Overview

Comprehensive Description

Characteristics

Dorylus is characterized by the following derived traits (Bolton 2003):
  • Distal margin of labrum not concave/cleft medially
  • Propodeal spiracle subtended by a longitudinal impression
  • Abdominal segments V-VII with strongly differentiated presclerites
  • Pygidium large, flattened to concave dorsally, lateral margin armed with a pair of teeth or short spines
  • Queen with bursa copulatrix permanently open
  • Queen hypopygium hypertrophied and bilobate posteriorly
  • Male submarginal cell of forewing extremely elongate

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Workers small or of medium size, without eyes or ocelli, highly polymorphic, constituting a series of forms which may be grouped as maximae, or soldiers, mediae and minimae. In the maxima the head is very large and usually broader in front than behind, the mandibles are long and narrow, with a small number of teeth on the inner border, the clypeus is very short and not marked off from the remainder of the head by sutures. Frontal carinae very short, erect, close together, not concealing the insertions of the antennae. Antennae short, inserted very near the mouth, 9- to 12- jointed, according to the species. Mediae smaller, with much smaller and shorter head, but the latter not narrowed in front; anterior border of clypeus more or less projecting in the middle over the mouth. Antennae as in the maxima. Minima very small, with the head narrowed anteriorly and the anterior border of the clypeus strongly projecting in the middle. Number of antennal joints reduced, seven being the minimum. Promesonotal suture distinct in all three forms of worker; mesoepinotal suture obsolete. Epinotum always unarmed. Petiole nodiform; postpetiole narrowed anteriorly, not or only indistinctly separated from the first gastric segment. Pygidium with a dorsal impression and terminating in three points. Posterior tibiae each with a pectinated spur.

 

Female very much larger than the worker, dichthadiiform, i. e. wingless, with long and voluminous abdomen. The head has the occipital lobes swollen and rounded, separated by a median longitudinal furrow. Eyes and ocelli absent, as in the workers. Clypeus as in the worker maxima, or soldier. Mandibles narrow, edentate. Antennae 11-jointed (12-jointed in the subgenus Dichthadia ). Thorax segmented, but the mesonotum without differentiated scutum and scutellum; alar insertions vestigial. Petiole large, its posterior corners prolonged as blunt points. Postpetiole shorter than the first gastric segment, but not followed by a constriction. Pygidium and hypopygium gaping or separated so as to expose to view the eighth pair of abdominal spiracles, the anal segment and sting; the pygidium not impressed; the hypopygium surpassing the pygidium considerably and terminating in two lobes or appendages.

 

Male very large, with very large eyes and ocelli. Clypeus short, prolonged backward between the short, diverging frontal carinae. Mandibles edentate. Antennae 13-jointed; scape one-third or one-fourth as long as the funiculus which is filiform. Legs short; femora flattened, tibiae narrow. Wings with narrow, poorly defined pterostigma, placed near the apical third; radial cell elongate and open; one closed cubital cell, usually one recurrent nervure (two in the subgenus Rhogmus and in some anomalies). Petiole nodiform or saucer-shaped, its concavity turned toward the postpetiole, the latter not separated from the gaster by a constriction. Gaster long, cylindrical or club-shaped. Pygidium rounded or split at the posterior border ( Rhogmus fimbriatus ). Genital armature voluminous, completely retractile; annular lamina narrow; stipes and volsella simple; lacinia absent; subgenital plate deeply furcate.

 

Emery, who has devoted much careful study to the Dorylinae, divides Dorylus into six subgenera ( Dorylus , sensu stricto; Dichthadia , Gerstaecker; Anomma , Shuckard; Typhlopone Westwood ; Rhogmus Shuckard; Alaopone Emery) mainly on the number of antennal joints and structure of the pygidium in the worker, the number of antennal joints and shape of the hypopygium in the female, and the shape of the; mandibles and petiole in the male. The genus (Map 4) occurs throughout Africa, India, Indochina, the Malayan Region, and Indonesia (Borneo, Java, Sumatra, and Celebes). All but one of the subgenera and most of the species are found in Africa; in Asia there are less than half a dozen species belonging to the subgenera Dichthadia , Typhlopone , and Alaopone .

 

In the 'Genera Insectorum' (Dorylinae, 1910, p. 7) Emery makes the following statement on the ethology of the genus Dorylus:Apart from the subgenus Anomma all the species of Dorylus lead a subterranean life and come to the surface of the soil only on exceptional occasions, as, e. g., during inundations or in order to accompany the males when they take flight. Their societies are very populous. The soldiers and workers make subterranean expeditions for the. purpose of capturing insects and other small animals, and exploit manure piles, cadavers and probably also the nests of termites. The males come to lights at night. Search for the heavy and voluminous apterous females is beset with difficulties so that they are rare in collections. It may be noted that in all the specimens hitherto described, with the exception of the female of D. fimbriatus described by Brauns, the terminal tarsal joints are lacking. I infer that the workers tear them off durin g the underground forays, while they are dragging the colossal queen by all her legs through the narrow galleries.

 

Map

License not applicable

Wheeler, W. M.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1.42 - 1.42
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus cf. vishnui DJCK-2007

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGCTTTATGATCAGGAATNTTAGGATCTTCTATAAGAATAATTATTCGTTTAGAATTAGGTACTTGTGATAAAATAATTATAGAT---GATCAAATTTTTAATACTATTATTACAAGACATGCATTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGATTTGGAAATTTTATTGCACCTCTTATAATTGGGGCCCCTGATATAGCATATCCACGAATAAATAATATAAGATTTTGATTACTACCTCCATCTATTACTCTAATAATTATAAGTAATTTTATTAACAGAGGACCAGGAACAGGATGAACAGTTTACCCTCCTTTAGCTTCAAGTATCTATCATAGAGGAGCATCAATTGATTTAACTATTTTTTCATTACATATTGCAGGTATATCATCAATTTTAGGAGCAATTAATTTTATTTCAACAATTATTAATATACATCATAAAAATTTAACTATAGATAAAACACCTNTATTTGTTTGATCAATTTTAATTACAGCTATTTTATTATTATTATCACTTCCAGTTTTAGCAGGAGCTATTACTATATTATTAACAGACCGAAATATTAATACTTCTTTTTTTGATCCTTCTGGTGGAGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus cf. vishnui DJCK-2007

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:92Public Records:41
Specimens with Sequences:75Public Species:36
Specimens with Barcodes:68Public BINs:36
Species:42         
Species With Barcodes:38         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Dorylus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dorylus

The army ant genus Dorylus, also known as driver ants, safari ants, or siafu, is found primarily in central and east Africa, although the range also extends to tropical Asia. The term siafu is a loanword from Swahili,[1] and is one of numerous similar words from regional Bantu languages used by indigenous peoples to describe various species of these ants. Unlike the New World members of the subfamily Ecitoninae, members of this genus do form temporary anthills lasting from a few days up to three months. Each colony can contain over 20 million individuals. As with their New World counterparts, there is a soldier class among the workers, which is larger, with a very large head and pincer-like mandibles. They are capable of stinging, but very rarely do so, relying instead on their powerful shearing jaws.[2]

Contents

Life cycle [edit]

Some soldier safari ants make tunnels to provide a safe route for the workers.

Seasonally, when food supplies become short, they leave the hill and form marching columns of up to 50,000,000 ants, which are considered a menace to people, though they can be easily avoided; a column can only travel about 20 metres in an hour. It is for those unable to move, or when the columns pass through homes, that there is the greatest risk.[3] Their presence is, conversely, beneficial to certain human communities, such as the Maasai, as they perform a pest prevention service in farming communities, consuming the majority of other crop-pests, from insects to large rats.[2]

The characteristic long columns of ants will fiercely defend themselves against anything that attacks them.[2] Columns are arranged with the smaller ants being flanked by the larger soldier ants. These automatically take up positions as sentries, and set a perimeter corridor in which the smaller ants can run safely. Their bite is severely painful, each soldier leaving two puncture wounds when removed. Removal is difficult, however, as their jaws are extremely strong, and one can pull a soldier ant in two without it releasing its hold. Large numbers of ants can kill small or immobilized animals and eat the flesh. A large part of their diet is earthworms. All Dorylus species are blind, though they, like most varieties of ants, communicate primarily through pheromones.[2]

In the mating season, alates (winged queens and drones) are formed. The drones are larger than the soldiers and the queens are even larger. They mate on the wing, and the queens go off to establish new colonies. As with most ants, workers and soldiers are sterile (non-reproducing) females.[2]

A male driver ant

Male driver ants, sometimes known as "sausage flies" (a term also applied to males of New World ecitonines) due to their bloated, sausage-like abdomens, are the largest known ants, and were originally believed to be members of a different species. Males leave the colony soon after hatching, but are drawn to the scent trail left by a column of siafu once they reach sexual maturity. When a colony of driver ants encounters a male, they tear its wings off and carry it back to the nest to be mated with a virgin queen. As with all ants, the males die shortly afterward.[2]

Such is the strength of the ant's jaws that, in East Africa, they are used as natural, emergency sutures. Various East African indigenous tribal peoples (e.g. Maasai moran), when suffering from a gash in the bush, will use the soldiers to stitch the wound by getting the ants to bite on both sides of the gash, then breaking off the body. This use of ants as makeshift surgical staples creates a seal that can hold for days at a time, and the procedure can be repeated, if necessary, allowing natural healing to commence.[4][5]

Several species in this genus carry out raids on termitaria, paralysing or killing some of the termites and carting them back to the nest.[6]

Species [edit]

Dorylus sp. in Cameroon, consuming a grasshopper
Dorylus sp. in Zambia, consuming mayonnaise
A column of Safari ants in Kakamega Forest, Kenya, guarded by soldiers

See also [edit]

References [edit]

  1. ^ Swahili translation
  2. ^ a b c d e f Hölldobler, Bert; Wilson, Edward O. (1990). The Ants. Belknap Press of Harvard University Press. ISBN 0-674-04075-9. 
  3. ^ Master of the Killer Ants
  4. ^ Gottrup, F. & David Leaper (2004). "Wound healing: historical aspects" (PDF). EWMA Journal 4 (2): p. 22. 
  5. ^ Gudger, E. W. (1925). "Stitching Wounds With the Mandibles of Ants and Beetles.". Journal of the American Medical Association 84: pp. 1861–64. 
  6. ^ Biotropics
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!