Overview

Distribution

Range Description

A widespread species occurring in Namibia, Botswana and South Africa (Corbet and Hanks 1968; Skinner and Chimimba 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The short-eared elephant shrew mostly inhabits Namibia, southern Botswana, and South Africa.

(Shaw, 1983)

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Compared to members of the other elephant shrew genus, the short-eared elephant shrew has shorter and rounder ears and lacks the pale rings around the eyes that are typical of those animals. The tail is hairy, with a visible gland on the underside. On the hind feet, the first digit is small and has a claw. The fur is usually long, soft, and is an orange, brown or grayish color on top and a lighter color on the underside. Adults often weigh between 40-50 grams with 100-110mm long bodies and 97-130mm long tails. Defining skull features include an enlarged auditory bullae and the appearance of three upper incisors, as well as a short rostrum and crowded teeth. Females also have six mammae.

(Rathbun & Fons) (Unger, online)

Range mass: 40 to 50 g.

Range length: 100 to 110 mm.

Average basal metabolic rate: 0.292 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Round-Eared Sengi occupies arid areas, such as deserts, dry grasslands and shrublands (Skinner and Chimimba 2005). Home range areas can be up to one square kilometer. The presence of this sengi is often indicated by long, straight trails composed of small oval bare spots where it lands while racing along the paths. The trails are used to swiftly travel between preferred areas within its home range (Sauer and Sauer 1972).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The animal only lives in desert and semi-desert areas of the countries in which it is found. It hides in the sparse grass cover or bushes that are a part of these dry areas. They also burrow into the sand.

(Smith, 1829)

Terrestrial Biomes: desert or dune ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Short-eared elephant shrews typically eat insects, usually termites and ants, and other small invertebrates. They may also feed on plant parts such as roots, shoots, and berries.

(Unger & Kratochvil, 1999)

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: leaves; roots and tubers; fruit

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

These elephant shrews help move soil around to create their burrows as well as recycle vacant burrows left from rodent species.

(Unger, online)

Ecosystem Impact: soil aeration

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The animal usually jumps from bush to bush during the day or basks in the sun, but if harassed by diurnal predators, such as hawks, it switches its schedule and looks for food at dusk, hiding in bushes during the day. Also, by using their forelimbs these animals can dig tunnels very rapidly to quickly escape predators. Few predators prey on the young because the young mature and leave the nest shortly after birth.

(Lincoln Park Zoo, online) (Smith, 1829)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Macroscelides proboscideus is prey of:
Accipitridae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Macroscelides proboscideus preys on:
non-insect arthropods
Arthropoda
Insecta

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

In the wild, these animals only live for 1-2 years. In captivity they can live as long as 3-4 years.

(Unger, online)

Range lifespan

Status: wild:
1 to 2 years.

Range lifespan

Status: captivity:
3 to 4 years.

Average lifespan

Status: captivity:
8.7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8.7 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The breeding season is in the warm, wet months of August and September. A female may have many pregnancies during one breeding season.  (Shaw, 1934)

Mating System: monogamous

Gestation for these animals is typically about 56 days and only two young are born, sometimes one. They are born in a very precocial state; they can run within a few hours after birth, are large in size, and are born with hair and their eyes open. Babies are weaned at 16-25 days and reach sexual maturity after about 43 days. (Rathbun & Fons)

Breeding season: August and September

Range number of offspring: 1 to 2.

Average number of offspring: 2.

Average gestation period: 56 days.

Range weaning age: 16 to 25 days.

Average age at sexual or reproductive maturity (female): 43 days.

Average age at sexual or reproductive maturity (male): 43 days.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 7 g.

Average gestation period: 65 days.

Average number of offspring: 1.6.

Average age at sexual or reproductive maturity (female)

Sex: female:
44 days.

The female does not make a nest for the young; however, she will find a sheltered area and give birth to the young in it. The mother does not guard her young and is gone from the litter most of the time, coming back once a day to feed the young. (Smith, 1829)

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macroscelides proboscideus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0101-06|AJ421452|Macroscelides proboscideus| AACCGCTGACTATTCTCAACCAATCACAAAGACATTGGTACTTTATACTTAATTTTTGGAACCTGGGCAGGCATGGTAGGTACCGCATTG---AGCATTCTTATCCGAGCCGAACTAGGTCAACCAGGCGCTCTATTAGGCGAT---GACCAAATCTATAATGTAATTGTTACAGCTCATGCGTTCGTAATGATTTTCTTCATAGTAATACCAATTATGATCGGAGGATTTGGAAACTGACTTGTGCCTTTAATA---ATTGGAGCTCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTATTACCACCATCCTTTCTCCTACTATTAGCTTCCTCAATGGTGGAGGCTGGAGCTGGTACGGGTTGAACCGTCTACCCCCCATTAGCAGGCAATCTAGCCCATTCTGGTGCATCAGTTGACATA---ACCATTTTCTCCCTGCACTTAGCCGGAGTCTCATCCATTCTTGGTGCGATTAATTTCATCACAACAATTATTAACATAAAACCACCCGCTATATCTCAATATCAGACACCTTTATTTGTGTGGTCTGTTCTCATTACAGCAGTCCTTCTACTTTTATCACTCCCCGTCCTAGCAGCT---GCCATTACTATACTTTTAACAGATCGAAACCTTAATACCTCTTTCTTTGATCCTGCAGGAGGAGGAGACCCTATTCTGTACCAACACCTCTTCTGATTCTTTGGACATCCTGAAGTTTATATCCTAATCCTTCCTGGATTTGGTATAATTTCCCATATTGTAACCTACTACTCAGGAAAAAAA---GAACCATTTGGATATATGGGGATAGTATGAGCCATAATATCAATTGGCTTTTTAGGCTTTATCGTATGAGCCCACCACATATTTACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macroscelides proboscideus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Stuart, C., Perrin, M., FitzGibbon, C., Griffin, M. (IUCN SSC Afrotheria Specialist Group) & Smit, H. (Stellenbosch University)

Reviewer/s
Rathbun, G. (Afrotheria Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Justification
Although this species is not locally abundant, it is widespread in suitable habitats over an area considerably greater than 500,000 km². Because it occupies habitats that are very arid that will not support most development without the availability of water, there are no known threats to the vast majority of the habitats occupied by the Round-eared Sengi. Areas close to rivers or reliable sources of water may have been developed, or may be developed in the future, as agricultural and urban areas. For example, a narrow area adjacent to and along the Orange River between Namibia and South Africa has been developed, but this is a relatively small area compared to the overall distribution of the Round-eared Sengi. Relatively small areas also may be impacted by mineral extraction activities, such as around the town of Springbok in South Africa. Again, this disturbance is confined to a relatively small area compared to the overall distribution of the species. Past, current, and future development in this region of Africa is not expected to have a significant impact on this sengi or its habitats. On the other hand, bush encroachment and desertification, especially related to localized intensive goat and sheep grazing, might adversely alter habitats that these sengis occupy, and these processes should be monitored for possible negative impacts on sengi populations. The species is thus listed as Least Concern.

History
  • 2006
    Least Concern
    (IUCN 2006)
  • 2003
    Least Concern
    (IUCN 2003)
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Due to destruction of its habitat, this species is labeled “vulnerable” by the IUCN.

(Shaw, 1983)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is believed that over much of its range its numbers are relatively low (Corbet and Hanks 1968; Skinner and Chimimba 2005). There are no data on population dynamics of this species, but it is expected that populations will vary greatly in the arid habitats that it occupies, and there are no reasons to believe that these variations, if they indeed occur, are abnormal.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no known major threats to the species. Habitat modification to relatively small areas may occur near rivers and human population centres due to small-holder and industrial agriculture, mineral extraction, and urban development. Changes in habitats due to desertification and bush encroachment may adversely alter habitats for sengis, but at present these changes do not appear widespread or serious.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in protected areas. Because of the very minor conservation problems facing this taxon, no conservation measures are needed or recommended at present or in the foreseeable future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Possible helpful soil movement from burrowing activity.

(Unger, online)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Short-eared Elephant Shrew

The Short-eared Elephant Shrew (Macroscelides proboscideus), or Round-eared Sengi or Round-eared Elephant Shrew, is a species of elephant shrew in the Macroscelididae family. It is found in Botswana, Namibia, and South Africa. Its natural habitats are subtropical or tropical dry shrubland, subtropical or tropical dry lowland grassland, and hot deserts.[2] They eat insects, shoots, and roots. Their gestation period is 56 days. The Short-eared Elephant Shrew is the only species in its genus (monotypic), but is still grouped with the soft-furred (non-giant) elephant shrews[3].

Elephant-shrews are among only a handful of monogamous mammals, making them a model group for the study of monogamy. The Short-eared Elephant Shrews have been studied for their mate guarding behavior[4].

References

  1. ^ Schlitter, Duane A. (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M., eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 83. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ a b Stuart, C., Perrin, M., FitzGibbon, C., Griffin, M. & Smit, H. (2008). Macroscelides proboscideus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 December 2008.
  3. ^ California Academy of Sciences. Elephant-shrews or Sengis: Macroscelidea. http://research.calacademy.org/research/bmammals/eshrews/index.html
  4. ^ Bernard, R. T. F., G. I. H. Kerley, T. Doubell and A. Davison 1996. Reproduction in the round-eared elephant shrew (Macroscelides proboscideus) in the southern Karoo, South Africa. Journal of Zoology, London, 240 233-243.

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!