Overview

Distribution

Range Description

This species is confined to West and Central Africa from Sierra Leone to northern Uganda and southwards to northern Angola and north-eastern Democratic Republic of Congo. Also on Bioko (Equatorial Guinea) (Shultz and Roberts in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The tree hyrax inhabits mainly forest areas forming a band across mid-Africa extending from the eastern to the western coast.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

This rodent-looking mammal has short ears and legs, thick, soft fur with gray-brown to black colorings. The hyrax has a distinct patch of lighter colored hair on its back which covers a scent gland and bristles when the animal is excited or mating. Typically the tree hyrax is about 1-2.5 feet in length, has a height at the shoulders of 10-12 inches.

Range mass: 1 to 5 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Usually found in lowland moist forests, as well as moist savannas, but also in montane habitats to elevations of 3,500 m (Shultz and Roberts in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Tree hyraxes inhabit various regions ranging from wooded areas and savannas to coastal dunes and tropical rainforests.

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Unlike the other species of hyrax, the tree hyrax is a nocturnal forager. It is mainly herbivorous, feeding on leaves, fruits, bark, twigs, and grasses as well as an occasional insect.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
5.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The tree hyrax has an unusually long gestation period for its size; ranging from 6.5 to 7.5 months. Sexual maturity is reached around 16 months of age. Litter sizes of 1-2 are common, unlike the larger litters of other hyraxes. The young are born fully furred and rather large. By the age of one day they are competent climbers. There is little data on the mating systems of these animals due to their nocturnal lifestyle, however it is believed that within the small groups there is one dominant male and the rest of the males form bachelor herds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrohyrax dorsalis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1728-08|AM904727|Dendrohyrax dorsalis| AACCGTTGATTGTTCTCAACTAATCACAAAGACATCGGCACCCTGTACTTATTATTTGGAGCCTGAGCCGGGATAGTAGGAACCGCCCTA---AGCATTTTAATCCGAGCCGAGCTCGGTCAACCAGGGACCCTACTGGGAGAT---GATCAAATTTATAATGTTGTGGTAACAGCTCACGCATTTGTAATAATTTTCTTCATGGTTATGCCAATTATAATTGGAGGGTTTGGCAACTGACTAGTGCCCCTAATA---ATTGGTTCTCCTGACATAGCATTCCCGCGAATAAATAATATAAGCTTCTGACTACTACCCCCCTCCTTTCTACTCCTACTAGCCTCATCTATAGTGGAGGCCGGGGCGGGAACTGGATGAACAGTCTACCCACCCTTGGCAAGTAACCTAGCTCACGCAGGAGCCTCCGTAGACCTG---ACAATCTTCTCATTACACTTGGCGGGAGTCTCCTCAATCTTAGGGGCTATTAACTTTATCACCACTATTATTAACATAAAACCCCCAGCAACCACCCAATATCAAACACCCCTGTTCGTTTGATCCGTATTAATCACTGCCGTACTTCTTTTACTATCCCTGCCAGTACTGGCAGCC---GGTATCACAATACTATTAACAGACCGAAACATCAATACAACTTTTTTCGACCCAGCAGGGGGAGGAGACCCAGTACTGTATCAACACTTATTCTGATTCTTTGGACACCCTGAAGTCTACATCCTTATTCTACCCGGATTTGGAATAATCTCCCACATCGTCACCTACTACTCAGGCAAAAAA---GAACCTTTCGGGTATATGGGCATAGTGTGGGCCATAATATCAATTGGCTTCCTAGGGTTTATTGTATGAGCCCATCACATATTTACTGTGGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendrohyrax dorsalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barry, R., Bloomer, P., Hoeck, H. & Shoshani, H. (IUCN SSC Afrotheria Specialist Group)

Reviewer/s
Rathbun, G. (Afrotheria Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, its occurrence in a number of protected areas, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category. Although it is used by local residents over much of the known range, there are no specific data suggesting that populations are in significant decline. However, forest habitats are continually being modified and cleared, so the status of this species should be closely monitored in the future.

History
  • 2006
    Least Concern
    (IUCN 2006)
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The status of the tree hyrax is said to be rare. Although not endangered, they are thought to be threatened due to habitat destruction.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no reliable information on population densities and structure. Observations from Taï N. P., Côte d’Ivoire, provide a rough estimate of 1-2 individuals/km² based on nocturnal calling records (Shultz and Roberts in press).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species, although they are presumably sensitive to severe habitat fragmentation as a result of deforestation, and they are also hunted for food and skins (Shultz and Roberts in press). Fa et al. (2000) recorded a significant increase in the number of carcasses of this species found in bushmeat markets in Bioko I. between 1991 and 1996.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occurs in many protected areas in its range, including Tai National Park and the National Park of Upper Niger (Guinea).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The soft furs of the eastern tree hyrax are sold for a high price value in many regions.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Western Tree Hyrax

The western tree hyrax (Dendrohyrax dorsalis), also called the western tree dassie or Beecroft's tree hyrax, is a species of tree hyrax, members of the family Procaviidae.

Range and habitat

D. d. emini

The western tree hyrax is found in West and Central Africa: Benin, Cameroon, Central African Republic, Republic of the Congo, Democratic Republic of the Congo, Ivory Coast, Equatorial Guinea, Gabon, Gambia, Ghana, Guinea, Guinea-Bissau, Liberia, Nigeria, Rwanda, Senegal, Sierra Leone, Sudan, Togo, Uganda, and possibly Niger. Its natural habitats are subtropical or tropical moist lowland forests, moist savanna, and rocky areas.[2]

References

  1. ^ Shoshani, Jeheskel (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M., eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 87-88. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ a b Barry, R., Bloomer, P., Hoeck, H. & Shoshani, H. (2008). Dendrohyrax dorsalis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 December 2008.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!