Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

This species occurs in Chile, on the western slope of the Andes between Vallenar and Curico, to 1,200 m asl. (Woods and Kilpatrick, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Octodon degus is generally considered endemic to west central Chile, where it inhabits the lower slopes of the Andes. Although some have argued that its range may extend north into Peru, this is not well supported. It is common in the international pet trade, however, and is often used in laboratory studies outside of its native range.

Biogeographic Regions: neotropical (Native )

  • Woods, C., D. Boraker. 1975. Octodon degus. Mammalian Species, 67: 1-5.
  • Contreras, L., J. Torres-Mura, J. Yanez. 1987. Biogeography of Octodontid rodents: An eco-evolutionary hypothesis. Fieldiana: Zoology, New Series, 39: 401-411.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Octodon degus superficially resembles a gerbil, but is much larger. Degus typically weigh between 170 and 300 g, and measure between 325 and 440 mm in length, including the tail. The fur is yellow-brown on the back and head, and the underparts and feet are cream colored. There is a pale band around the eye and, in some individuals, the neck. The tail is moderately long and conspicuously tufted. The ears are large and darkly pigmented. The fifth digit is reduced, and on the forefeet it has a nail instead of a claw. The cheekteeth are hypsodont and their biting surfaces resemble a figure of eight. Sexes are difficult to distinguish, but males tend to be about 10% larger than females. Pups are born furred and able to see, and begin exploring within hours of birth.  Octodon degus can be distinguished from the two other members of the genus Octodon by slight differences in dental morphology. It is also smaller than its relatives and its tail is said to be more noticeably tufted.

Range mass: 170 to 300 g.

Range length: 325 to 440 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 0.958 W.

  • Lee, T. 2004. Octodon degus: A diurnal, social, and long-lived rodent. ILAR Journal, 45/1: 14-24.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Coastal and central scrubland (matorralo) (Ojeda pers. comm.).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Octodon degus inhabits a mediterranean-type semi-arid shrubland ecosystem called "matorral", which is found on the western slopes of the Andes between 28 and 35 degrees south latitude. Further north the climate becomes too arid to support this plant community, and further south it is too wet. Degus appear to be limited to elevations below 1200 meters, both by the distribution of their habitat and by their intolerance of low oxygen partial pressure. Degus are well able to inhabit lands influenced by cattle grazing, and are agricultural pests in some areas.

Range elevation: 0 to 1200 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: chaparral

Other Habitat Features: agricultural

  • Fulk, G. 1976. Notes on the activity, reproduction, and social behavior of Octodon degus. Journal of Mammalogy, 57/3: 495-505.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Degus are generalist herbivores. They feed on the leaves, bark, and seeds of shrubs and forbs. Among their favorite foods are the bark of Cestrum palqui and Mimosa cavenia, leaves and bark of Proustia cuneifolia, Atriplex repunda, and Acacia caven, annuals such as Erodium cicutarum when in season, green grasses, and thistle seeds. Degus choose food items that reduce fiber and increase nitrogen and moisture in the diet, and thus prefer young leaves and avoid woodier shrubs.  Degus rely on microbial fermentation in their enlarged cecum (they are "hindgut fermenters") to digest their food. They reingest a large percentage of their feces, usually during the night. This allows them to maximize their digestion. Degus store food in the winter, and it has been reported that they occasionally eat meat in old age.

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts

Other Foods: dung

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Folivore , Granivore , Lignivore); coprophage

  • Veloso, C., G. Kenagy. 2005. Temporal dynamics of milk composition of the precocial caviomorph Octodon degus (Rodentia : Octodontidae). Revista Chilena de Historia Natural, 78/2: 247-252.
  • Gutierrez, J., F. Bozinovic. 1998. Diet selection in captivity by a generalist herbivorous rodent (Octodon degus) from the Chilean coastal desert. Journal of Arid Environments, 39: 601-607.
  • Kenagy, G., C. Veloso, F. Bozinovic. 1999. Daily rhythms of food intake and feces reingestion in the degu, an herbivorous Chilean rodent: optimizing digestion through coprophagy. Physiological and Biochemical Zoology, 72/1: 78-86.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Octodon degus affects the plant community in its habitat by selective browsing. Degus behaviorally reduce the fiber content of their diet, preferrentially eating shrubs such as Adesmia bedwellii, Baccharis paniculata, and Chenopodium petioare, which are less fibrous and less thorny than others. These species have been shown to increase their foliage area upon exclusion of degus.  As degus are very common, they are themselves an important food source for their predators.

Degus often live in association with Bennett's chinchilla rats (Abrocoma bennettii). The two species are known to share burrow systems and have even been observed in the same chamber within a burrow. This is believed to be a mutualistic relationship, but it is not well understood.

Ecosystem Impact: creates habitat

Mutualist Species:

  • Abrocoma benettii (Bennett's chinchilla rat)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Octodon degus is subject to predation by larger mammals such as culpeo foxes (Lycalopex culpaeus), and from the air by raptors such as barn owls (Tyto alba), short-eared owls (Asio flammeus), and black-chested buzzard eagles (Geranoaetus melanoleucus). Degus use vigilance and cover to avoid predators. Their pelage is also counter-shaded and matches the soil color, which reduces visibility to predators. Degus live socially and use alarm calls to warn others of danger. When a predator is spotted, they take cover in shrubby areas and may retreat to the communal burrow.

Known Predators:

Anti-predator Adaptations: cryptic

  • Ebensperger, L., P. Wallem. 2002. Grouping increases the ability of the social rodent, Octodon degus, to detect predators when using exposed microhabitats. Oikos, 98: 491-497.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Degus have well-developed sight, smell, and hearing. They are highly vocal and use various calls to communicate with one another, including alarm calls, mating calls, and communication between parents and young. Vision is very important in avoidance of predators and in foraging. It has been shown that degus are able to see ultraviolet wavelengths, and that their urine reflects in the UV range when fresh. It has therefore been suggested that degus' urine scent marks are also visual cues. These scent marks are also used as dust wallows, allowing members of a social group to identify each other by scent.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

  • Chavez, A., F. Bozinovic, L. Peichl, A. Palacios. 2003. Retinal spectral sensitivity, fur coloration, and urine reflectance in the genus Octodon (Rodentia): implications for visual ecology. Investigative Opthalmology & Visual Science, 44/5: 2290-2296.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In laboratory conditions, degus typically live five to eight years.

Typical lifespan

Status: captivity:
5 to 8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During the annual breeding season, male-male aggression temporarily increases. Males exclude other males from their burrow and monopolize the females (usually 2 to 4) who live there. Dustbathing and urine marking may be used in the defense of territory by both sexes, but these behaviors particularly increase in the male during the breeding season. Courting males often engage in mutual grooming with females, and frequently perform a courtship ritual which involves wagging of the tail and trembling of the body. The male then raises a hind leg and sprays urine onto the female. This may serve to familiarize her with his scent and perhaps make her more receptive to his advances in the future. Receptive females may sometimes enurinate males in a similar fashion. Related female degus may nurse each other's young.

Mating System: polygynous ; cooperative breeder

In the wild degus tend to breed once per year. The breeding season usually begins in late May (autumn in Chile), and the young are conceived in late winter to early spring (September to October). In wet years, degus may produce second litters. It has been suggested that degus may be induced ovulators, but this has not been established for certain. There is also some evidence that male reproductive organs may be sensitive to changes in photoperiod. The gestation period is 90 days, and litter size is typically 4-6 pups. The young are precocial. They are born with fur and teeth; their eyes are open and they are able to move about the nest on their own. Pups are weaned at 4 to 5 weeks, and become sexually mature between 12 and 16 weeks of age. Degus do not reach adult size until about 6 months of age, however, and they generally live in same-sex social groups until they are about 9 months old and their first breeding season occurs. It has been reported that pups raised in isolation in the laboratory experience severe neural and behavioral abnormalities.

Breeding interval: Degus breed once a year.

Breeding season: Wild degus breed in September and October.

Range number of offspring: 4 to 6.

Range gestation period: 90 to 95 days.

Range weaning age: 4 to 6 weeks.

Range time to independence: 4 to 6 weeks.

Range age at sexual or reproductive maturity (female): 12 to 16 weeks.

Range age at sexual or reproductive maturity (male): 16 (high) weeks.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; post-partum estrous

Average birth mass: 14 g.

Average number of offspring: 6.

Before conception can occur, the male degu must invest considerable energy in the defense of his territory and harem from other males. The female subsequently expends considerable energy in gestation and lactation. The pregnancy is relatively long for a rodent, and the young are born well developed. After birth, both parents protect and provision the pups. Degus nest communally, and groups of related females nurse one another's young. In the laboratory, the female remains close to the pups until two weeks after birth, and males have been observed to huddle with the young during this period without instances of infanticide. In the wild, male degus may spend as much time feeding and huddling with the young as females do. Pups begin to eat solid food at about two weeks of age, and venture out of the burrow at three weeks. Upon weaning at four to six weeks, the pups are able to live independently of the parents and form same-sex social groups until their first breeding season.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Protecting: Male, Female)

  • Ebensperger, L., M. Hurtado. 2005. Seasonal changes in the time budget of degus, Octadon degus.. Behaviour, 142: 91-112.
  • Lee, T. 2004. Octodon degus: A diurnal, social, and long-lived rodent. ILAR Journal, 45/1: 14-24.
  • Ebensperger, L., A. Caiozzi. 2002. Male degus, Octodon degus, modify their dustbathing behavior in response to social familiarity of previous dustbathing marks. Revista Chilena de Historia Natural, 75: 157-163.
  • Woods, C., D. Boraker. 1975. Octodon degus. Mammalian Species, 67: 1-5.
  • Fulk, G. 1976. Notes on the activity, reproduction, and social behavior of Octodon degus. Journal of Mammalogy, 57/3: 495-505.
  • Soto-Gamboa, M. 2005. Free and total testosterone levels in field males of Octodon degus (Rodentia, Octodontidae): accuracy of the hormonal regulation of behavior. Revista Chilena de Historia Natural, 78/2: 229-238.
  • Kleiman, D. 1974. Patterns of behaviour in hystricomorph rodents. Symposium of the Zoological Society (London), 34: 171-209.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Octodon degus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATATCTTCTATTCGGCGCTTGAGCCGGAATAGTAGGCACGGCTTTGAGTTTACTAATTCGAGCAGAATTAGGCCAACCTGGAGCCCTGCTAGGAGATGACCAAATCTACAATGTAGTCGTAACAGCCCATGCATTTGTTATAATCTTTTTTATAGTTATACCTATTATGATTGGAGGATTCGGAAACTGGTTGGTTCCTTTAATAATTGGAGCGCCTGATATAGCATTCCCCCGAATAAACAATATAAGCTTCTGACTTCTACCCCCATCTTTCCTCTTACTTCTCGCTTCATCAATAGTAGAAGCTGGGGCCGGAACAGGATGAACAGTATACCCGCCATTAGCTGGAAACCTTGCCCATGCAGGAGCCTCCGTTGATTTAACAATTTTCTCTCTGCACCTAGCAGGGGTTTCATCAATTCTAGGAGCTATTAATTTTATTACTACTATTATTAATATAAAACCACCAGCTATGACACAATATCAAACACCCCTGTTCGTCTGATCAGTATTAATCACAGCCGTATTACTCCTACTCTCATTACCTGTTCTGGCAGCTGGGATCACAATATTACTAACAGACCGAAACCTAAATACCACTTTCTTTGATCCTGCAGGGGGAGGAGACCCTATCTTGTATCAACACTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Octodon degus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Lessa, E., Ojeda, R. & Bidau, C.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern in view of its relatively wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Octodon degus is considered the most common mammal in its range, and is not considered threatened or endangered.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is an abundant species (Ojeda pers. comm.).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats for this species at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place to protect this rodent.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Degus are significant agricultural pests in some areas. They take advantage of cultivated prickly pear cactus, wheat, vineyards, and orchards as abundant food sources, and can do considerable damage. They are also known to host three species of parasites that can infect humans.

Negative Impacts: injures humans (carries human disease); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Degus are frequently kept as pets, and are used extensively in laboratory research. Because they are largely diurnal, they are useful in research on circadian rhythms, and their intolerance of sugars makes them ideal models for diabetes research.

Positive Impacts: pet trade ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Degu

The degu (Octodon degus, /ˈdɡ/) is a small caviomorph rodent that is endemic to central Chile.

It is sometimes referred to as the brush-tailed rat, and is also called the common degu, to distinguish it from the other members of the genus Octodon. Other members are also called degus, but they are distinguished by additional names. The name "degu" on its own, however, indicates either the genus Octodon or, more usually, O. degus. Degus are in the parvorder Caviomorpha of the infraorder Hystricognathi, along with the chinchilla and guinea pig. The word degu comes from the Mapudungun dewü (mouse, rat).[2]

Contents

Description[edit]

The degu is a small rodent with a body length of 25.0 to 31.0 centimetres (9.8–12.2 in) and a weight of 170 to 300 grams (6.0 to 11 oz). It has yellow-brown fur above and creamy-yellow below, with yellow around the eyes and a paler band around the neck. It has a long, thin tail with a tufted black tip, dark sparsely-furred ears, and pale grey toes. Its fifth toe is small with a nail, rather than a claw, on the forefeet. Its hindfeet are bristled. Its cheek teeth are shaped like figures-of-eight, hence the degu's genus name "Octodon".[3]

Social behavior[edit]

Three degus keeping warm at Artis Zoo, Netherlands

Degus are highly social. They live in burrows, and, by digging communally, they are able to construct larger and more elaborate burrows than they could on their own.[4] Degus digging together coordinate their activities, forming digging chains.[5] Females living in the same group have been shown to spontaneously nest communally;[6][7] they nurse one another's young. They spend a large amount of time on the surface, where they forage for food.[5] When foraging, their ability to detect predators is increased in larger groups,[8] and each animal needs to spend less time in vigilance. Degus exhibit a wide array of communication techniques. They have an elaborate vocal repertoire comprising up to 15 unique sounds,[9] and the young need to be able to hear their mother's calls if the emotional systems in their brains are to develop properly.[10] They use their urine to scent mark,[11] and experiments have shown that they react to one another's marks,[12] although in males the hormone testosterone may suppress their sense of smell somewhat.[13]

Degus are seasonal breeders; the breeding season for wild degus begins in the Chilean autumn when there is roughly 12 hours light:12 hours darkness,[14] with pups born in early to mid spring.[15] Female degus are pregnant for approximately ninety days,[3][16] having a comparatively long gestation period compared to other non-caviomorph rodents. Female pregnant weight varies over the course of gestation and according to litter size;[17] litters contain an average of six pups,[6] but size can range from one or two up to twelve young.[17] Degu pups are born relatively precocial, fully furred and with eyes open, and their auditory and visual systems are functional at birth.[18] Unlike most other rodents, male degus also take part in protecting and raising their pups until they are old enough to leave the family.[19]

Unlike some other octodontids, degus are diurnal[20] (active during the day), and they have good vision. Their retinas include rod cells and two types of cone cells, corresponding to peak sensitivity in the green and ultraviolet regions of the spectrum.[21] Behavioral experiments have shown that degus are able to discriminate ultraviolet light from the wavelengths visible to humans; it is likely that this ultraviolet sensitivity has a social function, since both their ventral (stomach) fur and their urine are highly UV reflective.[22]

Diet[edit]

Degus use their forepaws to hold food whilst eating

Degus are strictly herbivorous, in the wild feeding on grasses and browsing the leaves of shrubs, though they will also take seeds.[23] Throughout much of the year forage is dried[20] and so degus are specially adapted to a very high fibre intake,[24] and this varies between food types and environmental conditions.[25] Like some other herbivores such as rabbits, they perform coprophagy (faecal reingestion) so as to extract more nutrition from their diet.[26] This also serves to maintain healthy gut function during times when food is scarce.[26] Although they are active by day, in high summer they do not leave their burrows in the middle of the day[20] and instead emerge to forage in the mornings and evenings.

Perhaps the most remarkable feature of degu physiology is their intolerance of dietary sugar. Degus have been found to have a divergent insulin structure (one of the hormones that regulates blood glucose level) and so are highly susceptible to developing diabetes mellitus when fed regularly on a diet containing free sugars.[27] This is thought to be due to evolutionary pressure arising from the lack of availability of free sugars in the degu's natural environment.[28] Because of this, the ingredients of non-degu specific hard feed formulations given to captive degus should be checked for free-sugar substances, such as molasses, honey and glucose syrup.[citation needed]

Research subjects[edit]

Degus are extremely intelligent and have a good ability to solve problems.[29] This individual has a much shorter tail than normal, almost certainly due to injury.

Degus entered the research spotlight due to their unique relationship with sugar and diabetes, but are also studied for a wide variety of other reasons. Neuroscientists at the Riken Institute in Tokyo, Japan, used degus for research into tool use in animals with good eye-and-paw coordination, in which they spontaneously learned to use a tiny rake to retrieve out-of-reach seeds.[29] Degus have also been found to spontaneously stack objects in order of decreasing size.[30] In both cases it is the first time these behaviours have been recorded in animals other than apes and birds.

Another interesting area of degu research is circadian rhythm function, i.e. the ability of the brain to tell what time of day it is. Degus have the ability to show both diurnal and nocturnal rhythms if the environment permits,[31] allowing a unique opportunity for study. Degus can take cues that do not relate to day length, such as temperature,[32] melatonin levels[33] and even scents from other degus[34] to adjust their rhythms.

Degus are also invaluable in development and aging studies. Research has shown that separation anxiety caused by separating pups from their mother from an early age for periods of half an hour or more can cause developmental and behavioural changes in later life, similar to ADHD in humans.[35] In elderly degus, neural markers have been discovered which are remarkably similar to those in humans with Alzheimer's disease, which is the first time this has been seen in a wild-type rodent.[36]

Pets[edit]

Captive degus need plenty of space to exhibit a full range of normal behaviours

After initial interest into degus as research subjects, degus have become popular as pets, though until very recently they were seldom found in pet shops. Their advantages over traditional small pets are their diurnal habits, bubbly personalities, the haired tail (as compared to rats and mice) and their lifespan: they are reported to live up to 13 years under ideal circumstances (though a poor gene pool/genetic background often reduces a pet degu's lifespan significantly).[citation needed] The average lifespan of a degu in captivity is typically around 6–8 years of age. One disadvantage of the degu as a pet is their predisposition to chewing, due to their continually growing incisor and molar teeth.[3] For this reason degus cannot be housed in plastic-bottomed cages typically found in pet stores. A metal cage with multiple levels made for rats and secured double latches works best. It is important to line the levels with grass mats or a soft fabric so that the degus do not get bumble feet.[citation needed] Untamed degus, as with most small animals, can be prone to biting, but their intelligence makes them easy to tame. Regular non-predatory handling and food offerings help with this transition. It is important never to try to catch a degu by the tail because it will fall off easily and is painful to the creature. If this occurs it will not grow back. Degus often 'groom' their human owners, by a gentle nibbling action, and readily bond with any person spending time with them. Degus need regular sand baths to keep their coats healthy and free from grease. Chinchilla sand is ideal for this. They should have access to this regularly, preferably two or three times a week, half an hour at a time. Daily sandbathing can make their coats soiled.

Legal status[edit]

Some jurisdictions consider degu as a potential invasive species and forbid owning them as a pets. In the United States they are illegal to own in California, Georgia, and Alaska.[37] In Canada they are illegal to own in Newfoundland and Labrador. They are completely illegal in New Zealand.[38]

Gallery[edit]

References[edit]

  1. ^ Lessa, E.; Ojeda, R.; Bidau, C. (2008). "Octodon degus". IUCN Red List of Threatened Species. Version 2008. International Union for Conservation of Nature. Retrieved 5 January 2009. 
  2. ^ Muñoz Urrutia, Rafael, ed. (2006), Diccionario Mapuche: Mapudungun/Español, Español/Mapudungun (in Spanish) (2nd ed.), Santiago, Chile: Editorial Centro Gráfico, pp. 104, 105, 141, ISBN 956-8287-99-X 
  3. ^ a b c Woods, C.; Boraker, D. (21 November 1975), "Octodon degus", Mammalian Species 67: 1–5 
  4. ^ Ebensperger, L. A.; Bozinovic, F. (2000), "Communal burrowing in the hystricognath rodent, Octodon degus: A benefit of sociality?", Behavioural and Ecological Sociobiology 47 (5): 365–369, doi:10.1007/s002650050678, ISSN (Print) 1432-0762 (Online) 0340-5443 (Print) 1432-0762 (Online) 
  5. ^ a b Ebensperger, L. A.; Bozinovic, F. (2000b), "Energetics and burrowing behaviour in the semifossorial degu Octodon degus (Rodentia: Octodontidae)", Journal of Zoology 252 (2): 179–186, doi:10.1111/j.1469-7998.2000.tb00613.x 
  6. ^ a b Ebensperger, L.A.; Veloso, C.; Wallem, P. (2002), "Do female degus communally nest and nurse their pups?", Journal of Ethology 20 (2): 143–146, doi:10.1007/s10164-002-0063-x, ISSN (Print) 1439-5444 (Online) 0289-0771 (Print) 1439-5444 (Online) 
  7. ^ Ebensperger, L.A.; Hurtado, M.; Lacey, E.; Chang, A.; Chang, AT (2004), "Communal nesting and kinship in degus (Octodon degus)", Naturwissenschaften 91 (8): 391–395, doi:10.1007/s00114-004-0545-5, ISSN (Print) 1432-1904 (Online) 0028-1042 (Print) 1432-1904 (Online), PMID 15309311 
  8. ^ Quirici, V.; Castro, R.A.; Oyarzun, J.; Ebensperger, L.A. (2008), "Female degus (Octodon degus) monitor their environment while foraging socially", Anim Cogn. 11 (3): 441–448, doi:10.1007/s10071-007-0134-z, ISSN (Print) 1435-9456 (Online) 1435-9448 (Print) 1435-9456 (Online), PMID 18214556 
  9. ^ Long, C.V. (2007), "Vocalisations of the degu (Octodon degus), a social caviomorph rodent", Bioacoustics 16: 223–244, ISSN 0952-4622 
  10. ^ Ziabreva, I.; Schnabel, R.; Poeggel, G.; Braun, K. (2003), "Mother's voice "buffers" separation-induced receptor changes in the prefrontal cortex of Octodon degus", Neuroscience 119 (2): 433–441, doi:10.1016/S0306-4522(03)00123-4, PMID 12770557 
  11. ^ Kleiman, D.G. (1974), Rowlands, I. W.; and Weir, B. J., ed., Patterns of behaviour in hystricomorph rodents. Symp Zool Soc Lond., 34: 171-209. In: The Biology of Hystricomorph Rodents, London: Academic Press 
  12. ^ Fischer, R.; Meunier, G. (1985), "Responses to conspecifics' urine by the degu Octodon degus", Physiological Behaviour 34 (6): 999–1001, doi:10.1016/0031-9384(85)90027-7 
  13. ^ Jechura, T.; Walsh, J.; Lee, T. (2003), "Testosterone suppresses circadian responsiveness to social cues in the diurnal rodent Octodon degus", Journal of Biological Rhythms 18 (1): 43–50, doi:10.1177/0748730402239675, PMID 12568243 
  14. ^ Ebensperger, L.A.; Caiozzi, A. (2002), "Male degus, Octodon degus, modify their dustbathing behviour in response to social familiarity of previous dustbathing marks", Revista Chilena de Historia Natural 75: 157–163, doi:10.4067/S0716-078X2002000100015, ISSN 0716-078X 
  15. ^ Bozinovic, F.; Bacigalupe, L.; Vasquez, R.; Visser, H.; Veloso, C.; Kenagy, G. (2004), "Cost of living in free-ranging degus (Octodon degus): Seasonal dynamics of energy expenditure", Comparative Biochemistry and Physiology A 137 (3): 597–604, doi:10.1016/j.cbpb.2003.11.014, PMID 15123196 
  16. ^ Brown, C.; Donnelly, T. (2001), "Cataracts and reduced fertility in degus (Octodon degus): Contracts secondary to diabetes mellitus", Lab Animal (NY) 30: 25–26, ISSN 0093-7355 
  17. ^ a b Long, C.V.; Ebensperger, L.A. (2009), "Pup growth rates and breeding female weight changes in two populations of captive bred degus (Octodon degus), a precocial caviomorph rodent", Reprod Domest Anim. 45 (6): 975–82, doi:10.1111/j.1439-0531.2009.01470.x, ISSN 0936-6768., PMID 19497026 
  18. ^ Reynolds, T.; Wright, J. (1979), "Early postnatal physical and behavioural development of degus (Octodon degus)", Lab Animal (NY) 13 (2): 93–9, doi:10.1258/002367779780943576 
  19. ^ http://www.exoticnutrition.com/breedingdegus.html
  20. ^ a b c Kenagy, G.; Nespolo, R.; Vasquez, R.; Bozinovic, F. (2002), "Daily and seasonal limits of time and temperature to activity of degus", Revista Chilena de Historia Natural 75 (3): 567–581, doi:10.4067/S0716-078X2002000300008, ISSN 0716-078X 
  21. ^ Cha'vez, A.; Bozinovic, F.; Peich, F.; Palacios, A. (2003), "Retinal spectral sensitivity, fur coloration and urine reflectance in the genus Octodon (Rodentia): Implications for visual ecology", IOVS 44 (5): 2290–2296, doi:10.1167/iovs.02-0670 
  22. ^ Palacios, A.; Bozinovic, F. (2003), "An "enactive" approach to ingtegrative and comparative biology: Thoughts on the table", Biol Res. 36 (1): 101–105, doi:10.4067/S0716-97602003000100008, ISSN 0716-9760, PMID 12795209 
  23. ^ Bozinovic, F.; Gallardo, P.A.; Visser, G.H.; Cortés, A. (2003), "Seasonal acclimatization in water flux rate, urine osmolality and kidney water channels in free-living degus: Molecular mechanisms, physiological processes and ecological implications", J Exp Biol. 206 (Pt 17): 2959–2966, doi:10.1242/jeb.00509, PMID 12878664 
  24. ^ Langer, P. (2002), "The digestive tract and life history of small mammals", Mammal Review 32 (2): 107–131, doi:10.1046/j.1365-2907.2002.00101.x 
  25. ^ Gutiérrez, J.; Bozinovic, F. (1998), "Diet selection in captivity by a generalist herbivorous rodent (Octodon degus) from the Chilean costal desert", Journal of Arid Environments 39 (4): 601–607, doi:10.1006/jare.1998.0412 
  26. ^ a b Kenagy, G.; Veloso, C.; Bozinovic, F. (1999), "Daily rhythms of food intake and feces reingestion in the degu, an herbivorous Chilean rodent: Optimizing digestion through coprophagy", Physiological and Biochemical Zoology 72 (1): 78–86, doi:10.1086/316644, PMID 9882606 
  27. ^ Opazo, J.C.; Soto-Gamboa, M.; Bozinovic, F. (2004), "Blood glucose concentration in caviomorph rodents", Comp. Biochem. Physiol. A. 137: 57=64, doi:10.1016/j.cbpb.2003.09.007 
  28. ^ Nishi, M.; Steiner, D. (2003), "Cloning of complementary DNA's encoding islet amyloid polypeptide, insulin, and glucagon precursors from a New World rodent, the degu, Octodon degus", Molecular Endocrinology 4 (8): 1192–8, doi:10.1210/mend-4-8-1192, PMID 2293024 
  29. ^ a b Okanoya, K.; Tokimoto, N.; Kumazawa, N.; Hihara, S.; Iriki, A.; Ferrari, Pier Francesco (2008), "Tool-Use Training in a Species of Rodent: The Emergence of an Optimal Motor Strategy and Functional Understanding", in Ferrari, Pier Francesco, PLoS ONE 3 (3): e1860, doi:10.1371/journal.pone.0001860, PMC 2268009, PMID 18365015 
  30. ^ Tokimoto, N.; Okanoya, K. (2004), "Spontaneous construction of "Chinese boxes" by degus (Octodon degus): A rudiment of recursive intelligence?", Japanese Psychological Research 46 (3): 255–261, doi:10.1111/j.1468-5584.2004.00257.x 
  31. ^ Kas, M. J. H.; Edgar, D. M. (2000), "Photic phase response curve in Octodon degus: Assessment as a function of activity phase preference", American Journal of Physiology 277 (5): R1385–1389, PMID 10801311 
  32. ^ Kas, M.J.; Edgar, D.M. (1998), "Crepuscular rhythms of EEG sleep-wake in a hystricomorph rodent, Octodon degus", J. Biol. Rhythms 13 (1): 9–17, doi:10.1177/074873098128999871, PMID 9486839 
  33. ^ Morris, L.G.; Tate, B.L. (2007), "Phase response curve to melatonin in a putatively diurnal rodent, Octodon degus", Chronobiol. Int. 24 (3): 407–411, doi:10.1080/07420520701420352, PMID 17612940 
  34. ^ Jechura, T.J.; Mahoney, M.M.; Stimpson, C.D.; Lee, T.M. (2006), "Odor-specific effects on reentrainment following phase advances in the diurnal rodent, Octodon degus", Am. J. Physiol. Regul. Integr. Comp. Physiol. 291 (6): R1808–1816, doi:10.1152/ajpregu.00005.2006, ISSN 0363-6119/06, PMID 16840658 
  35. ^ Zehle, S.; Bock, J.; Jezierski, G.; Gruss, M.; Braun, K. (2007), "Methylphenidate treatment recovers stress-induced elevated dendritic spine densities in the rodent dorsal anterior cingulate cortex", Dev. Neurobiol. 67 (14): 1891–1900, doi:10.1002/dneu.20543, PMID 17874461 
  36. ^ Inestrosa, N.C.; Reyes, A.E.; Chacon, M.A.; Cerpa, W.; Villalon, A.; Montiel, J.; Merabachvili, G.; Aldunate, R. et al. (2004), "Human-like rodent amyloid-beta-peptide determines Alzheimer pathology in aged wild-type Octodon degus", Neurobiol. Aging 26 (7): 1023–8, doi:10.1016/j.neurobiolaging.2004.09.016, PMID 15748782 
  37. ^ http://degucage.com/where-are-degus-legal/
  38. ^ http://nz.answers.yahoo.com/question/index?qid=20080905164302AAjFqrw
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!