Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 34 specimens in 1 taxon.
Water temperature and chemistry ranges based on 25 samples.

Environmental ranges
  Depth range (m): 175 - 80000
  Temperature range (°C): -0.893 - 7.316
  Nitrate (umol/L): 15.354 - 36.329
  Salinity (PPS): 34.325 - 34.958
  Oxygen (ml/l): 2.199 - 6.848
  Phosphate (umol/l): 1.061 - 2.511
  Silicate (umol/l): 13.176 - 129.798

Graphical representation

Depth range (m): 175 - 80000

Temperature range (°C): -0.893 - 7.316

Nitrate (umol/L): 15.354 - 36.329

Salinity (PPS): 34.325 - 34.958

Oxygen (ml/l): 2.199 - 6.848

Phosphate (umol/l): 1.061 - 2.511

Silicate (umol/l): 13.176 - 129.798
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Depth range

Continental slope to lower abyssal (200 m to 7000 m).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eurythenes gryllus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTTCATCTTAGGTGCCTGAGCTAGGGTCGTCGGCACGTCTCTCAGTGTAATTATTCGATCTGAACTCAGTAGACCGGGAAACCTAATTGGAGAT---GATCAGGTCTATAACGTAATAGTAACTGCCCACGCCTTTGTTATAATCTTCTTTATAGTTATACCTATTATAATTGGTGGATTTGGGAATTGACTAGTTCCCCTTATACTCGGAAGCCCCGACATAGCTTTCCCGCGCATAAACAACATAAGATTCTGACTACTACCCCCCTCACTAACCTTATTACTAATAAGAGGTCTAGTAGAAAGAGGAGTAGGAACTGGTTGAACCGTCTACCCGCCCTTAGCCGCAGCCGCAGCCCACAGTGGAGGGTCTGTTGACCTGGCGATCTTCTCTCTCCATCTAGCAGGTGCTTCTTCCATTTTAGGCGCCATCAATTTTATCTCCACTGTAATTAACATACGAACCCCTGGTATATATATAGACCGAGTGCCCTTATTTGTCTGATCCGTCTTCATCACAGCCATTCTACTCCTCTTATCTCTACCCGTACTAGCCGGTGCAATCACTATACTCCTAACAGACCGAAATCTAAACACTTCCTTCTTTGACCCTAGGGGTGGAGGTGACCCTATCCTTTACCAACACCTATTCTGATTCTTTGGCCACCCTGAAGTATACATCTTGATCTTGCCTGCTTTTGGAATAGTATCCCACATCGTCAGACAAGAATCAGGTAAAAAAGAGACTTTTGGTGCCCTAGGAATAATCTATGCTATACTAGCAATTGGAGTCCTAGGTTTTATTGTCTGGGCCCACCACATATTCACCGTTGGCATAGATGTTGACACTCGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eurythenes gryllus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!