You are viewing this Genus as classified by:

Articles on this page are available in 2 other languages: French (41), German (1) (learn more)

Overview

Comprehensive Description

Camponotus HNS perjurus Shattuck & McArthur

Worker. HW 1.2 - 1.8; HL 1.9 - 2.3; PW 1.4 - 1.55. Major worker not yet described. Minor worker. Purplish, tending iridescent; unique head, pronotum attached well below vertex, resembling Iridomyrmex purpureus HNS in attachment; propodeal dorsum concave; a few scattered erect setae, none under head, on tibiae nor on scapes; head sides straight, tapering forward; vertex nearly semicircular; anterior clypeal margin projecting, convex; color mostly red-brown with gaster darker.

  • McArthur, A. J. (2007): A key to Camponotus Mayr of Australia. In: Snelling, R. R., Fisher, B. L., Ward, P. S. (Eds): Advances in ant systematics (Hymenoptera: Formicidae): Homage to E. O. Wilson - 50 years of contributions. Memoirs of the American Entomological Institute 80, 290-351: 310-310, URL:http://hdl.handle.net/10199/15375
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camponotus HNS arenatus Shattuck HNS & McArthur

Worker. HW 1.5 - 1.8; HL 1.9 - 2.2. Major worker not yet described. Minor worker. Pronotum anterior regions dark red to black, distinctly darker than mesonotum and propodeum; metanotal groove depressed below level of anterior region of propodeum; node anterior face much shorter than posterior face; tibiae and scapes lacking erect setae; anterior clypeal margin broadly convex; propodeum lacking a distinct angle, PD / D about 1.5; node summit broadly convex; erect setae on all surfaces of head and mesosoma, node and gaster, absent from scapes and tibiae.

  • McArthur, A. J. (2007): A key to Camponotus Mayr of Australia. In: Snelling, R. R., Fisher, B. L., Ward, P. S. (Eds): Advances in ant systematics (Hymenoptera: Formicidae): Homage to E. O. Wilson - 50 years of contributions. Memoirs of the American Entomological Institute 80, 290-351: 312-312, URL:http://hdl.handle.net/10199/15375
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camponotus HNS owensae Shattuck & McArthur

Worker. HW 1.6 - 2.0; HL 2.0 - 2.4; PW 1.4 - 1.60. Major worker not yet described. Minor worker. Entirely black; propodeum with a wide concavity and a posterior hump; metanotal groove depressed below level of anterior region of propodeum; node summit long and flat, its anterior face much shorter than posterior; setae on tibiae raised to 20°, none visible on scapes, otherwise overall plentiful white flat-lying, with a few erect; anterior clypeal margin projecting bounded by rounded angles.

  • McArthur, A. J. (2007): A key to Camponotus Mayr of Australia. In: Snelling, R. R., Fisher, B. L., Ward, P. S. (Eds): Advances in ant systematics (Hymenoptera: Formicidae): Homage to E. O. Wilson - 50 years of contributions. Memoirs of the American Entomological Institute 80, 290-351: 312-312, URL:http://hdl.handle.net/10199/15375
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camponotus HNS Mayr, 1861: Europ. Formicid.:35,(Wien).

Type-species: Formica ligniperda Latreille HNS , 1802, Fourmis: 88, by designation of Bingham, 1903.

Distribution: Palaearctic, Ethiopian, Oriental, Australian, Polynesian, Nearctic & Neotropical regions.

Key to species

1- First gastral tergite with basal two thirds paler than the rest; petiole dorsum steeply rounded (Fig. 12) ... Campontus oasium Forel HNS

- Gaster completely dark or with small yellowish batch at base only; petiole dorsum widely rounded to flat (Fig. 13)... Campontus thoracicus (Fabricius) HNS

  • Mohamed, S., Zalat, S., Fadl, H. (2001): Taxonomy of ant species (Hymenoptera: Formicidae) collected by pitfall traps from Sinai and Delta region, Egypt. Egyptian Journal of Natural History 3, 40-61: 43-43, URL:http://plazi.org:8080/dspace/handle/10199/16666
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genus Camponotus HNS Mayr, 1861

Camponotus HNS Mayr, 1861:35.

Type-species: Formica ligniperda Latreille HNS , 1802.

This is a world wide genus with a large number of species reaching their greatest abundance in the tropics. The form of the alitrunk and head varies considerably. Although attempts have been made to differentiate species groups, it has not been possible to make clearcut distinctions in all cases to justify the use of subgeneric names. Despite the variety of form, the attachment of the antennal scape some distance from the clypeal border is a constant feature that immediately distinguishes the genus from Formica HNS and Lasius HNS . The antennae are 12 segmented in the female and worker, 13 in the male; segments 2 to 5 are marginally longer than those following. Maxillary palps 6 segmented, labial palps 4 segmented. Frontal carinae are sinuate broadening behind the antennal insertions. Ocelli are absent in the worker, small but distinct in the female and male. Wings with one discoidal cell, cubital cell absent. Male external genitalia small.

In North Europe the 4 Fennoscandian species all mine in dead wood but only C. herculeanus HNS occasionally mines in live trees. This and C. ligniperda HNS are among the largest ants found in Europe with major workers up to 12 or 14 mm long and females up to 18 mm long.

Keys to species of Camponotus HNS

Workers

1 Front clypeal border incised in middle (Fig. 114)............... 29. fallax (Nylander) HNS

Front clypeal border entire............................................................................ 2

2 (1) Colour uniformly black; pubescence thick; projecting hairs profuse over whole body including gaster (Fig. 118)........................................... 30. vagus (Scopoli) HNS

Colour in part reddish; pubescence thin; hairs on gaster sparse mainly restricted to tergite borders............................................................................ 3

3 (2) Gaster shining with pubescence short, sparse often absent over medial areas of first and second gaster tergite. Basal face of first tergite and sometimes whole tergite reddish; alitrunk bright yellowish red to dark red 32. ligniperda (Latreille) HNS

Gaster somewhat dull with long pubescence evenly distributed over dorsal surface; basis of first gaster tergite often with a small reddish patch behind scale; alitrunk dull red, sometimes reddish black............ 31. herculeanus (Linne) HNS

Queens

1 Front clypeal border incised in middle; size smaller: head width 2.0-2.2mm 29. fallax (Nylander) HNS

Front clypeal border entire; size larger head width over 3 mm.........................

2 (1) Colour uniformly black with thick pubescence and numerous standing hairs on gaster................................................................................ 30. vagus (Scopoli) HNS

Bicoloured with at least propodeum reddish ................................................... 3

3 (2) General appearance shining, pubescence short sparse or absent over medial area of first gaster tergite (Fig. 122). Punctuation on frons shallow 32. ligniperda (Latreille) HNS

General appearance somewhat dull, gaster pubescence long and evenly distributed over surface (Fig. 123). Punctuation on frons deep 31. herculeanus (Linne) HNS

Males

Front border of clypeus with shallow emargination ........... 29. fallax (Nylander) HNS

Front border of clypeus convex...................................................................... 2

2 (1) Long hairs abundant over dorsum of head and gaster; dorsal crest of petiole sharply angled at sides enclosing wide and deep emargination (Fig. 115) 30. vagus (Scopoli) HNS

Head and dorsal surface of gaster with sparse hairs; petiole with shallow emargination and sides of dorsal crest more rounded (Fig. 121)................................ 3

3 (2) From above, gaster fringed at the sides with scattered projecting hairs; pubescence long (0.075-0.125 mm)..................................31. herculeanus (Linne) HNS

From above, first two gaster tergites usually without hairs; pubescence sparse and short (0.05 mm)..................................................... 32. ligniperda (Latreille) HNS

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 86-88, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camponotus HNS donnellani Shattuck HNS & McArthur

Worker. HW 1.40; HL 1.58. Major worker not yet described. Minor worker. Head, mesosoma and node red with upper surfaces of head, pronotum and sometimes mesonotum with blotches of darker color; propodeum with at most 4 elongate erect setae near angle; anterior propodeal dorsum feebly concave, posterior straight; node summit broadly rounded; head sides nearly parallel; vertex rounded; anterior clypeal margin feebly projecting, broadly convex; long setae scattered on all surfaces, absent from scapes and tibiae; glossy.

  • McArthur, A. J. (2007): A key to Camponotus Mayr of Australia. In: Snelling, R. R., Fisher, B. L., Ward, P. S. (Eds): Advances in ant systematics (Hymenoptera: Formicidae): Homage to E. O. Wilson - 50 years of contributions. Memoirs of the American Entomological Institute 80, 290-351: 313-313, URL:http://hdl.handle.net/10199/15375
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camponotus HNS rufonigrus Shattuck HNS & McArthur

Worker. HW 1.1 - 1.4; HL 1.3 - 1.6; PW 0.9 - 1.2. Major worker not yet described. Minor worker. Black head contrasting with red mesonotum; propodeum with more than 10 erect setae scattered; pronotum and mesonotum evenly convex; metanotum indistinct; propodeum concave anteriorly, flat posteriorly, angle rounded, PD / D about 1.5; anterior clypeal margin evenly convex, carina conspicuous; dorsal and under surfaces of head, mesosoma, petiole, gaster and coxa with sparse long erect setae; entire body with short indistinct flat-lying short setae; tibiae and scapes lacking erect setae.

  • McArthur, A. J. (2007): A key to Camponotus Mayr of Australia. In: Snelling, R. R., Fisher, B. L., Ward, P. S. (Eds): Advances in ant systematics (Hymenoptera: Formicidae): Homage to E. O. Wilson - 50 years of contributions. Memoirs of the American Entomological Institute 80, 290-351: 313-313, URL:http://hdl.handle.net/10199/15375
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camponotus HNS Mayr

Worker medium-sized to very large, potymorphic, rarely dimorphic, the worker maxima having a large, broad head, the minima a much smaller head and more slender body, the media being intermediate in structure. Head differing considerably in form in different species, usually broad and more or less excised behind, narrower in front, very convex above and flattened beneath. Mandibles powerful, short, triangular, with coarse teeth on their broad apical borders; external border and upper surface convex in large individuals. Palpi moderately long, the maxillary pair 6-, the labial pair 4-jointed. Clypeus large, trapezoidal or subrectangular, usually carinate or subcarinate, often divided into a large, median, subhexagonal and two small, triangular, lateral divisions, which do not reach the lateral border of the cheeks, the anterior border entire or emarginate, often excised on each side, with a broad, more or less projecting median lobe. Frontal area small, triangular or lozenge-shaped; frontal groove distinct; frontal carinae long, prominent, marginate, and sinuate or S-shaped, rising from the posterior border of the clypeus. Eyes moderately large, broadly elliptical, not very prominent, situated behind the middle of the head; ocelli absent, the anterior ocellus sometimes indicated. Antennae 12-jointed; scapes sometimes thickened distally, inserted some distance behind the posterior border of the clypeus; funiculi long, filiform, not enlarged at their tips, all the joints longer than broad. Thorax differing greatly in shape in the various species, typically broadly and more or less evenly arcuate in profile, broad in front, laterally compressed behind, the epinotum usually simple and unarmed. Rarely the mesonotum is impressed or sellate. Petiole surmounted by an erect scale, the upper border of which may be blunt or anteroposteriorly compressed, entire, subacuminate or more or less emarginate. Gaster rather large, broadly elliptical, its first segment forming less than half its surface. Legs long and well developed. Gizzard with a long slender calyx, the sepals of which are not reflected at their anterior ends.

Female larger than the worker maxima but usually with smaller head. The latter and the petiole much as in the worker. Ocelli present. Thorax elongate elliptical; pronotum short, its posterior margin arched, its posterior angles reaching back to the insertions of the wings, mesonotum and scutellum long, convex; metanotum depressed below the scutellum. Gaster elongate elliptical, massive. Wings long and ample, the anterior pair with a radial, one cubital, and no discoidal cell.

Male small and slender; head small, with very prominent eyes and ocelli. Mandibles small and narrow. Antennae 13-jointed, slender, scapes long. Petiolar node thick and blunt; gaster elongate, with small slender genital appendages. Legs very slender. Wing venation as in the female.

Pupae nearly always enclosed in cocoons.

This huge cosmopolitan genus, comprising more than 1000 described forms, has become so unmanageable that Forel and Emery have recently split it up into some thirty-six subgenera. The frequent occurrence of species of Camponotus HNS in all countries, except Great Britain and New Zealand, and the extraordinary variability of many of the species in response to slight differences of environment make the genus one of considerable interest to the student of geographical distribution. In the Ethiopian Region, it is represented by numerous species assignable to no less than eleven of the thirty-six subgenera recognized by Emery and myself, namely, Myrmoturba HNS , Dinomyrmex HNS (Map 41), Myrmosericus HNS , Myrmothrix HNS (one species, probably introduced). Orthonotomyrmex HNS , Myrmotrema HNS (Map 38), Myrmopiromis HNS , Myrmorhachis HNS , Myrmopsamma HNS , Myrmamblys HNS , and Colobopsis HNS , and species of six others, Camponotus HNS , sensu stricto, Myrmosaulus HNS , Myrmosaga HNS , Mayria HNS , Myrmonesites HNS , and Myrmopytia HNS , occur in f lie Malagasy Region. A few of these subgenera, Myrmopsamma HNS and Myrmopiromis HNS , are peculiarly African, while others, Myrmosaga HNS , Mayria HNS , Myrmonesites HNS , and Myrmopytia HNS , are only found in Madagascar. The development of the subgenus Myrmoturba HNS and especially of the species maculatus (Fabricius) HNS , the typical form of which is West African, is extraordinary, as will be seen by consulting the catalogue(Part VIII). C. (Myrmoturba) maculatus HNS (Map 39) and two other species, C. (Myrmosericus) rufoglaucus HNS (Map 42) and C. (Orthonotomyrmex) sericeus HNS (Map 43), have a singular distribution. Forms of maculatus HNS occur in all the continents; rufoglaucus HNS , with many varieties, ranges from southern China across India and equatorial and South Africa to the Gulf of Guinea; and sericeus HNS occupies a similar range, though showing little tendency to produce subspecies and varieties.

Map 38. Distribution of Myrmotrema HNS , a subgenus of Camponotus HNS of the Ethiopian and Malagasy Regions. According to Emery (1920) one species occurs in India.

The species of Camponotus HNS often form very populous colonies and exhibit a great diversity of nesting habits. Many live in the ground, either under stones or in crater nests, others under bark, in dead wood, hollow twigs, and galls, and a few construct carton nests or employ their larvae, after the manner of Oecophylla HNS , in spinning together particles of vegetable detritus with silk ( C. senex HNS and formiciformis HNS ). The food ofthe various species consists of miscellaneous insects, the excreta of aphids (honeydew), and nectar. Many of the smaller forms are stolid, apathetic, or timid, but the maxima workers of the large species belonging to the subgenera Dinomyrmex HNS , Myrmoturba HNS , Myrmothrix HNS , and Myrmopiromis HNS are very pugnacious and capable of inflicting painful wounds with their powerful mandibles.

  • Wheeler, W. M. (1922): The ants collected by the American Museum Congo Expedition. Bulletin of the American Museum of Natural History 45, 39-269: 232-234, URL:http://plazi.org:8080/dspace/handle/10199/17097
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ Camponotus HNS ]] sp. alw-02.

Caaguazú , Canindeyú , Central, Ñeembucú (ALWC, IFML, INBP).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 29-29, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ Camponotus HNS ]] sp. alw-09.

Boquerón (ALWC).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 29-29, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ Camponotus HNS ]] sp. alw-04.

Pte. Hayes (ALWC).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 29-29, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ Camponotus HNS ]] sp. alw-03.

Canindeyú (ALWC).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 29-29, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ Camponotus HNS ]] sp. alw-06.

Boquerón (ALWC).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 29-29, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genus Camponotus Mayr HNS

Species of Camponotus HNS (carpenter ants) are found in almost all terrestrial habitats of California, and include both ground-nesting and arboreal species. The workers are generalist scavengers and predators, and are most active at dusk and at night. Identification of the California species can be difficult. The keys cited below do not cover all of the species in this state, several of which are undescribed. The images on AntWeb provide additional assistance in identification. See also the description of Camponotus maritimus HNS above (under “Taxonomic Changes”).

Species identification: keys in Wheeler and Wheeler (1986g) and Mackay and Mackay (2002). Additional references: Brady et al. (2000), Chen et al., (2002), Creighton and Snelling (1967), Degnan et al. (2004), Gadau et al. (1999), Hansen and Akre (1985), MacArthur(2005), Sameshima et al. (1999), Sauer et al. (2000), Smith (1979), Snelling (1968b, 1970, 1988).

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: 28-29, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ Camponotus HNS ]] sp. alw-08.

Boquerón , Pte. Hayes (ALWC).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 29-29, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ Camponotus HNS ]] sp. alw-01.

Boquerón , Pte. Hayes (ALWC).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 29-29, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ Camponotus HNS ]] sp. alw-05.

Canindeyú (ALWC).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 29-29, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camponotus HNS sp. CA-01

E2 [endemic to California floristic province (Hickman, 1993)]

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camponotus HNS sp. CA-02

E2 [endemic to California floristic province (Hickman, 1993)]

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ Camponotus HNS ]] sp. alw-07.

Canindeyú (ALWC).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 29-29, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Worker. HW 1.1 - 1.4; HL 1.3 - 1.6; PW 0.9 - 1.2. Major worker not yet described. Minor worker. Black head contrasting with red mesonotum; propodeum with more than 10 erect setae scattered; pronotum and mesonotum evenly convex; metanotum indistinct; propodeum concave anteriorly, flat posteriorly, angle rounded, PD / D about 1.5; anterior clypeal margin evenly convex, carina conspicuous; dorsal and under surfaces of head, mesosoma, petiole, gaster and coxa with sparse long erect setae; entire body with short indistinct flat-lying short setae; tibiae and scapes lacking erect setae.

License not applicable

McArthur, A. J.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worker. HW 1.40; HL 1.58. Major worker not yet described. Minor worker. Head, mesosoma and node red with upper surfaces of head, pronotum and sometimes mesonotum with blotches of darker color; propodeum with at most 4 elongate erect setae near angle; anterior propodeal dorsum feebly concave, posterior straight; node summit broadly rounded; head sides nearly parallel; vertex rounded; anterior clypeal margin feebly projecting, broadly convex; long setae scattered on all surfaces, absent from scapes and tibiae; glossy.

License not applicable

McArthur, A. J.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worker. HW 1.6 - 2.0; HL 2.0 - 2.4; PW 1.4 - 1.60. Major worker not yet described. Minor worker. Entirely black; propodeum with a wide concavity and a posterior hump; metanotal groove depressed below level of anterior region of propodeum; node summit long and flat, its anterior face much shorter than posterior; setae on tibiae raised to 20°, none visible on scapes, otherwise overall plentiful white flat-lying, with a few erect; anterior clypeal margin projecting bounded by rounded angles.

License not applicable

McArthur, A. J.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worker. HW 1.5 - 1.8; HL 1.9 - 2.2. Major worker not yet described. Minor worker. Pronotum anterior regions dark red to black, distinctly darker than mesonotum and propodeum; metanotal groove depressed below level of anterior region of propodeum; node anterior face much shorter than posterior face; tibiae and scapes lacking erect setae; anterior clypeal margin broadly convex; propodeum lacking a distinct angle, PD / D about 1.5; node summit broadly convex; erect setae on all surfaces of head and mesosoma, node and gaster, absent from scapes and tibiae.

License not applicable

McArthur, A. J.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worker. HW 1.2 - 1.8; HL 1.9 - 2.3; PW 1.4 - 1.55. Major worker not yet described. Minor worker. Purplish, tending iridescent; unique head, pronotum attached well below vertex, resembling Iridomyrmex purpureus in attachment; propodeal dorsum concave; a few scattered erect setae, none under head, on tibiae nor on scapes; head sides straight, tapering forward; vertex nearly semicircular; anterior clypeal margin projecting, convex; color mostly red-brown with gaster darker.

License not applicable

McArthur, A. J.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ worker ]]. Fundnotiz: Tulear (SW. Madagaskar).

License not applicable

Forel,A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worker medium-sized to very large, potymorphic, rarely dimorphic, the worker maxima having a large, broad head, the minima a much smaller head and more slender body, the media being intermediate in structure. Head differing considerably in form in different species, usually broad and more or less excised behind, narrower in front, very convex above and flattened beneath. Mandibles powerful, short, triangular, with coarse teeth on their broad apical borders; external border and upper surface convex in large individuals. Palpi moderately long, the maxillary pair 6-, the labial pair 4-jointed. Clypeus large, trapezoidal or subrectangular, usually carinate or subcarinate, often divided into a large, median, subhexagonal and two small, triangular, lateral divisions, which do not reach the lateral border of the cheeks, the anterior border entire or emarginate, often excised on each side, with a broad, more or less projecting median lobe. Frontal area small, triangular or lozenge-shaped; frontal groove distinct; frontal carinae long, prominent, marginate, and sinuate or S-shaped, rising from the posterior border of the clypeus. Eyes moderately large, broadly elliptical, not very prominent, situated behind the middle of the head; ocelli absent, the anterior ocellus sometimes indicated. Antennae 12-jointed; scapes sometimes thickened distally, inserted some distance behind the posterior border of the clypeus; funiculi long, filiform, not enlarged at their tips, all the joints longer than broad. Thorax differing greatly in shape in the various species, typically broadly and more or less evenly arcuate in profile, broad in front, laterally compressed behind, the epinotum usually simple and unarmed. Rarely the mesonotum is impressed or sellate. Petiole surmounted by an erect scale, the upper border of which may be blunt or anteroposteriorly compressed, entire, subacuminate or more or less emarginate. Gaster rather large, broadly elliptical, its first segment forming less than half its surface. Legs long and well developed. Gizzard with a long slender calyx, the sepals of which are not reflected at their anterior ends.

 

Female larger than the worker maxima but usually with smaller head. The latter and the petiole much as in the worker. Ocelli present. Thorax elongate elliptical; pronotum short, its posterior margin arched, its posterior angles reaching back to the insertions of the wings, mesonotum and scutellum long, convex; metanotum depressed below the scutellum. Gaster elongate elliptical, massive. Wings long and ample, the anterior pair with a radial, one cubital, and no discoidal cell.

 

Male small and slender; head small, with very prominent eyes and ocelli. Mandibles small and narrow. Antennae 13-jointed, slender, scapes long. Petiolar node thick and blunt; gaster elongate, with small slender genital appendages. Legs very slender. Wing venation as in the female.

 

Pupae nearly always enclosed in cocoons.

 

This huge cosmopolitan genus, comprising more than 1000 described forms, has become so unmanageable that Forel and Emery have recently split it up into some thirty-six subgenera. The frequent occurrence of species of Camponotus in all countries, except Great Britain and New Zealand, and the extraordinary variability of many of the species in response to slight differences of environment make the genus one of considerable interest to the student of geographical distribution. In the Ethiopian Region, it is represented by numerous species assignable to no less than eleven of the thirty-six subgenera recognized by Emery and myself, namely, Myrmoturba , Dinomyrmex (Map 41), Myrmosericus , Myrmothrix (one species, probably introduced). Orthonotomyrmex , Myrmotrema (Map 38), Myrmopiromis , Myrmorhachis , Myrmopsamma , Myrmamblys , and Colobopsis , and species of six others, Camponotus , sensu stricto, Myrmosaulus , Myrmosaga , Mayria , Myrmonesites , and Myrmopytia , occur in f lie Malagasy Region. A few of these subgenera, Myrmopsamma and Myrmopiromis , are peculiarly African, while others, Myrmosaga , Mayria , Myrmonesites , and Myrmopytia , are only found in Madagascar. The development of the subgenus Myrmoturba and especially of the species maculatus (Fabricius) , the typical form of which is West African, is extraordinary, as will be seen by consulting the catalogue(Part VIII). C. (Myrmoturba) maculatus (Map 39) and two other species, C. (Myrmosericus) rufoglaucus (Map 42) and C. (Orthonotomyrmex) sericeus (Map 43), have a singular distribution. Forms of maculatus occur in all the continents; rufoglaucus , with many varieties, ranges from southern China across India and equatorial and South Africa to the Gulf of Guinea; and sericeus occupies a similar range, though showing little tendency to produce subspecies and varieties.

 

The species of Camponotus often form very populous colonies and exhibit a great diversity of nesting habits. Many live in the ground, either under stones or in crater nests, others under bark, in dead wood, hollow twigs, and galls, and a few construct carton nests or employ their larvae, after the manner of Oecophylla , in spinning together particles of vegetable detritus with silk ( C. senex and formiciformis ). The food ofthe various species consists of miscellaneous insects, the excreta of aphids (honeydew), and nectar. Many of the smaller forms are stolid, apathetic, or timid, but the maxima workers of the large species belonging to the subgenera Dinomyrmex , Myrmoturba , Myrmothrix , and Myrmopiromis are very pugnacious and capable of inflicting painful wounds with their powerful mandibles.

License not applicable

Wheeler, W. M.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

E2 [endemic to California floristic province (Hickman, 1993)]

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

E2 [endemic to California floristic province (Hickman, 1993)]

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Species of Camponotus (carpenter ants) are found in almost all terrestrial habitats of California, and include both ground-nesting and arboreal species. The workers are generalist scavengers and predators, and are most active at dusk and at night. Identification of the California species can be difficult. The keys cited below do not cover all of the species in this state, several of which are undescribed. The images on AntWeb provide additional assistance in identification. See also the description of Camponotus maritimus above (under “Taxonomic Changes”).

 

Species identification: keys in Wheeler and Wheeler (1986g) and Mackay and Mackay (2002). Additional references: Brady et al. (2000), Chen et al., (2002), Creighton and Snelling (1967), Degnan et al. (2004), Gadau et al. (1999), Hansen and Akre (1985), MacArthur(2005), Sameshima et al. (1999), Sauer et al. (2000), Smith (1979), Snelling (1968b, 1970, 1988).

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Boquerón (ALWC).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Boquerón , Pte. Hayes (ALWC).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Canindeyú (ALWC).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Boquerón (ALWC).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Canindeyú (ALWC).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pte. Hayes (ALWC).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Canindeyú (ALWC).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caaguazú , Canindeyú , Central, Ñeembucú (ALWC, IFML, INBP).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Boquerón , Pte. Hayes (ALWC).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type-species: Formica ligniperda Latreille , 1802, Fourmis: 88, by designation of Bingham, 1903.

 

Distribution: Palaearctic, Ethiopian, Oriental, Australian, Polynesian, Nearctic & Neotropical regions.

 

Key to species

 

1- First gastral tergite with basal two thirds paler than the rest; petiole dorsum steeply rounded (Fig. 12) ... Campontus oasium Forel

 

- Gaster completely dark or with small yellowish batch at base only; petiole dorsum widely rounded to flat (Fig. 13)... Campontus thoracicus (Fabricius)

License not applicable

Mohamed, S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

J'ai etabli ce sous-genre en 1921, (Ann. Soc. Ent. de Belgique, LXI, p. 310.) sur un petit groupe de Camponotus africains qui fait un bloc assez homogene et distinct de ses voisins. Cependant, mon regrette ami et collegue M. C. Emery, crut devoir le decomposer dans son Catalogue des Formicinae du Genera Insectorum, 1925. 11 est evident qu'il n'en avait pas saisi entierement la figure puisque des formes tres voisines se rapportant au C. chrysurus Gerst . comme races ou varietes se trouvent placees par lui dans trois sous-genres differents. Ainsi les Camponotus chrysurus , Gerst., altisquamis Mayr., Kollbrunneri For. et apelis For. sont classes dans le S. G. Myrmopiromis Wheeler; les C. barbarossa, Em. , arminius For, securifer Em., Yvonnae For. dans le S. - G. Myrmamblys Forel; le C. micipsa Wh. dans le S. - G. Myrmisolepis Sants. Or ces formes sont incontestablement si voisines qu'il faut beaucoup d'attention pour les distinguer et cela sur des caracteres si minimes que pour la plupart ils ne valent pas la distinction specifique.

 

C'est entre les S. - G. Myrmopiromis et Myrmotrema que doit se placer le S. - G. Myrmopelta , dont voici les caracteres distinctifs:

 

Epistome de l'ouvriere maxima etroit, subrectangulaire, assez plat, avec une impression longitudinale et mediane plus ou moins nette et occupant tout l'article ou seulement son quart posterieur. Chez l'ouvriere media et minor, l'epistome devient trapezoidal et plus ou moins carene. Le bord anterieur forme un leger lobe qui depasse faiblement le bord anterieur de la tete chez cette derniere tandis qu'il ne le depasse pas chez l'ouvriere maxima, La tete est assez grande, souvent allongee chez l' [[ worker ]] major,. mais surtout chez la femelle. Le pronotum est arrondi, sans epaules ni bordure. L'epinotum est nettement separe du promesonotum par un sillon plus ou moins imprime. A la sculpture ordinaire s'ajoute quelquefois une ponctuation pilifere en forme de fossettes allongees disposees surtout autour de la bouche et rappelant le S. - Myrmotrema . La pilosite dressee est bien developpee doree ou blanchatre, assez epaisse mais pointue, parfois une pelisse sur le gastre. Le noir domine.

 

Voici la liste des especes:

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ouvriere. - Notablement dimorphe. Tete plus ou moins allongee, arrondie et retrecie en arriere chez les petites ouvrieres, elargie en arriere chez les grandes; yeux remarquablement en arriere du milieu; ocelles distincts chez les grandes ouvrieres.

 

Mandibules saillantes, multidentees. Epistome carene, avec un lobe arrondi et un peu echancre au milieu. Aretes frontales rapprochees entre elles, a peu pres droites, tres peu divergentes en arriere. Antennes inserees, comme chez les Camponotus , de 12 articles; scape tres long, - depassant le bord occipital de plus de la moitie de sa longueur, meme chez l'ouvriere maxima. Corselet allonge avec le dos en selle, la partie la plus basse et la plus etroite etant representee par le metanotum, qui est largement decouvert, limite devant et derriere par des sutures et portant ses stigmates, rapproches sur le dos. L'epinotum est en bosse arrondie. L'ecaille est epaisse et obtuse.

 

Femelle. - Ailee. Tete et antennes comme chez la grande ouvriere. L'ecaille est plus haute et legerement echancree au sommet.

 

Male. - Corps grele. Tete allongee, avec les yeux grands, situes tres en arriere du milieu des cotes. Mandibules a bord masticateur large et multidente. Epistome abord anterieur arrondi et echancre au milieu. Corselet relativement bas et long. Ecaille nodiforme. Armure genitale bien plus grande et plus robuste que chez les Camponotus : stipes triangulaires. Ailes comme chez Camponotus .

 

Les ouvrieres de ce genre ressemblent aux Camponotus du sousgenre Myrmosphincta par le port, mais elles en different par leurs longues antennes dont le scape depasse amplement le bord occipital, meme dans les plus grands exemplaires, et les stigmates du metanotum rapproches sur le dos. Gesier a peu pres comme chez Oecophylla .

 

Les males different de tous les Camponotus par leurs mandibules larges et multidentees.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ouvriere. - Pas de dimorphisme; taille peu variable. Tete rectangulaire avec les angles posterieurs arrondis. Epistome plat, sans carene et sans lobe¡ largement entaille au milieu de son bord anterieur. Corselet a dos plat, obtusement borde: pronotum a epaules anguleuses; metanotum limite par des sutures devant et derriere sur le dos, ses stigmates situes au-dessous du bord qui limite sa face dorsale; suture meso-metanotale enfoncee; epinotum tronque en arriere. Ecaille tres epaisse, anguleuse sur les cotes de son bord dorsal.

 

Femelle. - Tete comme chez l'ouvriere. Corselet deprime: vu par-dessus, le pronotum est presque aussi long que le disque du mesonotum; celui-ci n'est que tres peu proeminent sur le pronotum, et le scutellum ne l'est pas du tout sur le postscutellum et l'epinotum. Ailes comme chez Camponotus .

 

Male inconnu.

 

Une seule espece: Camponotus Buchneri For.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Je complete la diagnose de Forel: tout le corps est deprime chez les ouvrieres et les femelles, surtout chez C. obtritus dont l' [[ worker ]] a tout a fait l'air d'avoir ete ecrasee. La tete est rectangulaire chez les grandes [[ worker ]], en trapeze allonge chez les petites; les yeux sont situes en arriere et lateralement. Le dos du corselet est plat et l'ecaille basse et epaisse. Le tegument est noir, mat et poilu; les pattes sont longues, comprimees et herissees de poils.

 

Cette diagnose exclut C. mirabilis que Forel avait place dans ce groupe et qui est le type de mon sous-genre Myrmostenus .

 

Amerique tropicale.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

J'adopte la liste de Forel.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

J'ai exclu de la liste de Forel les especes de Madagascar et le C. integellus qui y figurait evidemment par erreur. J'y ai place l'espece C. abscissus du sous-genre Myrmamblys .

 

Ce groupe est a present exclusivement neotropical.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

La tete du soldat et de la femelle de l'espece type est tronquee a l'exces: la face oblique anterieure est plane, contournee d'un bord net et comprend l'epistome entier, ainsi qu'une partie des aretes frontales, de sorte que l'articulation des antennes se trouve juste a la limite de la face tronquee. La tete de l'ouvriere est retrecie en arriere comme chez quelques especes de Myrmoturba ou de Dinomyrmex . Chez une autre espece ( C. Tonduzi ) que j'ai cru devoir associer a l'espece type, la tete de l'ouvriere est faite precisement comme chez le type, mais celle du soldat est beaucoup plus indifferente et n'a pas de surface nettement tronquee. Une troisieme espece a ete decrite recemment par Mann (C. Burtoni); le soldat ressemble au type; l'ouvriere est inconnue.

 

Amerique centrale et meridionale.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

J'etablis cette coupe pour les C. mirabilis , longipilis et sphenocephalus du bassin de l'Amazone, dont j'ai decrit la femelle sans l'ouvriere, et qui me paraissent former un groupe naturel, a cause de leur corps extremement allonge et de leur tete deprimee. Forel a place une de ces especes dans le sous-genre Myrmomalis , avec lequel elle n'a rien de commun, sauf la depression du corps.

 

Je suppose que quand on connaitra les ouvrieres, elles ressembleront a celles du sous-genre precedent.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

J'ai rassemble dans ce sous-genre la plupart des especes neotropicales a tegument luisant que Forel a reparties dans ses groupes Colobopsis et Myrmamblys .

 

La tete des petites ouvrieres est allongee, arrondie derriere, a bords lateraux a peu pres paralleles, et luisante; celle des grandes est plus ou moins rectangulaire, obtuse ou tronquee par devant; parfois la surface tronquee a un bord net; elle comprend alors l'epistome tout entier; la surface de la tete de ces ouvrieres ou soldats et des femelles est plus ou moins sculpturee, au moins dans sa partie anterieure. Corselet a dos arque et continu.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

J'ai circonscrit ce sous-genre aux especes neotropicales relativement indifferentes, c'est-a-dire que j'en ai detache quelque« petits groupes particulierement differencies surtout dans la structure de la tete.

 

Dans ces limites, le sous-genre en question tient le milieu entre les Myrmoturba massifs de l'Amerique meridionale ( C. chilensis , tenuiscapus , Bruchi , etc) par C. punctulatus et le sous-genre Myrmobrachys .

 

Les ouvrieres presentent generalement un dimorphisme bien accentue dans la forme de la tete. Celle-ci est souvent large et arrondie lateralement, tronquee ou echancree derriere et plus ou moins obtuse par devant chez les grandes [[ worker ]] ( C. punctulatus , fastigatus , etc.), ou bien longue avec les cotes plus ou moins paralleles et parfois subtronquee par devant ( C. novogranadensis , personatus , etc). L'epistome des petites [[ worker ]] a generalement le bord anterieur arrondi; celui des grandes est depourvu de lobe. Le dos du corselet est continu, sans echancrure. Le tegument est ordinairement mat.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Je limite le groupe subgenerique aux especes qui presentent les caracteres suivants:

 

a) Surface tronquee de la tete, chez la grande ouvriere, le soldat et la femelle, circonscrite ou non d'un bord net, laissant en dehors de la troncature une partie de l'epistome.

 

b) Aretes frontales divergentes, relativement courtes, droites ou faiblement sigmoides; les articulations des antennes situees au milieu ou en arriere du milieu des susdites aretes.

 

En general, il n'y a pas d'intermediaires entre les petites ouvrieres et les grandes ou soldats, sauf dans le groupe des grandes especes malaises ( C. cylindricus , saundersi , pilosus , etc), qui meriteraient peut-etre un sous-genre a part.

 

Les especes de ce sous-genre habitent surtout la region indomalaise, la Papouasie et l'Australie; l'espece type, le bassin de la Mediterranee et le Japon; enfin, quelques formes, qui se rapprochent du type, le Sud des Etats-Unis, le Mexique et les Antilles.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Je place ici ce sous-genre que je ne connais pas en nature. Forel soupconne que ce pourrait bien etre la petite ouvriere d'un Colobopsis (et moi j'ajoute d'un Myrmotemnus ), dont le soldat est inconnu.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

J'etablis cette coupe essentiellement pour les especes du sousgenre Myrmamblys de Forel, qui vivent dans l'Ancien Continent, ainsi que dans la Malaisie, l'Australie et l'Oceanie, et le groupe centro-americain, C. sexguttatus et especes voisines, que Forel a classe dans son sous-genre Myrmosphincta .

 

Les especes de ce nouveau sous-genre different des veritables Myrmamblys neotropicaux par le tegument en general luisant, meme sur la tete des petites ouvrieres, plus ou moins sculpture sur celle des grandes ouvrieres, des soldats et des femelles; par le corselet des [[ worker ]] souvent plus ou moins impressionne sur le dos, notamment chez les especes de la Malaisie et chez le groupe sexguttatus .

 

Ce sous-genre est difficile a caracteriser. Le dimorphisme se montre d'une facon tres differente dans la forme de la tete, plus ou moins tronquee par devant. L'epistome est toujours compris tout entier dans la troncature. L'insertion des antennes est situee bien en avant-du milieu des aretes frontales (comme d'ailleurs dans la generalite des Camponotus ). Parfois (comme dans les veritables Colobopsis ) il n'y a pas d'intermediaires entre les petites et les grandes ouvrieres, de sorte que l'on peut bien distinguer des ouvrieres et des soldats, comme, par exemple, chez C. emarginatus de l'Afrique australe. D'apres Viehmeyer, C. dolichoderoides n'aurait pas de polymorphisme. Cette espece est voisine de C. exsectus , dont on ne connait pas la grande [[ worker ]] et dont la [[ queen ]] a a peu pres la forme de tete de la petite [[ worker ]], sauf qu'elle est bien plus grande.

 

Je pense que lorsque l'on connaitra mieux ce groupe passablement heterogene, il conviendra de le subdiviser, car il n'est en somme qu'un residu de classification.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caracteres de la tete comme dans le sous-genre precedent, sauf l'absence totale des points-fossettes sur les joues des grandes [[ worker ]] et des 9. Le dos du corselet des ouvrieres est continu; le pronotum est souvent margine et quelquefois epaule ( C. fulvopilosus, Ellioti , Themistocles ). La plupart des especes portent des poils grossiers, obtus, de couleur claire (blancs, jaunes ou roux) plus ou moins abondants, quelquefois formant pelisse sur le gastre ou sur le dos du corselet. Ce genre de poils se trouve sur quelques especes des deux sous-genres precedents.

 

Afrique equatoriale et australe et surtout Madagascar.

 

Je n'ai maintenu dans ce sous-genre que les especes africaines ou malgaches que Forel y a classees; celles d'autres provenances m'ont paru trop heterogenes pour pouvoir y etre laissees. En revanche, j'y ai mis les especes malgaches et ethiopiennes que Forel classe parmi les Myrmobrachys . Ce sous-genre, tel que je l'ai reforme, forme une trinite avec les deux precedents.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stature et tete de l'ouvriere comme dans le sous-genre precedent. Corselet avec ou sans entaille dorsale. Chez les grandes [[ worker ]] et les [[ queen ]], le devant de la tete est crible de fossettes rondes, comme enlevees a l'emporte-piece.

 

Afrique et Madagascar: une espece de l'Inde. Transition au sous-genre precedent et au suivant.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Especes en general massives, a tegument mat, quelquefois revetu d'une pubescence soyeuse ou avec quelques poils courts, grossiers et obtus. La stature de l'ouvriere est ordinairement peu variable; la tete des grandes [[ worker ]], tres large en arriere, jamais tronquee devant; celle des petites, en trapeze, elargie posterieurement. Epistome avec ou sans lobe. Dos du corselet de l'ouvriere plus ou moins interrompu d'une entaille au devant de l'epinotum; quelquefois le dos est plan et seulement la suture meso-epinotale est profondement marquee et l'epinotum meme est margine lateralement et derriere (ex. C. robustus ); l'epinotum est ordinairement margine, rarement en bosse arrondie ( C. Dofleini , Wasmanni ); pronotum borde ou non, parfois epaule; chez C. Wasmanni il est arme d'une paire de courtes epines. Ecaille squamiforme ou nodiforme.

 

Les especes de ce sous-genre ont leur centre principal en Afrique et a Madagascar; quelques-unes habitent l'Inde et le bassin de la Mediterranee.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Je me suis decide a separer C. lateralis et especes voisines de. C. sericeus, Kiesenwetteri , etc. J'ai donc ressuscite le sous-genre Myrmentoma For., qui a pour type C. lateralis , tandis que Orthonotomyrmex Ashm. a pour type C. sericeus .

 

Les caracteres distinctifs des deux series sont: d'abord la sculpture du tegument: C. lateralis est luisant, tandis, que les especes de l'autre serie sont mates. Puis la structure de l'epistome: celui-ci, dans la serie lateralis , est etroit; les fossettes clypeales sont profondes et occupent presque entierement ses parties laterales; le bord anterieur a une encoche mediane tres evidente. Cette structure n'est pas aussi marquee chez C. Gestroi. Elle est identiquement la meme chez C. lateralis que chez C. caryae Fitch ( fallax Nyl.) et especes voisines, chez lesquelles le dos du corselet est continu chez l'ouvriere. Cela me porte a reunir toutes ces especes dans un seul sous-genre et a considerer le groupe caryae comme la souche dont sont issues les formes a dos interrompu.

 

Les especes du groupe caryae ont ete classees par Forel dans le sous-genre Camponotus , dont elles different par la structure de l'epistome. Les [[ male ]] de C. caryae ont la tete courte et le funicule des antennes compose d'articles courts, comme chez lateralis et especes voisines, tandis que les especes du sous-genre Camponotus , tel que je l'ai circonscrit, ont la tete longue et les articles du funicule allonges, comme chez C. maculatus et ses sous especes.

 

Les especes de ce sous-genre habitent les pays temperes de la region holarctique, y compris le bassin de la Mediterranee.

 

Le seul Camponotus connu de l'Ambre, C. Mengei Mayr, parait se rapporter au groupe caryae .

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Je fonde cette coupe pour l'espece C. imitator For. de Madagascar, qui ne saurait etre associee avec aucune autre, a cause de ses caracteres singuliers, residant surtout dans la structure du corselet de l'ouvriere.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Je rassemble dans ce nouveau sous-genre trois especes que Forel a classees dans des sous-genres differents du genre Camponotus ( Myrmosphincta , Myrmobrachys et Orthonotomyrmex ) et deux dans le genre Calomyrmex . Ces especes proviennent toutes de Madagascar. Le genre Calomyrmex est tres homogene et compose de formes exclusivement australiennes et papouasiennes monomorphes. Il devenait heterogene par l'inclusion des especes madecasses un peu dimorphes C. putatus et heteroclitus . En effet, Forel a decrit une grande et une petite ouvriere de C. putatus .

 

Pas de grandes differences entre les ouvrieres major et minor. Tete en trapeze arrondi, plus large derriere, obtuse devant. Epistome remarquablement court, son bord anterieur arrondi; chez C. Mocquerisi , il est etroitement entaille au milieu. Mandibules courtes. Corselet a sutures accusees: pronotum deprime et ordinairement obtusement borde; une encoche plus ou moins marquee sur le dos devant l'epinotum; celui-ci offre des formes differentes. selon les especes. Le metanotum n'est pas apparent sur le dos; cependant ses stigmates sont visibles lorsqu'on regarde l'insecte d'en haut. Ecaille plus ou moins epaisse et basse.

 

Ce groupe parait se relier au sous-genre Myrmosaga , surtout par une espece inedite qui ressemble a C. gibber et dont voici la diagnose.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Une seule espece de Madagascar, qui a beaucoup de ressemblance avec certaines especes du sous-genre precedent (par exemple C. pictipes ). Le caractere distinctif du sous-genre, qui consiste dans le segment basal du gastre court et deprime, n'a pas, a mon avis, grande importance et je serais vraiment tente de fondre ces deux groupes en un seul sous-genre (voir plus bas la description de l'espece nouvelle C. Sikorai).

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Je reunis dans ce sous-genre des especes, toutes de Madagascar, que Forel repartit dans trois de ses sous-genres, a cause de la forme du profil du corselet des ouvrieres, mais qui me paraissent constituer un ensemble naturel. Je connais les [[ male ]] de deux especes que Forel place dans des sous-genres differents: C. quadrimaculatus , type du sous-genre Myrmosaga et C. gibber qui est classe parmi les Myrmosphincta . Tous deux ont une forme de tete que je ne retrouve chez aucune autre espece, avec les ocelles places sur une bosse du vertex, comme chez les [[ male ]] de la plupart des Pheidole . Je pense que c'est une preuve suffisante de la parente des susdites especes.

 

La tete de la grande ouvriere est large et echancree derriere; celle de la petite est tronquee derriere avec les angles posterieurs arrondis et les cotes paralleles. L'epistome a generalement un lobe court, arrondi ou parfois tronque, les parties laterales ordinairement bien distinctes. Le profil du corselet presente dans les differentes especes les trois memes conditions que dans le sous-genre Myrmophyma . Le pronotum n'est jamais margine. L'ecaille est plus ou moins epaisse. Le tegument est toujours luisant et la sculpture fine.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caracterise par le profil du corselet de l'ouvriere fortement courbe et non interrompu. L'epinotum est comprime et reduit sur le dos a une arete; sa face declive abrupte. Du reste comme les especes a thorax court et haut du sous-genre precedent. Australie et Oceanie.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tete des grandes ouvrieres cordiforme, celle des petites arrondie et retrecie en arriere, chez quelques especes, au point de n'avoir plus de bord posterieur et meme ( C. camelinus ) de former un cou, comme chez quelques especes de Dinomyrmex . Corselet en general elance; pronotum arrondi, non borde; une depression plus ou moins marquee sur le dos devant l'epinotum, qui est plus ou moins releve en bosse arrondie (tres evidente chez C. cinerascens et camelinus ). Stigmates du metanotum visibles dorsalement. Ecaille plus ou moins nodiforme. Pattes velues (excepte chez C. aurocinctus ).

 

Chez C. Batesi de Madagascar, le dos du corselet n'est presque pas impressionne devant l'epinotum. Je ne connais que la petite ouvriere.

 

J'ai reforme entierement ce sous-genre, en n'y laissant que le type designe par l'auteur et les especes parentes qui habitent l'Indochine, la Malaisie et l'Australie. Une espece douteuse de Madagascar. J'ai etabli le genre Notostigma pour les especes C. Carazzii et Podenzanai d'Australie.

 

Les sous-genres Myrmosphincta , Myrmosaga et Myrmocamelus , que Forel a etablis sur des caracteres plus ou moins vagues de la forme du corselet des ouvrieres, ne resistent pas a la critique. Ce sont, a mon avis, des assemblages d especes heterogenes dont j'ai de mon mieux fait l'ecart.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ouvriere et femelle. - - Tete encore plus deprimee en avant que dans le sous-genre precedent, avec lequel les especes de ce groupe ont de la ressemblance. Pattes non poilues; tibias et tarses non comprimes.

 

Malacca et Archipel indien. Especes habitant les plantes myrmecophiles.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Petit groupe d'especes malaisiennes, qui ont de l'analogie avec les sous-genres Myrmothrix et Myrmaphaenus . Tete ordinairement deprimee dans sa partie anterieure; mandibules saillantes; epistome ordinairement sans carene. Tarses anterieurs garnis d'une brosse epaisse; tibias et tarses comprimes. Pattes et scapes plus ou moins velus.

 

J'ai compris dans ce sous-genre toutes les especes qu'y a mises Forel, plus le type du sous-genre Myrmophyma ( C. quadrisectus ). Mais cette espece ne presente pas le moins du monde la forme de la tete, caractere essentiel de cette derniere coupe.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

dont l'ouvriere differe de tous ses congeneres par le pronotum pourvu d'epaules dentiformes, la crete mediane du mesonotum et de l'epinotum et les tarses tres comprimes. Amerique tropicale.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ouvriere et femelle. - Tete de la grande [[ worker ]] plus longue que large, a bords lateraux a peu pres paralleles, passablement deprimee; le bord posterieur echancre; epistome ordinairement sans lobe, meme il est parfois echancre a son bord anterieur, avec ou sans carene. Tete de la petite ' [[ worker ]] elargie derriere. Tegument mat, finement sculpture, herisse de poils grossiers et courts ou plus longs et fins; chez une espece ( C. blandus ), revetu de pubescence soyeuse. Corselet comme dans les sous-genres precedents. Tibias et tarses ordinairement comprimes.

 

Region neotropicale. - Sont compris dans ce sous-genre les C. coruscus et Leydigi , que Forel a classes parmi le sous-genre Myrmothrix , et quatre (ou cinq) autres especes.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ouvriere et femelle. - Caracteres de Myrmoturba , mais la tete des grandes [[ worker ]] est en general massive et plutot arrondie; celle des petites non retrecie en arriere. Especes grandes ou moyennes, pourvues de soies abondantes sur le corps et, a peu d'exceptions pres, sur les membres. Le tegument est presque toujours mat et quelquefois revetu d'une pubescence soyeuse. Tarses non comprimes.

 

Une espece fait des jardins de fourmis dans les forets du Bresil ( C. femoratus ); d'autres des nids de carton ou nichent dans la terre ou le bois pourri. Elles habitent exclusivement la region neotropicale, excepte une forme d'Afrique qui est suspecte d'avoir ete importee. J'ai elimine de ce groupe les especes asiatiques que Forel y avait mises, et meme quelques especes americaines, cela dans le but de lui donner plus d'homogeneite.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ouvriere et femelle. - Caracteres de Myrmoturba . Le tegument est entierement mat, tres finement sculpture, d'aspect soyeux et plus ou moins recouvert d'une pubescence plus ou moins abondante sur tout le corps, surtout sur le gastre.

 

Especes plus ou moins sabulicoles. Forel comprend dans ce sous-genre des especes de tous les pays. Je l'ai limite aux formes de l'Inde, du bassin de la Mediterranee et de l'Afrique.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ouvriere et femelle. - Especes grandes ou tres grandes. Le caractere qui distingue ce sous-genre du precedent est que, chez les petites [[ worker ]], la tete se retrecit en arriere en un cou, ou du moins de telle sorte qu'en dehors de l'articulation, on ne peut y discerner de bord posterieur. Du reste comme Myrmoturba avec lequel il se relie intimement.

 

Habite la zone tropicale de tous les continents y compris Madagascar.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ouvriere et femelle. - Epistome carene, pourvu a son bord anterieur d'un lobe tres prononce, ordinairement rectangulaire, rarement d'autre forme. Tete des grandes [[ worker ]] en general notablement plus large derriere que devant, souvent echancree a son bord posterieur; celle des petites [[ worker ]] avec les bords lateraux paralleles ou retrecie en arriere, de sorte que le bord posterieur est fort reduit. Mandibules generalement a six ou sept dents. Dos du corselet arque comme dans le sous-genre precedent; rarement le profil de l'epinotum est legerement deprime en forme de selle. Sculpture variable; chez quelques especes de l'Amerique meridionale (ex. C. chilensis ) le gastre est couvert d'une pubescence copieuse formant pelisse.

 

Nids generalement dans la terre ou sous les pierres. Dans tous les continents et dans beaucoup d'iles. Transitions multiples, notamment a Camponotus , Myrmamblys , Myrmotemnus , Myrmophyma , Dinomyrmex , Myrmothrix et Myrmosericus .

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ouvriere et femelle. - Je limite ce sous-genre aux grandes especes ayant l'epistome non carene ou avec une carene peu apparente, sans lobe anterieur ou avec un lobe peu avance, plus ou moins rectangulaire ( japonicus ) ou arrondi ( sansabeanus ): son bord anterieur n'est pas incise au milieu. Tete de la grande [[ worker ]] et de la [[ queen ]] non tronquee ou obtuse devant; peu plus large derriere que devant. Mandibules fortement arquees, a quatre ou cinq, quelquefois six dents. Dos du corselet arque, continu sur le profil; dos du pronotum arrondi ou parfois deprime chez les grandes [[ worker ]], avec les epaules legerement saillantes.

 

Les C. ocreatus et sansabeanus relient ce sous-genre au suivant.

 

Nids generalement dans le bois. Habite la region holarctique, surtout l'Amerique du Nord, d'ou je pense que le groupe est originaire. Une espece de Madagascar est probablement d'une tout autre origine.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

- [[ worker ]]. - Long. 7 a 9,5 mill. - Taille, aspect et stature du nossibeensis Andre. Mais conformation du Darwinii rubropilosus . La face basale du metanotum est presque deux fois plus longue que large (plus large que longue chez le nossibeensis ). Pilosite de l'abdomen moins dense que chez le type du rubropilosus .

 

Madagascar; ma collection.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diese Gattung ist meines Wissens nur auf der oestlichen Halbkugel der Erde verbreitet und nebst den nachfolgend beschriebenen und den zwei europaeischen Arten gehoeren ohne Zweifel hieher: F. cylindrica Ltr., desecta Sm., mutilata Sm., pilosa Sm., rufifrons Sm., stricta Sm.

License not applicable

Mayr, G.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 4 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Camponotus (Camponotus sp.) preys on:
Phaenicia eximia
Hemilucilia segmentaria
Cochliomyia macellaria
Mammalia

Based on studies in:
Costa Rica (Carrion substrate)

This list may not be complete but is based on published studies.
  • L. F. Jiron and V. M. Cartin, 1981. Insect succession in the decomposition of a mammal in Costa Rica. J. New York Entomol. Soc. 89:158-165, from p. 163.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:6,554Public Records:967
Specimens with Sequences:5,189Public Species:247
Specimens with Barcodes:4,756Public BINs:245
Species:600         
Species With Barcodes:467         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus nr. whitei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nr. whitei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus nr. terebrans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nr. terebrans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus nr. subnitidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nr. subnitidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus nr. setosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nr. setosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus nr. rubiginosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nr. rubiginosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus nr. reticulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nr. reticulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus nr. ephippium

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nr. ephippium

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus nr. discors

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nr. discors

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus nr. claripes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nr. claripes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus nr. aureopilus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nr. aureopilus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus nr. denticulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nr. denticulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG074

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG010

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG088

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG089

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG047

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus MG024

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATTTTTGCAATTTGGTCAGGAATAGTAGGCTCTTCTATAAGAATAATTATTCGATTAGAGCTTGGGTCTCCTAACTCATTAATTCATAATGATCAAATTTACAATTCCATAGTTACAAGACATGCTTTTATTATAATTTTTTTTATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTTTCTTGTTCCTTTAATACTCGGATCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTCTTCCCCCTTCAATTTTACTATTAATCCTAAGAAATTTTATTAATGAAGGATCTGGAACAGGTTGAACTGTCTATCCCCCTCTTTCTTCTAATACCTTCCACAGAGGACCATCTGTGGATCTAACTATTTTTTCTCTCCATATCGCTGGTATATCCTCAATTCTTGGAGCAATTAATTTTATCTCAACAATTATGAATATACATAATATTAATATTTCTTTAGATAAAATTCCCTTATTAGTATGATCTATTCTTGTTACAGCAATCCTTCTCCTTCTTTCCCTTCCTGTTCTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCATCAGGAGGTGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG024

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus MG064

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCTATACTTTATCTTTGCAATTTGATCAGGACTAATCGGATCATCAATAAGAATAATTATTCGATTAGAACTCGGCTCTCCTAACTCACTAATTTTAAATGATCAAATCTTTAACTCTATCGTTACAAGCCATGCTTTTATTATAATTTTTTTCATAGTTATGCCCTTTATAATCGGTGGTTTCGGTAATTTTCTAGTACCTCTAATACTTGGCTCTCCTGACATAGCCTACCCTCGCTTAAATAACATAAGATTTTGACTTTTACCGCCCTCAATTTCCCTCCTAATTCTAAGTAATTTTATTAATGAAGGATCGGGGACAGGGTGGACCGTTTACCCCCCGCTAGCCTCTAACTCCTTTCATAGAGGCCCCTCTATTGATATAACCATCTTTTCTCTTCATATCGCTGGCATATCCTCAATCCTGGGGGCAATCAACTTTATCTCTACTATTATAAATATGCATAATTCTAATATCTCCCTAGATAAAATTCCCCTACTAGTATGATCTATCCTTATTACAGCTATTCTTCTCTTACTAGCTCTCCCCGTATTAGCAGGAGCTATTACAATATTACTAACTGATCGAAACTTAAATACATCTTTCTTCGACCCGTCTGGCGGGGGAGATCCAATTTTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG064

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus MG050

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATACTATACTTTATCTTCGCTATTTGATCCGGCTTAATTGGATCATCCATAAGAATAATTATTCGACTAGAACTCGGCTCCCCTAATTCTTTAATTCTAAACGACCAGACCTTCAATTCTATCGTAACAAGCCATGCTTTTATTATAATCTTTTTTATAGTTATACCTTTCATAATTGGAGGTTTTGGTAATTTCTTAGTTCCTTTAATACTTGGATCTCCTGATATAGCTTATCCTCGTTTAAACAATATAAGATTTTGACTCCTACCCCCTTCAATTTCTCTTTTAATTATAAGTAACTTTATCAACGAAGGCTCAGGCACTGGTTGAACCGTTTACCCCCCCTTAGCTTCTAACTCTTTCCATAGAGGCCCATCTATTGATCTAACTATCTTCTCCCTACATATTGCTGGTATATCCTCCATTCTTGGCGCAATTAATTTTATTTCTACTATTATAAATATACATAATTCTAATATTTCCTTAGATAAAATCCCCCTCTTAGTCTGATCTATCCTTATCACAGCCATTCTTCTTCTTCTATCTTTACCCGTATTAGCTGGAGCTATTACAATATTATTAACTGACCGAAATTTAAATACCTCTTTCTTTGACCCTTCAGGGGGCGGTGATCCAATTCTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG050

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus MG049

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGCAATTTGATCAGGCTTAGTTGGATCATCAATAAGAATGATTATTCGATTAGAACTTGGATCCCCTAATTCACTAATCTTAAATGATCAAACCTTTAACTCTATTGTCACTAGTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTTTCATAATTGGTGGTTTTGGCAATTTCTTAGTTCCTTTAATATTAGGATCCCCAGACATAGCCTACCCACGATTAAATAATATAAGATTTTGATTATTACCCCCATCAATCTCCTTACTAATCCTAAGAAACTTTATTAACGAAGGATCTGGTACCGGTTGAACTGTTTACCCCCCTTTAGCATCCAACTCTTTTCATAGAGGTCCCTCTATTGATCTTACTATTTTTTCCCTTCATATTGCAGGTATATCCTCTATTTTAGGTGCAATTAATTTTATCTCTACTATCATAAATATACATAATCCCAATATTTCCTTAGACAAAATCCCTCTTTTAGTATGATCAATCCTTATTACAGCTATTCTTCTTCTATTATCTTTACCTGTTCTAGCAGGAGCCATTACAATATTACTGACTGATCGAAACTTAAATACCTCCTTCTTTGATCCCTCAGGAGGAGGTGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG049

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG039

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG078

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus MG018

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCGGCTCATCCATAAGTATAATTATTCGATTAGAATTAGGCTCCCCTAATTCATTAATTTATAATGATCAAATCTATAATACTATAGTAACAAGTCATGCTTTCATTATAATCTTTTTTATAGTTATACCATTTATAATTGGAGGATTTGGAAATTTTTTAATTCCTCTAATGCTTGGTTCTCCAGATATAGCTTTTCCTCGATTGAATAATATAAGATTTTGATTACTTCCTCCTTCAATTTTTTTACTTATTTTAAGAAATTTTATTAATGAAGGATCAGGAACAGGATGAACTGTTTACCCTCCATTAGCATCCAATACTTTCCATAGAGGACCTTCCGTCGATTTAACNATTTTTTCCCTTCATATTGCCGGAATATCCTCAATTCTTGGAGCAATTAACTTTATTTCAACAATTATTAATATACATAATAATAATATTTGTTTAGATAAAATTCCTCTTCTAGTATGATCAATCCTTATTACAGCAATTCTCCTTCTCCTATCTCTACCTGTTTTAGCTGGAGCAATTACTATATTATTAACAGATCGAAACTTAAACACTTCATTTTTTGATCCATCAGGAGGGGGTGACCCTATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG018

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG001

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG104

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus MG002

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGCAATTTGATCTGGATTAATCGGATCTTCAATAAGAATAATTATCCGACTTGAACTTGGATCACCTAACTCATTAATTTTAAATGACCAAACCTTTAATTCTATTGTAACAAGTCATGCTTTTATTATAATCTTTTTTATAGTTATACCATTTATAATTGGGGGATTTGGTAATTTTCTAGTTCCACTTATAATTGGATCTCCTGATATAGCCTATCCTCGAATAAATAATATAAGATTTTGACTTTTACCACCCTCAATTTCTTTATTAATTATAAGAAACTTTATTAATGAAGGATCCGGCACTGGTTGGACTATTTACCCTCCTCTTGCATCCAATTCTTTTCACAGAGGCCCTTCTATCGACTTAACAATCTTTTCTCTTCATATTGCAGGTATATCTTCAATTTTAGGAGCAATTAATTTTATCTCAACTATTTTAAATATACATAATCCTAATATTACCCTAGATAAAATTCCCCTTCTAGTTTGATCAATCCTTATCACAGCAATTTTACTACTATTATCTCTTCCAGTATTAGCAGGAGCAATCACTATATTACTAACGGATCGAAATTTAAATACTTCATTTTTTGATCTATCTGGTGGCGGAGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG002

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG005

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 68
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus MG053

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATACTATACTTTATCTTTGCAATCTGATCTGGACTAATCGGTTCATCAATAAGAATGATCATTCGATTAGAACTAGGCTCCCCCAACTCCCTAATTTTAAATGATCAAACTTTTAATTCTATTGTTACAAGCCATGCCTTTATCATAATTTTCTTCATAGTTATACCATTTATAATTGGTGGGTTTGGTAATTTCCTAATTCCTCTAATACTTGGATCTCCTGATATAGCCTACCCACGCTTAAATAACATAAGTTTCTGACTTTTACCCCCTTCAATTTTCCTCTTAATCCTAAGCAACTTTATCAATGAAGGTTCAGGTACAGGTTGAACTATCTACCCCCCTCTAGCCTCAAATGTTTTCCATAGAGGCCCCTCTATTGACCTTACAATCTTTTCTCTTCATATTGCTGGAATATCCTCTATTCTTGGGGCAATTAACTTTATCTCAACTATTATTAACATACATAACCCTAATATTTCTTTAGATAAAATTCCCCTCCTAATCTGATCTATCCTAATCACAGCAATCCTTCTTTTATTATCCCTCCCTGTATTAGCCGGAGCTATTACAATACTACTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTTCTGGAGGAGGAGATCCAATTCTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG053

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 72
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG03_maculatus_nr

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG011

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG072

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG075

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG003

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG068

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG115

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG098

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG021

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG019

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG067

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG091

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG022

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG020

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG110

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG109

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG077

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG090

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus compressus GR17

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus compressus GR17

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-SA-3SSB

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-SA-3SSA

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-SA-1SS2D

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-SA-1SSC

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-SA-1SSB

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-SA-1SSA

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-NCA-01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-MPU-01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-KZN-01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus cf. novaehollandiae RL-2006

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTCTTCCTGGATTTGGATTAATCTCTCATATTATTATAAATGAAAGTGGAAAAAAA---GAAACTTTTGGAGCCTTAGGAATAATYTATGCTATTTTAACTATTGGATTCTTAGGATTTATTGTATGAGCTCATCATATATTTACTATTGGTTTAGATATTGATACACGAGCTTACTTTACCTCAGCAACTATAATTATTGCAATCCCAACTGGAATTAAAATTTTTAGATGAATTACT---ACTTTACATGGATCA---AAAATTAGTTACAATTCATCTCTATGATGATCCATAGGTTTTATTTTTTTATTTACTATTGGAGGATTAACAGGAGTAATTCTCTCAAATTCTTCTATTGATATTGTTTTACATGATACTTATTATGTAGTAGCTCATTTTCATTATGTT---TTATCTATAGGAGCAGTATTTGCTATTATTGCAAGATTTATTCATTGATTTCCTCTTATTACTGGATATTCTCTTAATAATTTTTTACTTAATATTCAATTTATTAGAATATTTATTGGTGTTAATCTAACCTTTTTTCCCCAACACTTTTTAGGACTAAGAGGTATACCTCGT---CGATATTCTGATTATCCTGATAATTTTCTC---TCATGAAATATCATCTCATCTATAGGATCTATAATTTCTATTATTAGTTTAATTTTATTAATATTTTTAATCTGAGAAGCTTTATCCTCCAAACGAATAATT---ATTAATATATTTTATTTAAATTCCTCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus cf. novaehollandiae RL-2006

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus vicinus_dark_form

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG119

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG118

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG017

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG062

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG081

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG079

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG048

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG092

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG070

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG111

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG121

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG059

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG013

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG026

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG041

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG100

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG004

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG045

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG066

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG065

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG101

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG012

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG085

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG046

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG097

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG054

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG034

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG023

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG116

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG014

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG040

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG033

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG009

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG030

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG025

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG027

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG031

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG061

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG035

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus RE01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus DRw16

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ANTCNP_sp3

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ANTCNP_sp1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus BCI_LT_11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MY10

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus europa_sp1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus JTL062

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus hova_cf01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus christi_01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus christi_02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus maculatus_cf01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Camponotus maculatus_cf02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTCTATAAGAATAATTATCCGGTTAGAACTAGGATCTCCTAATTCTTTAATCTTAAATGATCAAACTTTTAACTCTATCGTTACAAGTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTTTCATAATTGGCGGTTTTGGTAATTTTTTAGTACCCCTAATACTCGGATCTCCCGACATAGCTTACCCTCGCTTAAATAATATAAGATTTTGATTACTACCTCCGTCAATCTCTTTATTAATCCTAAGTAATTTTATTAATGAAGGTTCAGGTACTGGGTGAACTGTTTACCCTCCATTAGCATCTAATTCTTTCCATAGAGGACCATCAGTTGACTTAACTATTTTCTCTCTCCATATTGCTGGAATATCTTCAATCCTTGGTGCAATTAACTTTATTTCCACTATTATAAATATACACAATCCTAATATTTCTTTAGATAAAATTCCCCTATTAGTATGATCAATCCTTATTACTGCTATTCTTTTATTACTTTCATTACCTGTTCTAGCAGGAGCTATTACAATATTACTAACAGATCGAAATTTAAATACCTCTTTTTTTGACCCATCAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus maculatus_cf02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-NAM-03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-NAM-04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-NAM-02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-NCA-02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-LIM-01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-LIM-02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus cf. atriceps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG029

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG073

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ambatovaky01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ambatovaky02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG120

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG038

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG100b

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG100a

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-WCA-01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus AFRC-SA-3SSC

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG112

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus CA05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus CA01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA131

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG095

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA26

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA23

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA22

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA21A

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS030

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS008

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS002

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS009

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS021

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS028

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS020

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 61
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS019

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS018

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS017

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS027

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS012

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS010

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS011

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS026

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS016

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS015

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS023

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS025

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS005

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS003

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS024

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MAS001

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus JTL021

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus JTL050

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus sansabeanus_nr

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus nearcticus_cf

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus hyatti_cf

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA09A

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA027

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA13

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA13A

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA24

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus ARA14

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG096

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus DR01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG099

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG102

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG008

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG051

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG071

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG058

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG016

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG028

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus MG015

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Camponotus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Carpenter ant

Carpenter ants (Camponotus spp.) are large (0.3 to 1.0 in or 0.76 to 2.54 cm) ants indigenous to many forested parts of the world.[1] They prefer dead, damp wood in which to build nests. They do not consume it, however, unlike termites.[2] Sometimes, carpenter ants hollow out sections of trees. They also commonly infest wooden buildings and structures, and are a widespread nuisance and major cause of structural damage.[3] The most likely species to be infesting a house in the United States is the black carpenter ant (Camponotus pennsylvanicus). However, over a thousand other species are in the genus Camponotus.

Carpenter ant cleaning antennae

Symbionts[edit]

All ants in this genus, and some related genera, possess an obligate bacterial endosymbiont called Blochmannia.[4] This bacterium has a small genome, and retains genes to biosynthesize essential amino acids and other nutrients. This suggests the bacterium plays a role in ant nutrition. Many Camponotus species are also infected with Wolbachia, another endosymbiont that is widespread across insect groups.

Habitat[edit]

Carpenter ant species reside both outdoors and indoors in moist, decaying, or hollow wood. They cut "galleries" into the wood grain to provide passageways for movement from section to section of the nest. Certain parts of a house, such as around and under windows, roof eaves, decks and porches, are more likely to be infested by carpenter ants because these areas are most vulnerable to moisture.

Carpenter ants have been known to construct extensive underground tunneling systems. These systems often lead to and end at some food source – often aphid colonies, where the ants extract and feed on honeydew. These tunneling systems also often exist in trees. The colonies typically include a central "parent" colony surrounded and supplemented by smaller satellite colonies.[5]

Food[edit]

Carpenter ants are foragers that typically eat parts of other dead insects or substances derived from other insects. Common foods for them include insect parts, "honey dew" produced by aphids, or some secretions from plants. Carpenter ants can increase the survivability of aphids when they attend to them. They attend to any aphid species, but can also express preference for specific ones.

Most species of carpenter ants forage at night. When foraging, they usually collect and consume dead insects. Some species less commonly collect live insects. When they discover a dead insect, workers surround it and extract its bodily fluids to be carried back to the nest. The remaining chitin-based shell is left behind. Occasionally, the ants bring the chitinous head of the insect back to the nest, where they also extract its inner tissue.[6] The ants can forage individually or in small or large groups, though they often opt to do so individually. Different colonies in close proximity may have overlapping foraging regions, though they typically do not assist each other in foraging. Their main food sources normally include proteins and carbohydrates.[7]

When workers find food sources, they communicate this information to the rest of the nest. They use biochemical pheromones to mark the shortest path that can be taken from the nest to the source. When a sizable number of workers follows this trail, the strength of the cue increases and a foraging trail is established. This ends when the food source is depleted. Foraging trails can either be under or above ground.[8]

Although carpenter ants do not tend to be extremely aggressive, they have developed mechanisms to maximize their provision from a food source when that same food source is visited by a competing organism. This is accomplished in different ways. Sometimes they colonize an area near a relatively static food supply. More often, they develop a systemic way to visit the food source with alternating trips by different individual ants or groups. This allows them to decrease the gains of intruders because the intruders tend to visit in a scattered, random, and unorganized manner. The ants, however, visit the sources systematically such that they lower the mean standing crop. They tend to visit more resource-dense food areas in an attempt to minimize resource availability for others. That is, the more systematic the foraging behavior of the ants, the more random that of its competitors.

Contrary to popular belief, carpenter ants do not actually eat wood because they are unable to digest cellulose. They only create tunnels and nests within it.[9]

Behavior and ecology[edit]

Nesting[edit]

Carpenter ants work to build the nests that house eggs in environments with roughly 12-15% humidity due to their sensitivity to environmental humidity. These nests are called primary nests. Satellite nests are constructed once the primary nest is established and has begun to mature. Residents of satellite nests include older larvae, pupae, and some winged individuals. Only eggs, the newly hatched larvae, workers, and the queen reside in the primary nests. Since satellite nests do not have environmentally sensitive eggs, the ants can construct them in rather diverse locations that can actually be relatively dry.[10]

Nuptial flight[edit]

When conditions are warm and humid, winged males and females participate in a nuptial flight. They emerge from their satellite nests and females mate with a number of males while in flight. The males die after mating. These newly fertilized queens discard their wings and search for new areas to establish primary nests. The queens build new nests and deposit around 20 eggs, nurturing them as they grow until worker ants emerge. The worker ants eventually assist her in caring for the brood as she lays more eggs. Again, satellite nests will be established and the process will repeat itself.[10]

Relatedness[edit]

Relatedness is the probability that a gene in one individual is an identical copy, by descent, of a gene in another individual. It is essentially a measure of how closely related two individuals are with respect to a gene. It is quantified by the coefficient of relatedness, which is a number between zero and one. The larger the value, the more "related" two individuals are. Carpenter ants are social hymenopteran insects. This means the relatedness between offspring and parents is disproportionate.  Females are more closely related to their sisters than they are to their offspring.  Between full sisters, the coefficient of relatedness is r > 0.75 (due to their haplodiploid genetic system).[11] Between parent and offspring, the coefficient of relatedness is r = 0.5, because, given the event in meiosis, a certain gene has a 50% chance of being passed on to the offspring. The level of relatedness is an important dictator of individual interactions.[citation needed]

Kin recognition[edit]

According to Hamilton's rule for relatedness, for relative-specific interactions to occur, such as kin altruism, a high level of relatedness is necessary between two individuals. In many social insect species, the mechanisms with which individuals determine whether others are nestmates or not are in place for carpenter ants. They are useful because they explain the presence or absence of altruistic behavior between individuals.  They also act as evolutionary strategies to help prevent incest and promote kin selection.[12]  Social carpenter ants recognize their kin in many ways. These methods of recognition are largely chemical in nature, and involve use of cuticles.  These include environmental odors, pheromones, "transferable labels", and labels from the queen that are distributed to and among nest members.[13] Because they have a chemical basis for emission and recognition, odors are useful because many ants can detect such changes in their environment through their antennae.[14] This allows acceptance of nestmates and rejection of non-nestmates.

The actual process of recognition for carpenter ants requires two events. First, a cue must be present on a "donor animal".  These cues are called "labels".  Next, the receiving animal must be able to recognize and process the cue.  In order for an individual carpenter ant to be recognized as a nestmate, it must as an adult go through specific interactions with older members of the nest.[13] This process is also necessary in order for the ant to recognize and distinguish other individuals.  If these interactions do not occur in the beginning of adult life, the ant will be unable to be distinguished as a nestmate and unable to distinguish nestmates.[15]

Kin altruism[edit]

Recognition allows for the presence of kin-specific interactions, like kin altruism. Altruistic individuals increase other individuals' fitness at the expense of their own fitness. Carpenter ants perform altruistic actions toward their nest-mates so that their shared genes are propagated more readily or more often. In many social insect species like these ants, many worker animals are sterile and do not have the ability to reproduce. As a result, they forego reproduction to donate energy and help the fertile individuals reproduce.

Pheromones[edit]

As in most other social insect species, individual interaction is heavily influenced by the queen. The queen can influence individuals with odors called pheromones, which can have different effects. Some pheromones have been known to calm workers, while others have been known to excite them. Pheromonal cues from ovipositing queens have a stronger effect on worker ants than those of virgin queens.[16]

Social immunity[edit]

In many social insect species, social behavior can increase the disease resistance of animals. This phenomenon, called social immunization, exists in carpenter ants. It is mediated through the feeding of other individuals by regurgitation. The regurgitate can have antimicrobial activity, which would be spread amongst members of the colony. Some proteases with antimicrobial activity have been found to exist in regurgitated material. Communal sharing of immune response capability is likely to play a large role in colonial maintenance during highly pathogenic periods.[17]

Oligogyny[edit]

Polygyny is often associated with many social insect species, and is usually characterized by limited mating flights, small queen size, and other characteristics. However, carpenter ants have "extensive" mating flights and relatively large queens, distinguishing them from polygynous species. Carpenter ants are described as oligogynous because they have a number of fertile queens which are intolerant of each other and must therefore spread to different areas of the nest. Some aggressive interactions have been known to take place between queens, but not necessarily through workers. Queens become aggressive mainly to other queens if they trespass on a marked territory. Queens in a given colony can work together in brood care[5] and the workers tend to experience higher rates of survival in colonies with multiple queens. Some researchers still subscribe to the notion that carpenter ant colonies are only monogynous.[18]

Carpenter ants as pests[edit]

Carpenter ants can damage wood used in the construction of buildings. They can leave behind a sawdust-like material called frass that provides clues to their nesting location. Carpenter ant galleries are smooth and very different from termite-damaged areas, which have mud packed into the hollowed-out areas.[19] Identification of carpenter ants: At the "waist" attachment between the thorax and abdomen (petiole) there is generally visible one upward protruding node, looking like a 'spike'.

Control involves application of insecticides in various forms including dusts and liquids. The dusts are injected directly into galleries and voids where the carpenter ants are living. The liquids are applied in areas where foraging ants are likely to pick the material up and spread the poison to the colony upon returning.

Exploding ants[edit]

In at least nine Southeast Asian species of the Cylindricus complex, including Camponotus saundersi, workers feature greatly enlarged mandibular glands that run the entire length of the ant's body. They can release their contents suicidally by performing autothysis, thereby rupturing the ant's body and spraying toxic substance from the head, which gives these species the common name "exploding ants."[20][21][22] The enlarged mandibular gland, which is many times the size of that of a normal ant, produces a glue. The glue bursts out and entangles and immobilizes all nearby victims.[23][24]

The termite species Globitermes sulphureus has a similar defensive system.[25]

Selected species[edit]

C. pennsylvanicus (winged male)
Wood damage by C. herculeanus
See List of Camponotus species for a complete listing of species and subspecies.

References[edit]

  1. ^ Cranshaw, Whitney; Richard Redak (2013). Bugs Rule!: An Introduction to the World of Insects. Princeton Univ. Press. p. 329. ISBN 140084892X. 
  2. ^ http://www.extension.umn.edu/distribution/housingandclothing/dk1015.html
  3. ^ Strauss, Levi (January 2005). "Carpenter Ant Fact Sheet". Spokane County Extension. Washington State Univ., Spokane, WA. Retrieved February 19, 2014. 
  4. ^ http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2206011
  5. ^ a b Colony Size and Polygyny in Carpenter Ants (Hymenoptera: Formicidae) Roger D. Akre, Laurel D. Hansen and Elizabeth A. Myhre Journal of the Kansas Entomological Society , Vol. 67, No. 1 (Jan., 1994), pp. 1-9
  6. ^ Pricer, John. The Life History of the Carpenter Ant. Biological Bulletin , Vol. 14, No. 3 (Feb., 1908), pp. 177-218
  7. ^ Yamamoto, Marcela, and Kleber Del-Claro. "Natural History and Foraging Behavior of the Carpenter Ant Camponotus Sericeiventris Guérin, 1838 (Formicinae, Campotonini) in the Brazilian Tropical Savanna." Acta Ethologica 11.2 (2008): 55-65. Print.
  8. ^ Dreisig, H. "Defense by Exploitation in the Florida Carpenter Ant, Camponotus Floridanus , at an Extrafloral Nectar Resource." Behavioral Ecology and Sociobiology 47.4 (2000): 274-79. Print.
  9. ^ Hahn, Jeff. "Carpenter Ants." : Insects : University of Minnesota Extension. N.p., n.d. Web. 01 Oct. 2013.
  10. ^ a b Pararas — Carayannis, Carolyn. "Carpenter Ants." Colony Behaviors of Carpenter Ants. N.p., n.d. Web. 1 October 2013.
  11. ^ http://www.jstor.org/discover/10.1086/671994?uid=1741656&uid=3738032&uid=2&uid=3&uid=5910784&uid=67&uid=62&uid=1741608&sid=21103300501803
  12. ^ http://link.springer.com/chapter/10.1007/978-1-4613-1053-2_11#page-2
  13. ^ a b http://www.sciencedirect.com/science/article/pii/S0003347289800685
  14. ^ http://www.sciencemag.org/content/222/4627/1027.short
  15. ^ http://link.springer.com/article/10.1007/BF00300567#page-1
  16. ^ H. G. Fowler and R. B. Roberts Journal of the Kansas Entomological Society , Vol. 55, No. 3 (Jul., 1982), pp. 568-570
  17. ^ Hamilton, Casey. "Trophallaxis and Prophylaxis: Social Immunity in the Carpenter Ant Camponotus Pennsylvanicus." Biology Letters 7.1 (2011): 89-92. Print.
  18. ^ Gadau, Jürgen, Pia J. Gertsch, Jürgen Heinze, Pekka Pamilo, and Bert Hölldobler. "Oligogyny by Unrelated Queens in the Carpenter Ant, Camponotus Ligniperdus." Behavioral Ecology and Sociobiology 44.1 (1998): 23-33. Print.
  19. ^ Catseye Pest Control http://www.catseyepest.com
  20. ^ Jones, T.H.; Clark, D.A.; Edwards, A.A.; Davidson, D.W.; Spande, T.F. and Snelling, Roy R. (2004): "The Chemistry of Exploding Ants, Camponotus spp. (Cylindricus complex)". Journal of Chemical Ecology 30(8): 1479–1492. doi:10.1023/B:JOEC.0000042063.01424.28
  21. ^ Emery, Carlo (1889). Viaggio di Leonardo Fea in Birmania e regioni vicine. XX. Formiche di Birmania e del Tenasserim raccolte da Leonardo Fea (1885–87).  Annali del Museo Civico di Storia Naturale Giacomo Doria (Genova) 2 7(27): 485–520. [PDF]
  22. ^ "Utahn enters world of exploding ants". Deseret News. September 11, 2002.  University of Utah graduate student Steve Cook explained "They've been called kamikaze ants by other researchers because they tend to explode or self-destruct when they're attacked or harassed in any way."
  23. ^ Vittachi, Nury (June 6, 2008). "The Malaysian ant teaches us all how to go out with a bang". Daily Star (Dhaka). 
  24. ^ Ridley, Mark (1995). Animal Behaviour (Second ed.). Blackwell Publishing. p. 3. ISBN 0-86542-390-3. Retrieved 2009-09-26. 
  25. ^ Robert S. Anderson, Richard Beatty, Stuart Church (January 2003). Insects and Spiders of the World 9. p. 543. ISBN 978-0-7614-7334-3. 

Further reading[edit]

  • Mayr, Gustav (1861): Die europäischen Formiciden. Vienna. PDF—original description of p. 35
  • McArthur, Archie J (2007): A Key to Camponotus Mayr of Australia. In: Snelling, R.R., B.L. Fisher and P.S. Ward (eds). Advances in ant systematics (Hymenoptera: Formicidae): homage to E.O. Wilson – 50 years of contributions. Memoirs of the American Entomological Institute 80. PDF—91 species, 10 subspecies
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!