in approximately 9-11 locations.[4] Recent genetic research[13] and field surveys suggest that these locations are linked by the occasional migration of individual gorillas. The nearest population of western lowland gorilla is some 250 km away. Both loss of habitat and intense hunting for bushmeat have contributed to the decline of this subspecies. A conservation plan for the Cross River gorilla was published in 2007 and outlines the most important actions necessary to preserve this subspecies.[14] Richard Black of the BBC has reported[15] that the government of Cameroon has created the Takamanda National Park on the border with Nigeria, as an attempt to protect these gorillas. The park now forms part of an important trans-boundary protected area with Nigeria’s Cross River National Park, safeguarding an estimated 115 gorillas—a third of the Cross River gorilla population—along with other rare species.[16] The hope is that the gorillas should be able to move between the Takamanda reserve in Cameroon over the border to Nigeria's Cross River National Park.

2008 discovery

In mid 2008, researchers discovered as many as 125,000 previously-undiscovered gorillas in the Republic of Congo. This discovery could more than double the known population of the animals, though the effect that the discovery will have on the gorillas' conservation status is currently unknown.[17]

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 181-182. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ a b c Walsh, P. D., Tutin, C. E. G., Oates, J. F., Baillie, J. E. M., Maisels, F., Stokes, E. J., Gatti, S., Bergl, R. A., Sunderland-Groves, J. & Dunn, A. (2008). Gorilla gorilla. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ a b c Planet Of No Apes? Experts Warn It's Close CBS News Online, 2007-09-12. Retrieved 2008-03-22.
  4. ^ a b Oates, J. F., Bergl, R. A., Sunderland-Groves, J. & Dunn, A. (2008). Gorilla gorilla ssp. diehli. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 26 April 2012.
  5. ^ "Animal Info - Gorilla". AnimalInfo.org. http://www.animalinfo.org/species/primate/gorigori.htm. Retrieved 2007-09-12. 
  6. ^ Williamson, E.A. and Butynski, T.M. (2009) Gorilla Gorilla In: Butynski, T.M. (Ed) The Mammals of Africa Volume 6. Elsevier Press, In Press
  7. ^ "PLOS Journal "First Observation of Tool Use in Wild Gorillas"". Biology.plosjournals.org. 2005-10-01. doi:10.1371/journal.pbio.0030380. http://biology.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pbio.0030380. Retrieved 2009-07-03. 
  8. ^ Caldecott, J., Miles, L., eds (2005) World Atlas of Great Apes and their Conservation. Prepared at the UNEP World Conservation Monitoring Centre. University of California Press, Berkeley, USA.
  9. ^ "Gorilla diet protects heart: grains of paradise". Asknature.org. February 20, 2012. http://www.asknature.org/strategy/23ec7287a4207c835d8bf162ff26afcb. Retrieved April 18, 2012. 
  10. ^ Wittiger, L. and Sunderland-Groves, J. 2007. Tool use during display behavior in wild cross river gorillas. American Journal of Primatology 69: 1307.
  11. ^ Science Daily
  12. ^ a b c d CNN (2008-08-05). "More than 100,000 rare gorillas found in Floral Park". CNN. http://www.cnn.com/2008/WORLD/africa/08/05/congo.gorillas/index.html. Retrieved 2008-08-05. 
  13. ^ Bergl, R. A. and Vigilant, L. 2007. Genetic analysis reveals population structure and recent migration within the highly fragmented range of the Cross River gorilla (Gorilla gorilla diehli). Molecular Ecology 16: 501–516.
  14. ^ Regional Action Plan for the Conservation of the Cross River Gorilla
  15. ^ BBC News website Protection boost for rare gorilla 28th November 2008 http://news.bbc.co.uk/1/hi/sci/tech/7754544.stm
  16. ^ New National Park Protects World's Rarest Gorilla Newswise, Retrieved on November 28, 2008.
  17. ^ Font size Print E-mail Share 33 Comments (2008-08-05). "Thousands Of Rare Gorillas Found In Congo". Cbsnews.com. http://www.cbsnews.com/stories/2008/08/05/tech/main4321037.shtml. Retrieved 2009-07-03. 

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!