Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphimallon solstitiale

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGATATTGGTACTCTCTACTTTTTATTTGGNAGATGGGCTGGAATAGTGGGAACTTCTTTAAGACTGCTAATCCGAGCAGAATTAGGAAACCCAGGAACTTTAATTGGTGAT---GACCAAATCTACAATGTCATCGTTACAGCCCATGCATTCGTAATAATTTTTTTTATAGTGATACCCATCATAATTGGAGGATTCGGAAATTGATTAGTCCCATTAATGCTTGGAGCCCCCGACATAGCATTCCCTCGAATAAACAACATAAGATTCTGATTACTCCCCCCCTCTCTAACACTTCTGCTTATAAGAAGCCTTGTAGAAAGAGGTGCTGGAACTGGTTGAACTGTTTACCCACCTTTATCATCTAACATTGCCCATAGAGGAGCTTCAGTTGATTTAGCTATTTTTAGATTACACTTAGCAGGGATCTCCTCAATTCTAGGAGCAGTAAATTTTATTACCACAGTGATCAATATACGATCTACAGGAATAACCTTTGATCGAATACCATTATTTGTTTGATCCGTAGCACTAACTGCTCTTTTACTTTTACTATCTTTACCTGTCTTAGCAGGAGCTATTACAATNCTCCTTACTGATCGAAACATTAACACTTCCTTTTTTGACCCTGCTGGAGGAGGGGACCCNATTTTATACCAACACTTATTCTGATTTTTTGGACACCCAGAAGTTTATATTTTAATTCTTCCTGGATTTGGAATAATCTCCCATATTATCAGCCAAGAAAGAAGAAAGAAAGAAACCTTTGGAACCTTAGGAATAATTTATGCTATAATAGCTATTGGTTTACTAGGATTTATTGTATGGGCCCACCATATATTCACAGTTGGGATAGACGTTGATACTCGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amphimallon solstitiale

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Amphimallon solstitiale

Amphimallon solstitiale, also known as the summer chafer or European june beetle, is a beetle similar to the cockchafer but much smaller, approximately 20 millimetres (0.79 in) in length. They are declining in numbers now, but where found they are often seen in large numbers.At dusk they actively fly around tree tops looking for a mate and can often be found drowning in pools of water the following morning. They are also attracted to light and come in through open, lit windows and fly around lamps, making quite a racket while bumping into lights. They are found throughout the Palearctic region, commonly seen from June to August, living in meadows, hedgerows, and gardens, and eating plants and tree foliage.

Distribution[edit]

The species can be found in such countries as Slovenia, Croatia, France, Greece, Italy, Spain, southern part of Russia and Britain I.[1]

References[edit]

  1. ^ "Amphimallon solstitiale (Linnaeus 1758)". 2.6.1. Fauna Europaea. May 24, 2013. Retrieved August 3, 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!