Overview

Distribution

Range Description

This species has been widely recorded over much of Subsaharan Africa. The distribution is patchy and discontinuous and they only occur where there is suitable habitat. The species is distributed from Senegal, The Gambia and Guinea in West Africa eastwards to the Central African Republic, northern Democratic Republic of the Congo and southern Sudan, and from here into East Africa where it ranges from Uganda and Kenya southwards throughout much of Tanzania, Zambia, Malawi, Zimbabwe and southern Mozambique into eastern South Africa (the Grahamstown district in the Eastern Cape province is the southerly limit [Skinner and Smithers 1990]). It has been recorded from 1,800 m asl on Kilimanjaro (Grimshaw et al. 1995)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Thryonomys swinderianus is common in Africa, south of the Sahara. It ranges from Gambia to southern Sudan and from south to north Namibia and South Africa. Its range does not include the southwest portion of South Africa (Fritzinger, 1997).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The body length of T. swinderianus is usually 350-610 mm, and their tail reaches 65- 260 mm in length (Fitzinger,1997). Great Cane Rats’ heavyset bodies have an average weight in males of 4.5 kg and 3.5 kg in females (Merwe, 2000). They have a rounded nose, short ears, and incisors that grow continuously (Mills, 1997). The pelage is coarse, with flattened bristle like hairs that grow in groups of five or six. The upper parts are a yellowish brown color and the underside is a much lighter gray. Great Cane Rats have no under fur (Fitzinger, 1997). The forefeet are smaller than the hind feet and have three well developed middle digits with the first and fifth digits greatly reduced. The hind feet have no first digit and all digits have heavy claws (Fitzinger, 1997). The dental formula for T. swinderianus is 1/1, 0/0, 1/1, 3/3 (Maerwe, 2000).

Range mass: 3 to 9 kg.

Average mass: 3.5-4.5 kg.

Range length: 350 to 610 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is typically found in association with reedbeds or in areas of dense, tall grass with thick reed or cane-like stems, typical of riverine and other similar habitats. They are seldom found far from water. Skinner and Smithers (1990) note that agricultural crops (such as maize, wheat, sugar-cane, groundnuts) have greatly improved the habitat for this species such that they have become an agricultural pest in some regions, and are often responsible for damaging cassava crops, and, in West Africa, oil palm plantations. It is predominantly nocturnal, with little known of their biology and ecology. Two litters of as many as twelve young are born annually.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

T. swinderianus is found naturally near marshes and river banks (Mills, 1997). Populations can also reach very high densities in plantations of cultivated crops (Merwe, 2000). Its habitat is expanding due to farmers turning once undesirable forest land into farmland (Asibey,1999).

Habitat Regions: tropical

Terrestrial Biomes: forest

Wetlands: marsh

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

T. swinderianus are herbivores and their natural diet is mainly grasses and cane. Sometimes they also eat bark, fallen fruits, nuts and many different kinds of cultivated crops. Some of the cultivated crop fields that T. swinderianus invade are sugar cane, maize, millet, cassava, roundnuts, sweet potatoes, and pumpkins (Fitzinger, 1997). Great Cane Rats’ favorite food is elephant grass and sweet potatoes (National Research Council, 1991). They prefer plants with lots of moisture and soluble carbohydrates (Agbelusi, 1997).

T. swinderianus cut the grasses and other foods with their incisors, producing a chattering sound that is relatively loud and very distinguishable (Mills, 1997).

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Fritzinger (1997) desribed a T. swinderianus that lived in captivity for four years and four months.

Average lifespan

Status: captivity:
4.3 years.

Average lifespan

Status: wild:
4.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5.4 years (captivity) Observations: Although ageing has not been studied in detail, these animals appear to be short-lived. Record longevity in captivity is 5.4 years (Richard Weigl 2005). Considering their size, a longer lifespan could be expected. It is possible that their maximum longevity is slightly understimated, but there is no data to suggest a much longer longevity.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

T. swinderianus live in groups of males and females during the breeding season. When the dry season comes males separate from the group and live by themselves. The females continue to live together (Fitzinger, 1997).

The breeding time depends on which part of Africa the animal is found and seems to depend on the weather (Fitzinger, 1997). The wet season of the year is the usual breeding season. Females generally have two litters per year with usually 4 offspring (Mills, 1997). Great Cane Rats estrous cycle usually lasts 6.62 days and they have a gestation period of 137- 172 days (Fitzinger, 1997). Offspring weigh about 129 grams and are relatively well developed. Their eyes are open, they are covered in hair and can run. T. swinderianus become sexually mature at about a year old (Fitzinger, 1997).

Range number of offspring: 1 to 6.

Average number of offspring: 4.

Range gestation period: 137 to 172 days.

Average gestation period: 155 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual

Average birth mass: 129 g.

Average number of offspring: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Parental Investment: precocial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thryonomys swinderianus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0555-06|NC_002658|Thryonomys swinderianus| AATCGCTGATTATTTTCCACAAACCACAAAGACATTGGAACACTATATTTACTATTTGGTGCCTGAGCAGGAATAGTAGGAACTGCTCTA---AGCCTTTTAATCCGAGCTGAATTAGGACAACCGGGTACCCTACTAGGAGAT---GATCAAATTTATAACGTTATCGTAACAGCCCATGCTTTCGTTATAATTTTCTTCATAGTTATACCTATCATAATTGGAGGTTTCGGAAACTGACTAGTACCTTTAATA---ATTGGAGCCCCGGATATAGCGTTCCCTCGAATAAACAACATAAGCTTCTGACTTCTTCCCCCTTCCTTCCTACTACTTCTATCTTCATCAATAATTGAAGCTGGAGCAGGGACAGGATGAACTGTTTACCCGCCCCTAGCAGGGAATTTAGCACATGCAGGAGCATCAGTTGACCTA---ACTATCTTCTCCCTACACCTAGCAGGTGTCTCCTCAATCCTCGGAGCCATCAACTTTATTACAACTATTATTAATATAAAACCCCCTGCAATATCCCAATACCAAACTCCTCTATTTGTATGATCTGTCCTTATTACAGCCGTACTTCTATTACTTTCCCTTCCAGTACTGGCTGCA---GGAATTACAATACTACTAACGGACCGAAATTTAAACACAACATTTTTCGATCCTGCAGGAGGAGGAGACCCTATTCTTTACCAACACCTATTCTGATTCTTTGGACACCCTGAAGTTTACATTTTAATCTTACCCGGATTCGGAATAATTTCGCACATCGTAACATATTATTCAAGTAAAAAA---GAACCTTTCGGATATATAGGAATAGTATGAGCAATAATATCTATCGGTTTCCTAGGATTCATTGTATGAGCCCATCACATATTTACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thryonomys swinderianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hoffmann, M.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Cox, N. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, it occurs in a number of protected areas, has a tolerance of a degree of habitat modification, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2004
    Least Concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

T. swinderianus population is not threatened by extinction, although individual populations may be extinct locally due primarily to over hunting (National Research Council, 1991).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a fairly common species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species. They are a favoured food item and commonly hunted with dogs in West Africa. This species is very common in bushmeat markets, and there have been numerous studies investigating the viability of farming this species to supply demands for protein in West and Central Africa. Jori et al. (1995) discuss the many economical, nutritional and environmental arguments for implementing rearing of this species in rural development programmes in Africa and methods to develop farming programmes. They are also a major agricultural pest, which has often led to control measures being applied to keep them out of plantations and fields.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is present in a number of protected areas throughout the range..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

T. swinderianus are considered to be great pests of many cultivated crops and can do great economical harm to farmers (Merwe, 2000).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

T. swinderianus is one of the most preferred meats in Africa and it can be more expensive than lamb, chicken, beef, or pork (National Research Council, 1991). It has been sold in Ghana markets for almost twice as much as beef and pork. In one African market, about 200,000 kg, which is worth about $220,000 U.S., was sold in a year’s time (Fitzinger, 1997). Asibey (1999) believes that if more research was done to find the most efficient way to breed T. swinderianus, then these animals would be the solution to Africa's protein shortage.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Greater Cane Rat

The Greater Cane Rat (Thryonomys swinderianus) is one of two species of cane rats, a small family of African hystricognath rodents. It inhabits Africa, south of the Saharan Desert. The cane rat lives by reedbeds and riverbanks. As humans move into such territories, the cane rats accepted plantations and cultivated areas. Cane rats can grow about two feet long in the longest individuals and weighs a little less than 19 lb (8.6 kg). It has rounded ears, short nose, and coarse bristly hair. Its forefeet are smaller than its hindfeet and supports its weight on only three toes. Cane rats live in small groups led by a single male. They are nocturnal and make nests from grasses or burrow underground. The oldest cane rat can live more than four years. If frightened, they grunt and run towards water. They eat grasses and cane and since they have tastes for cultivated foods, they make serious agricultural pests. So far, their conservation status is lower risk.

In the country of Ghana and other regions of West Africa, the Greater Cane Rat is usually called a grasscutter or cutting grass. In both West Africa and Southern Africa, it is considered a delicacy. As a consequence, "grasscutters" are beginning to be raised in cages for sale, and so are sometimes referred to as micro livestock.

See also

References

  1. ^ Hoffmann, M. (2008). Thryonomys swinderianus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 5 January 2009.
  • Matthews, Jaman. "The Value of Grasscutters," World Ark, (January-February, 2008), pp. 23-24.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!