Overview

Comprehensive Description

Description

Stocky, rabbit-like mammal with short ears and no external tail. Upper parts gray through gray-brown to ocher, flanks and underparts, including inside of limbs and throat, paler and buffish. Large glands on back sometimes surrounded by more yellow-orange hair, but this feature is variable. Coat short and dense, liberally scattered with much longer, touch-sensitive hairs. Feet distinctive: forefoot with four very short toes; hind feet with three, one of which is elongat­ed, separated from the others with a curious, curved claw, and used as a grasping toe. Neck very short giving the impression that the head is just stuck straight onto the body. Snout pointed but short. Nasal region naked and black. Whiskers well-developed and black. Eyes rather large and dark with pale patch often visible above eye. Ears small and rounded with paler patch behind base. External tail absent.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The species is found throughout sub-Saharan Africa and north-east Africa, being discontunously distributed from Senegal through southern Algeria (isolated population), Libya and Egypt (east of the Nile R.) to central and southern Africa (excluding the Congo Basin forests) (Olds and Shoshani 1982; Hoeck and Bloomer in press). They also extend to the Arabian Peninsula, mainly in the west, and to Lebanon, Jordan, and Israel (Olds and Shoshani 1982; Harrison and Bates 1991; Shoshani 2005). Reports of the occurrence of this species in Turkey are in error, and there is no evidence for its current or historical occurrence in this country (Kryštufek and Vohralík 2001). Its occurrence in Syria also has not been confirmed (D. Kock pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Procavia capensis occurs throughout most of Africa and the Arabian Peninsula with the exception of the Congo basin and Madagascar. It is the most arid-adapted of hyrax species, and its range includes dry mountainous regions in the Namib, Sahara, and Arabian deserts.

Biogeographic Regions: ethiopian (Native )

  • Bartholomew, G., M. Rainy. 1971. Regulation of Body Temperature in the Rock Hyrax, Heterohyrax brucei. Journal of Mammalogy, 52: 81-95.
  • Estes, R. 1991. The Behavior Guide to African Mammals. Berkeley: The University of California Press.
  • Hoeck, H. 1975. Differential Feeding Behaviour of the Sympatric Hyrax Procavia johnstoni and Heterohyrax brucei. Oecologia, 22: 15-47.
  • Olds, N., J. Shoshani. 1982. Mammalian Species Procavia capensis. American Society of Mammalogists, 171: 1-7.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

46 records. Latest 2009 (South Sinai).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Narrow (syriaca in Sinai, ruiceps in Eastern Desert). AOO=163.8 km². EOO=171659 km². 7 locations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Narrow (sub-Saharan Africa,  through northeast  to Syria, Turkey and the Arabian peninsula; isolated populations in Algeria and Libya).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Hyraxes are the smallest of the subungulate mammals and are similar in appearance to woodchucks. Members of this species have a single pair of long, strong, tusk-like incisors, and their molars are similar to the cheek teeth of rhinoceroses. Total length for adults ranges from 305 to 550 mm, and tail length ranges from 11 to 24 mm. Hindfoot length ranges from 65 to 76mm, and ear length ranges from 27 to 38 mm. These hyraxes are heavily built for their size, weighing as much as 4.3 kg. Males (4 kg) are slightly larger than females (3.6 kg) and have blunter features and thinner bodies with thicker necks than females. The tusks of males are larger and sharper than those of females. Males also have a larger larynx and larger guttural pouches, which help to amplify their territorial calls. Hyrax eyes contain a special membrane called the umbraculum that is thought to shield the eye from the sun.

The forefeet of Procavia capensis have four toes and are plantigrade, while the hindfeet have three toes and are semi-digitigrade. All of the toes have rounded nails resembling hooves, except the inside rear toe, which is equipped with a claw that is used in grooming. Procavia capensis has mesaxonic feet in which the plane of symmetry passes through the third digit. The soles of the feet have large, black pads that are moistened by sweat glands, increasing their cohesion to rocky substrates.

The coat of Procavia capensis is dense and rough, with a thick undercoat and long guard hairs scattered throughout. Long, black vibrissae, used as haptic receptors, are found on the back and around the mouth. Pelage color is highly variable among subspecies, ranging from gray, to yellow-brown, to dark brown. The dorsum is usually darker than the flanks, and the venter tends to be a paler cream-color. In the cape region of Africa, pelage color corresponds with environmental moisture; animals living in wetter areas have darker coats, and those living in more arid regions have paler coats. A patch on the dorsum is surrounded by longer hairs in a contrasting color that may be black, yellow, or orange. Underneath this patch is a bare spot containing a dorsal gland specific to hyraxes that secretes pheromones, which are likely used to mark rocks and help young imprint on their mother. Pheromone production is most pronounced during mating season.

Range mass: 4.3 (high) kg.

Average mass: 3.8 kg.

Range length: 305 to 550 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes shaped differently; ornamentation

Average basal metabolic rate: 4.954 W.

  • Skinner, J., C. Chimimba. 2005. The Mammals of the Southern African Sub-region. Cambridge: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

ssp syriaca length 35-57 cm, ssp ruiceps 46-48 cm and weight 4.3 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Taxonomy

Currently only a single sp of Procavia is recognised. Osborn & Helmy (1980) identiied ssp ruiceps Hemprich & Ehrenberg in the Eastern Desert, and ssp syriaca Schreber in Sinai. 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Rock Hyraxes occupy a wide range of habitats, from arid deserts to rainforest, occurring from sea level to 4,300 m on Mount Kenya; they are typically associated with rocky outcrops, cliffs or boulders (Hoeck and Bloomer in press). They often occur in association with Bush Hyrax Heterohyrax brucei (Hoeck 1975; Barry and Mundy 1988). The diet comprises a variety of grasses, forbs and shrubs, with a predilection for new shoots, buds, fruits and berries (Hoeck and Bloomer in press). A comprehensive review of biology and literature is found in Olds and Shoshani (1982) and Hoeck and Bloomer (in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Procavia capensis is commonly found in arid land habitat including deserts, savannas and scrub forests. It lives in rocky areas with moderate vegetative cover and many rock crevices and cavities, the latter of which are used as shelter. Although it does not burrow, it does inhabit abandoned burrows, including those of aardvarks and meerkats. Even when traveling between suitable habitats, rock hyraxes do not normally stray from areas with some form of cover or refuge.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; scrub forest

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Entirely restricted to rocky areas with cliffs and availability of acacia.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Rock hyraxes are primarily grazers and forage on many different plant species per foraging bought; however, regional preferences have been documented. For example, giant lobelia and certain daisy species are preferred on the west slope of Mt. Kenya, swampy vegetation is eaten close to the bottoms of valleys, and lowland forage includes new shoots, fruits, berries, and figs. Grasses make up 78% of the diet during the wet season, but only 57% during the dry season. When conditions are moist, either during the wet season or after a rainfall, rock hyraxes show a preference for new shoots, buds, and leaves. During drought, they may eat coarse material such as bark, lichens, and liverworts. Daily food consumption varies with body weight, and plant water content has a significant influence on the amount of food that is ingested. Rock hyraxes may travel up to 60 m from their burrows to forage but may travel further during a drought. When grazing, individuals maintain their spacing and remaining vigilant for potential predators.

The feeding habits of rock hyraxes are comparable to those of ungulates. Giraffes and elephants are their most likley competitors for food. Hyraxes can feed very rapidly and entire colonies may spend less than one hour per day feeding. Most feeding is concentrated in two feeding periods of about twenty minutes: one about three hours after sunrise and the other about two hours before sunset. Rock hyraxes do not manipulate or carry their food, and they use their feet only to reach or hold twigs. While foraging, they often hold their head at a 90˚ angle to best utilize their wide gape, and they bite off large amounts of vegetation. By eating large amounts of food quickly, and spending most of their time resting, rock hyraxes are able to survive on resources too sparse or nutrient-poor to support more active mammals of a comparable size.

Plant Foods: leaves; wood, bark, or stems; fruit; bryophytes

Primary Diet: herbivore (Folivore )

  • Sale, J. 1966. Daily food consumption and mode of ingestion in the hyrax. J. E. Afr. Nat. Hist. Soc., 25: 215-224.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Rock hyraxes are the dominant herbivores in rocky areas throughout their geographic range. They are preyed upon by a number of different vertebrate species and are known to host up to 25 species of lice.

Commensal/Parasitic Species:

  • lice (Pthiraptira)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Except in high mountainous areas, leopards are the main predator of Procavia capensis. Hyraxes may also be preyed upon by snakes (e.g., Egyptian cobras and puff adders), eagles (e.g., Verreaux’s eagles and martial eagles), owls, jackals, African wild dogs, and various cat species (e.g., servals, caracals and lions). Neonates are sometimes preyed upon by mongooses. Procavia capensis evades predators by staying alert and remaining close to cover while foraging. Individuals immediately respond to the alarm calls of territorial males and to the calls of other species such as bush hyraxes and some birds. Hyraxes also avoid predators by using burrows that are smaller in diameter than most predators in their habitat. They have been known to escape predation by playing dead, or by working together to scare off smaller predators from the safety of a burrow.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

All of the senses of rock hyraxes are well-developed, although their near-vision is thought to be relatively poor. Hyraxes have a variety of vocal calls. Territorial calls are distinct and genus-specific. In rock hyraxes, territorial calls are loud and repetitious and increase in volume and duration towards the end of the sequence before ending in a series of guttural noises. Adults also emit twittering or whinnying calls and striking alarm calls, which are made when a potential predator is identified. When threatened, they may growl or grind their molars. Infants make only five of the twenty-one sounds used by adults; three of these are vocal, including mewing calls given when they are lost or begging, and two are non-vocal. Between 2 to 15 months of age, young develop all vocal sounds except five; four of which are exclusive to adult females and one is characteristic of adult males.

Rock hyraxes urinate on the sides of rocks near colony sites. Crystallized calcium carbonate present in the excretion makes a white stain used in visual communication. Hyraxes also deposit their droppings and urine in a common latrine, but it is unknown whether this serves any role in olfactory communication. The dorsal gland and hair surrounding it are important for communication among conspecifics. Pheromone production from the dorsal gland increases with increased stimuli. In an aggressive context, pheromone production is accompanied by a slight curling of the upper lip and piloerection of the neck hairs. During territorial calls, males crouch and raise their head with their jaws slightly agape. Hyraxes show submission by presenting their hindquarters, backing away, closing their dorsal gland, and/or flattening their ears. Submissive behaviors are very important, as simple interactions such as approaching or directly staring at another adult might be seen as a threat and the tusks can inflict fatal wounds. To avoid antagonizing other individuals, feeding or huddling individuals usually face away from each other.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

It seems the Rock Hyrax uses its song for more complex communication than previously understood. One study provides evidence of complex syntactic vocalizations in this small social mammal. It demonstrates the syntax of hyrax calls is significantly different between different regions in Israel and that syntax is more closely related to nearby groups than distant groups. The authors find that this rich syntactic structure, and its geographic correlation suggests the possibility of vocal production learning in the hyrax.
  • Kershenbaum, A., Ilany, A., Blaustein, L., & Geffen, E. (2012). Syntactic structure and geographical dialects in the songs of male rock hyraxes. Proceedings of the Royal Society B: Biological Sciences, rspb.2012.0322-. doi:10.1098/rspb.2012.0322
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Alan Couch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Mainly active by day with apparent peaks in early morn­ing and evening. Lives in colonies in rock crevices and dens on often inaccessible cliffs. Very alert with at least some members of the colony acting as lookouts and alerting others to danger with sharp alarm call. Adept climber, foot struc­ture allowing purchase on the smoothest of rocks. Sight excellent, hearing and scent good. Diet largely vegetarian and predominant­ly acacia leaves and seeds, though may take a wide range of other food including insects and small reptiles. Does not need to drink water. Predators include birds of prey (range of Verreaux's Eagle Aquila verreauxii almost exactly mirrors that of the Rock Hyrax in Africa, but it is very rare in Egypt), Jackals Canis aureus, Wild Cats Felis silvestris, and Leopards Panthera pardus. Mating in August/September. Males establish and defend territories. Mating brief and vigorous. After mating season, individuals mix freely again. Gestation 7.5-8 months. Litter size 1-6. Female nurses for 10 weeks and young reach sexual maturity after 16 months, adulthood at three years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little information is available regarding the average lifespan of Procavia capensis, however, evidence suggests it can live for up to 12 years in the wild.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
8.5 years.

Average lifespan

Status: captivity:
11.0 years.

Average lifespan

Status: wild:
14.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14.8 years (captivity) Observations: In the wild, animals have been reported to live for 8.5 years (Ronald Nowak 1999). One captive specimen lived for 14.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Rock hyraxes are polygynous, and a single territorial male can control a harem of 3 to 7 females in a territory of less than 4000 square meters. Prior to copulation, the male usually calls and then approaches a receptive female with his penis and dorsal spot erected while weaving his head. Although there are no visible signs of estrous, the quantity or quality of dorsal-gland secretions may change as a function of estrous. Mating females may attack their mates when they approaching if females are not willing to copulate. A willing female backs into the male and presses her anogenital region against his flank and breast. The male then grasps her with his forelegs for a moment while copulation occurs. Territorial males preferentially mate with mature females. Peripheral males are usually only successful in mating with subadult or young adult females that are under 28 months of age. The structure of the male penis differs between the different genera of hyraxes, thus contributing to reproductive isolation where sympatry occurs.

Mating System: polygynous

Procavia capensis breeds seasonally (e.g., August to November in Kenya) with births synchronized to occur during the rainy season. During the breeding season, there is a significant increase in territoriality evident through dramatically higher rates of calling and aggression in males; these behaviors correspond with an increase in testicle size. Testicles can become more than 20 times larger than their normal size during breeding season. Outside of the breeding season, spermatogenesis does not occur. Gestation lasts from 6 to 8 months, which is unusually long for a mammal of such small size. Extended gestation in P. capensis is thought to reflect the fact that its ancestors were much larger in body size. Females become increasingly aggressive as parturition approaches and temporarily form isolated nursing groups with other pregnant females. Birth takes place in the dark and females make hoarse squeaking noises in time with their contractions. Litter size ranges from 1 to 6, with an average of 2.4, which represents 10.8% of the mother’s weight. Newborns are large and well-developed at birth. They have both eyes fully opened, a complete coat of hair, and weigh 170 to 240 grams. Young can jump by two days old, and by the third or fourth day, they begin to eat food. Newborns are capable of eating solid food by two weeks of age. Weaning is usually complete by three months after birth. Reproductive maturity is achieved at 16 months of age, but young do not reach adult size and weight until three years of age.

Breeding interval: Rock hyraxes breed once yearly

Breeding season: In Kenya, rock hyraxes breed from August to November.

Range number of offspring: 1 to 4.

Average number of offspring: 2.4.

Range gestation period: 6 to 8 months.

Range birth mass: 170 to 240 g.

Average birth mass: 202 g.

Average weaning age: 3 months.

Average age at sexual or reproductive maturity (female): 16 months.

Average age at sexual or reproductive maturity (male): 16 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
500 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
500 days.

After birth, neonates are licked clean before they climb onto the back of the mother where they rest on her dorsal gland. This is thought to promote imprinting and keeps young warm and out of the way of other adults. Females have three pairs of mammae, one pectoral and two inguinal, all of which are used in nursing. Nursing may occur inside a burrow or outside on the rocks and occurs at roughly 1.5 h intervals during the first couple of days after birth. There is no information available regarding paternal care in this species.

Parental Investment: precocial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Estes, R. 1991. The Behavior Guide to African Mammals. Berkeley: The University of California Press.
  • Millar, R., T. Glover. 1970. Seasonal changes in the reproductive tract of the male rock hyrax, Procavia capensis. Journal of Reproduction and Fertility, 23: 497-499.
  • Olds, N., J. Shoshani. 1982. Mammalian Species Procavia capensis. American Society of Mammalogists, 171: 1-7.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Procavia capensis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2107-09|AJ428945|Procavia capensis| AACCGTTGATTGTTCTCAACCAACCATAAAGACATCGGCACTTTGTACTTACTATTTGGAGCTTGAGCTGGAATAGTAGGAACCGCCCTA---AGCATCCTAATCCGGGCCGAACTTGGCCAACCAGGAGCCCTGCTGGGAGAC---GATCAAATCTACAACGTTGTAGTTACAGCCCACGCATTCGTAATAATTTTCTTCATAGTAATACCAATTATAATTGGAGGGTTCGGCAACTGACTAGTCCCCCTAATA---ATCGGCTCCCCGGATATAGCATTCCCACGAATAAACAATATGAGCTTCTGACTATTACCCCCTTCCTTTCTACTTCTACTAGCCTCATCTATAGTAGAAGCCGGAGCAGGAACAGGCTGAACAGTATACCCGCCTCTGGCGGGTAATTTAGCCCACGCAGGGGCCTCTGTAGACCTG---ACAATCTTCTCACTTCACCTAGCTGGGGTTTCCTCAATCTTAGGGGCTATCAACTTCATCACCACTATCATTAACATAAAACCCCCAGCAACCACCCAATACCAAACACCCCTATTCGTTTGATCCGTACTAATTACTGCTGTACTCCTTTTACTATCCCTACCAGTACTAGCAGCC---GGAATTACAATACTACTAACAGATCGAAACATCAACACAACCTTTTTCGACCCAGCGGGAGGAGGAGACCCGGTTCTATATCAACATTTATTCTGATTCTTTGGACATCCAGAAGTTTATATCCTCATTCTACCCGGATTTGGGATAATCTCCCACATTGTCACCTACTACTCAGGCAAAAAA---GAACCTTTCGGGTACATGGGTATGGTATGAGCCATGATATCAATTGGTTTCCTAGGATTTATTGTATGAGCTCACCACATATTCACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Procavia capensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barry, R., Bloomer, P., Hoeck, H. & Shoshani, H. (IUCN SSC Afrotheria Specialist Group)

Reviewer/s
Rathbun, G. (Afrotheria Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, its occurrence in a number of protected areas, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2006
    Least Concern
    (IUCN 2006)
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although Procavia capensis is classified as a species of least concern on the IUCN's Red List of Threatened Species, current population trends are unknown. While it is hunted for its meat throughout its geographic range and has experienced local extirpations, there are no major threats to the long-term persistence of this species.

IUCN Red List of Threatened Species: least concern

  • Barry, R., P. Bloomer, H. Hoeck, H. Shoshani. 2008. "IUCN 2010 Red List of Threatened Species: Procavia capensis" (On-line). Accessed March 17, 2011 at http://www.iucnredlist.org/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Common.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Widespread and abundant in drier rocky areas of Africa and the Arabian Peninsula. In some areas, such as in Matopos in Zimbabwe and the Serengeti of Tanzania (where they have been well studied) they are characterised by extreme local population fluctuations (Hoeck and Bloomer in press). On Mount Kenya, where they are considered among the most conspicuous of mammals, average density has been estimated at between 20 and 100 animals per km² (Young and Evans 1993).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species. However, it is hunted locally, and may have been extirpated in some smaller localities. In Israel, where the species is protected by law and has few natural enemies, their numbers have grown in cultivated areas resulting in damage to crops and necessitating effective control measures being put in
place (e.g., electric fences) (Mendelssogn and Yom-Tov 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in many protected areas across its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In areas where humans are prevalent, especially South Africa, rock hyraxes are sometimes considered pests, as they inhabit road culverts and/or crevices in stone walls. Agricultural plots that have been recently cleared are often bordered by rocks that were removed during clearing, thus providing prime habitat for rock hyraxes. Fields such as these are often used for cultivating fruit trees, upon which hyraxes browse and cause considerable damage. In addition, rock hyraxes are a known reservoir for Leishmania tropica, a flagellate parasite that infects rodents and humans.

Negative Impacts: injures humans (carries human disease); crop pest

  • Jacobson, R., C. Eisenberger, M. Svobodova, G. Baneth, J. Sztern, J. Carvalho, A. Nasereddin, M. Fari, U. Shalom, P. Volf, J. Votypka, J. Dedet, F. Pratlong, G. Schonian, L. Schnur, C. Jaffe, A. Warburg. 2003. Outbreak of Cutaenous Leishmaniasis in Northern Israel. Journal of Infectious Diseases, 188: 1065-73.
  • Moran, S., S. Sofer, M. Cohen. 1987. Control of the rock hyrax, Procavia capensis, in fruit orchards by fluoroacetamide baits. Crop Protection, 6: 265-270.
  • Svobodová, M., P. Volf, J. Votýpka. 2006. Experimental transmission of Leishmania tropica to hyraxes (Procavia capensis) by the bite of Phlebotomus arabicus. Microbes and Infection, 8: 1691-1694.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Members of Procavia capensis colonies urinate and defecate in designated areas called latrines. As time goes on and more material accumulates, this matter eventually congeals into a large, sticky solid. This substance has been used in a number of applications, including a medicine called hyraceum that has been used to treat epilepsy, convulsions, and a number of female-specific diseases. Procavia capensis is hunted for its meat throughout its geographic range.

Positive Impacts: food ; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rock Hyrax

The rock hyrax (Procavia capensis) or Cape hyrax, is one of the four living species of the order Hyracoidea, and the only living species in the genus Procavia. Like all hyraxes, it is a medium-sized (~4 kg) terrestrial mammal, superficially resembling a guinea pig with short ears and tail. The closest living relatives to hyraxes are the modern day elephants and sirenians. The rock hyrax is found across Africa and the Middle East, in habitats with rock crevices in which to escape from predators. Hyraxes typically live in groups of 10–80 animals, and forage as a group. Their most striking behaviour is the use of sentries: one or more animals take up position on a vantage point and issue alarm calls on the approach of predators.

The rock hyrax has incomplete thermoregulation, and is most active in the morning and evening, although their activity pattern varies substantially with season and climate.

Over most of its range, the rock hyrax is not endangered, and in some areas is considered a minor pest. In Ethiopia, Israel and Jordan, they have been shown to be a reservoir of the leishmaniasis parasite.

Contents

Characteristics

Skull
The dorsal gland can be seen here as a patch of fur with a lighter colouration
The characteristic foot pads
The unusual incisors

The rock hyrax is squat and heavily built, adults reaching a length of 50 cm (20 in) and weighing around 4 kg (8.8 lb), with a slight sexual dimorphism; males being approximately 10% heavier than females. Their fur is thick and grey-brown color, although this varies strongly between different environments; from dark brown in wetter habitats, to light gray in desert living individuals.[3] Hyrax size (as measured by skull length and humerus diameter) is correlated to precipitation, probably because of the effect on preferred hyrax forage.[4]

Prominent in and apparently unique to hyraxes is the dorsal gland, which excretes an odour used for social communication and territorial marking. The gland is most clearly visible in dominant males.[5]

The head of the rock hyrax is pointed, having a short neck with rounded ears. They have long black whiskers on their muzzles.[6] The rock hyrax has a prominent pair of long, pointed tusk-like upper incisors which are reminiscent of the elephant, to which the hyrax is distantly related (see below). The forefeet are plantigrade, and the hindfeet semi-digitigrade. The soles of the feet have large, soft pads that are kept moist with sweat-like secretions. In males, the testes are permanently abdominal, another anatomical feature that hyraxes share with their relatives elephants and sirenians.[5]

Thermoregulation in the rock hyrax has been subject to much research, as their body temperature varies with a diurnal rhythm. However, animals kept in constant environmental conditions also display such variation[5] and this internal mechanism may be related to water balance regulation.[7]

Distribution

The rock hyrax occurs across sub-Saharan Africa, with the exception of the Congo basin and Madagascar. A larger, longer-haired subspecies is abundant in the glacial moraines in the alpine zone of Mount Kenya[citation needed]. The distribution continues into northern Algeria, Libya and Egypt, and the Middle East, with populations in Israel, Jordan, Syria, the Arabian peninsula and eastern Turkey.[5]

Ecology and behaviour

Basking in the sun

Hyraxes live in herds of up to 80 individuals. These herds are subdivided into smaller flocks consisting of a few families. These families consist of 3 to 15 related adult females, a dominant male, and several young. The dominant male defends and watches over the group. The male also marks its territory to avoid any altercations.[8]

In Africa, hyraxes are preyed on by leopards, Egyptian cobras, puff adders, caracals, wild dogs, and eagles.[9] Verreaux's Eagle in particular is a specialist hunter of hyrax.[10][11] In Israel, the rock hyrax is reportedly rarely preyed upon by terrestrial predators, as their system of sentries and their reliable refuges provide considerable protection. Hyrax remains are almost absent from the droppings of wolves in the Judean Desert.[12]

Feeding and foraging

Hyraxchewing.ogv
Hyrax making a chewing motion

Hyraxes feed on a wide variety of different plants, including both grasses [8] and broad leafed plants.[13] They also have been reported to eat insects and grubs[6]. The rock hyraxes forage for food up to about 50 metres from their refuge, usually feeding as a group and with one or more acting as sentries from a prominent lookout position. On the approach of danger, the sentries give an alarm call, and the animals quickly retreat to their refuge.[14] They are able to go for many days without water due to the moisture they obtain through their food.[15] Despite their seemingly clumsy build, they are able to climb trees, and will readily enter residential gardens to feed on the leaves of citrus and other trees.

Reproduction

Rock hyraxes give birth to two or three young after a 6–7 month gestation period. The young are well developed at birth with fully opened eyes and complete pelage. Young can ingest solid food after two weeks and are weaned at ten weeks. Young are sexually mature after 16 months, reach adult size at three years, and typically live about ten years[5]. During seasonal changes, the weight of male reproduction organs (testis, seminal vesicles) changes due to sexual activity. Hyraxes were examined and it was found that between May and January, the males were inactive sexually. From February onward, there was a dramatic increase to the weight of these organs, and the males are able to copulate.[16]

Social behaviour

Rock hyraxes are very noisy and sociable.[8] Adults make use of at least 21 different vocal signals. The most familiar signal is a high trill, and is given in response to perceived danger.[6] Rock hyrax calls are referred to as “songs.” Hyrax songs can provide important biological information such as size, age, social status, body weight, condition, and hormonal state of the singer, as determined by measuring their song length, patterns, complexity, and frequency.[17] More recently, researchers have found rich syntactic structure and geographical variations in the songs of rock hyraxes, a first in the vocalization of mammalian taxa other than primates, cetaceans, and bats.[18]

The rock hyrax also makes a loud grunting sound while moving its jaws as if chewing, and this behaviour may be a sign of aggression. Some authors[19] have proposed that observation of this behavior by ancient Israelites gave rise to the misconception given in Leviticus 11:4-8 that the hyrax chews the cud; in fact, hyraxes are not ruminants.[5]

The rock hyrax spends approximately 95% of its time resting.[5] During this time, they can often be seen basking in the sun, which is thought to be an element of their complex thermoregulation.

Dispersal

Males have been categorised into four classes: territorial, peripheral, early, and late dispersers. The territorial males are the most dominant. Peripheral males are more solitary and sometimes take over a group when the dominant male is missing. Early peripheral males are juveniles that leave the birth site around 16 to 24 months of age. Late dispersers are also juvenile males, but they leave the birth site much later; around 30 or more months of age.[20]

Names

They are known as dassies in South Africa, and sometimes rock rabbits. The Swahili names for them are pimbi, pelele and wibari, though the latter two names are nowadays reserved for the tree hyraxes. The Dutch name is klipdas.[21] This species has many subspecies, many of which are also known as rock or Cape hyrax, although the former usually refers to African varieties. In Arabic, the rock hyrax is called الوبر ("wabr") or طبسون ("tabsoun"). In Hebrew, the rock hyrax is called שפן סלע (shafan sela), meaning rock "shafan", where the meaning of shafan is obscure, but is colloquially used as a synonym for rabbit in modern Hebrew.[19] Gerald Durrell wrote that in Bafut, in Cameroon, the locals call the rock hyrax the n'eer. [22]

Pharmaceutical use

Rock hyraxes produce large quantities of hyraceum—a sticky mass of dung and urine that has been employed[when?] as a South African folk remedy in the treatment of several medical disorders, including epilepsy and convulsions.[23] Hyraceum is now being "rediscovered" by intrepid perfumers who tincture it in alcohol to yield a natural animal musk.[24]

Culture

Rock hyraxes are classified as non-kosher in the Old Testament/Jewish Torah.[25] Nonetheless, they are also included in Proverbs 30:26 as one of a number of remarkable animals for being small but exceedingly wise, in this case because "the rock badgers are a people not mighty, yet they make their homes in the cliffs".[26]

In Joy Adamson's books and the associated movie Born Free, a rock hyrax that she called Pati-Pati was her companion for six years before Elsa and her siblings came along and took the role of nanny and watched over them with great care.[27]

Gallery

References

  1. ^ http://www.bucknell.edu/msw3/browse.asp?s=y&id=11400040
  2. ^ Barry, R., Bloomer, P., Hoeck, H. & Shoshani, H. (2008). Procavia capensis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 December 2008.
  3. ^ Bothma J.d.P. (1966) Color Variation in Hyracoidea from Southern Africa. Journal of Mammalogy 47: 687–693.
  4. ^ Klein R.G., CruzUribe, K . (1996) "Size variation in the rock hyrax (Procavia capensis) and late Quaternary climatic change in South Africa." Quaternary Research 46 (2): 193–207.
  5. ^ a b c d e f g Olds, N., Shoshani, J. (1982). "Procavia capensis". Mammalian Species 171: 1–7. 
  6. ^ a b c http://www.livingdesert.org/animals/rock_hyrax.asp
  7. ^ Meltzer, A. (1973) Heat balance and water economy of the rock hyrax (Procavia capensis syriaca Schreber 1784). Unpubl. Ph.D. dissert., Tel-Aviv Univ., Israel, 135 pp.
  8. ^ a b c Rock hyrax. (n.d.). Retrieved April 17, 2009, from EBSCO Animals database. MAIN <http://0-search.ebscohost.com.patris.apu.edu/login.aspx?direct=true&db=ani&AN=9500100073&site=ehost-live>
  9. ^ Turner, M. I. M., and R. M. Watson. 1965. An introductory study on the ecology of hyrax (Dendrohyrax brucei and Pro- cavia johnstoni) in the Serengeti National Park. E. African Wildl. J., 3:49-60.
  10. ^ Estes, Richard D. (1999). The Safari Companion. Chelsea Green Publishing Company. ISBN 1-890132-44-6. 
  11. ^ Mike, Unwin (2003). Southern African Wildlife. Bradt Travel Guides. ISBN 1-84162-060-2. 
  12. ^ Margolis, E. (2008). "Dietary composition of the wolf Canis lupus in the Ein Gedi area according to analysis of their droppings (in Hebrew)". Proceedings of the 45th Meeting of the Israel Zoological Society. 
  13. ^ http://natureniche.tripod.com/hyrax.html
  14. ^ Kotler B.P., Brown J.S. & Knight M.H. (1999) Habitat and patch use by hyraxes: there's no place like home? In, pp. 82–88
  15. ^ African Wildlife Foundation: < Hyrax
  16. ^ Glover, T.D. & Millar, R.P. (1970) Seasonal Changes in the Reproductive Tract of the Male Rock Hyrax. J. Reprod. Fert. 23, 497-499
  17. ^ Koren, Lee, and Eli Geffen. "Complex call in male rock hyrax (Procavia capensis): a multi-information distributing channel." Behavioral Ecology and Sociobiology. 63.4 (2009 Feb): p. 581–590.
  18. ^ Arik Kershenbaum, Amiyaal Ilany, Leon Blaustein, Eli Geffen (2012). "Syntactic structure and geographical dialects in the songs of male rock hyraxes". Proc. R. Soc. B (Royal Society). doi:10.1098/rspb.2012.0322. http://rspb.royalsocietypublishing.org/content/early/2012/04/15/rspb.2012.0322.full. Retrieved April 20, 2012. 
  19. ^ a b Slifkin, Nosson (March 1, 2004). "Shafan– The Hyrax" (PDF). The camel, the hare & the hyrax: a study of the laws of animals with one kosher sign in light of modern zoology. Southfield, MI; Nanuet, NY: Zoo Torah in association with Targum/Feldheim Distributed by Feldheim. pp. 99-135. ISBN 1-56871-312-6. http://www.zootorah.com/hyrax/hyrax.pdf. Retrieved April 25, 2012.  ISBN 978-1-56871-312-0.
  20. ^ http://www.jaxzoo.org/things/biofacts/RockHyrax.asp
  21. ^ Wikisource-logo.svg "Dassy". Encyclopedia Americana. 1920. 
  22. ^ Durrell, Gerald (1954). The Bafut Beagles. Rupert Hart-Davies. 
  23. ^ Olsen, A., Prinsloo, L. C., Scott, L., Jägera, A, K. (2008) "Hyraceum, the fossilized metabolic product of rock hyraxes (Procavia capensis), shows GABA-benzodiazepine receptor affinity". South African Journal of Science 103.
  24. ^ http://www.profumo.it/title/Hyraceum/pid/5076
  25. ^ Leviticus 11:4-5; Deuteronomy 14:7
  26. ^ Prov 30:26, ESV
  27. ^ Joy Adamson, Elsa - The Story Of A Lioness, London: Collins & Harvill Press, 1961, p.3
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!