Overview

Brief Summary

The cestode Taenia solium (pork tapeworm) (along with T. saginata [beef tapeworm] and T. asiatica [Asian tapeworm]) causes intestinal taeniasis in infected humans, which serve as the definitive host (i.e. the host that harbors adult parasites). Taenia solium can also cause cysticercosis, which results when a human serves as an intermediate (and dead-end) host. Taenia solium (like T. saginata) has a worldwide distribution (T. asiatica is limited to Asia). Taenia solium is more prevalent in poorer communities where humans live in close contact with pigs and eat undercooked pork. Taeniasis and cysticercosis are very rare in Muslim countries. It is important to note that human cysticercosis is acquired by ingesting T. solium eggs shed in the feces of a human T. solium tapeworm carrier and thus can occur in populations that neither eat pork nor share environments with pigs. (Centers for Disease Control Parasites and Health website)

Humans are the only definitive host for Taenia solium (as well as for T. saginata, and T. asiatica). An infection usually involves just a single tapeworm (Nakao et al. 2010). Eggs or gravid proglottids (bisexual reproductive segments) are passed with feces; the eggs can survive for days to months in the environment. Pigs typically become infected by ingesting vegetation contaminated with eggs or gravid proglottids. In the animal's intestine, the oncospheres hatch, invade the intestinal wall, and migrate to the striated muscles, where they develop into cysticerci. A cysticercus can survive for several years in the animal. Humans become infected and develop intestinal taeniasis by ingesting raw or undercooked infected pork. In the human intestine, the cysticercus develops over several months into an adult tapeworm, which can survive for years. The adult tapeworm attaches to the small intestine by its scolex and resides in the small intestine. The length of an adult T. solium is typically 2 to 7 m. The adults produce proglottids which mature, become gravid, detach from the tapeworm, and migrate to the anus or are passed in the stool (several per day). Taenia solium adults have an average of 1,000 proglottids and each proglottid produces around 50,000 eggs. The eggs contained in the gravid proglottids are released after the proglottids are passed with the feces. (Centers for Disease Control Parasites and Health website) Disease can take another form if a human ingests eggs present in food or water contaminated by the feces of human tapeworm carriers. In this case, the human can become an intermediate (and dead-end) host and harbor the cystic stage in its tissues, causing cysticercosis and, if there is neurological involvement, neurocysticercosis. (Michelet et al. 2010 and references therein)

Up to 20 million people are infected with Taenia solium cysticerci worldwide. Furthermore, neurocysticercosis is a major cause of adult onset seizures in many low-income countries and accounts for 50,000 deaths each year. Domestic pigs (Sus scrofa), African wild pigs (Potamochoerus), and other animals including primates, dogs, rabbits, and hyraxes (family Procaviidae) serve as the main intermediate hosts. (Michelet et al. 2010 and references therein)

Conlan et al. (2009) explored the role of interspecific competition among Taenia species in modulating T. solium infection of humans. In Southeast Asia, T. solium faces competition in both the human definitive host and the typical pig intermediate host. In humans, adult T. solium, T. saginata and T. asiatica compete through density-dependent crowding mechanisms. In pigs, metacestodes of T. solium, T. hydatigena and T. asiatica compete through density-dependent immune-mediated interactions. Humans are the definitive host for T. solium, T. saginata and T. asiatica. Pigs are the known intermediate host for T. solium, T. asiatica, and T. hydatigena. Canines are the definitive host for T. hydatigena and bovines are the intermediate host for T. saginata. Conlan et al. (2009) compared the biological characteristics of T. solium, T. saginata, T. asiatica, and T. hydatigena. (Conlan et al. 2009 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Taenia solium

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGAATGTCAAATATTTGTTAAGTTGGATATTTACTTTAGATCATAAGCGAGTTGGTATAATTTATACTTTGTTGGGTTTGTGGTCAGGTTTTGTAGGTTTAAGTTTTAGTTTATTAATTCGTGTTAATTTTTTAGAACCTTATTATAATGTGATTTCTTTGGATTGTTATAAATTTTTGATTACTAACCATGGTATAATAATGATTTTCTTTTTTTTAATGCCTATTTTAATTGGAGGTTTTGGTAAATACTTAATTCCATTGATAAGAGGATTATCGGATTTGAATTTACCACGTTTGAATGCTTTAAGTGCATGGTTGTTAGTTCCATCAATTGTTTTTCTTTTAATTAGGATGTGTTTAGGCGCTGGTATAGGGTGGACTTTTTACCCACCTTTATCATCTTCGTTGTTTTCAAGAGGAAGTGGGGTAGATTTTTTAATGTTTTCTTTGCATTTAGCTGGTGTATCAAGTATTTTTAGTTCTATTAATTTTATATGTACATTATATAGAGTTTTTATGACTAATATATTTTCTCGTACATCTATAGTGTTATGATCTTATTTATTTACATCTATCTTGTTATTGGTTACTTTACCTGTTTTGGCAGCCGCTGTTACTATGCTTCTATTTGATCGTAAATTTAGTTCTGCGTTTTTTGATCCGTTAGGAGGTGGTGATCCTGTTTTGTTTCAACATATGTTTTGATTTTTTGGTCATCCCGAGGTTTATGTGTTAATTCTTCCGGGGTTTGGTATAATTAGTCATATATGTTTGAGTATAAGTATGTGTTCTGATGCTTTTGGCTTTTATGGGTTATTGTTTGCTATGTTTTCAATAGTATGTTTAGGAAGAAGTGTGTGAGGACATCATATGTTTACGGTTGGGTTAGATGTTAAGACGGCTGTATTTTTTAGTTCTGTTACTATGATAATTGGAGTGCCTACGGGGATTAAGGTTTTTACTTGGCTTTATATGCTTTTAAAATCTCGTGTTAATAAGAGTGATCCGGTTTTATGATGAATAATTTCGTTTATAGTATTGTTTACATTTGGTGGTGTAACCGGTATTATTCTATCTGCTTGTGTATTAGATAAAGTTCTTCATGATACTTGGTTTGTTGTTGCTCATTTTCATTATGTTATGTCATTAGGGTCTTATATCAGTATAATAATTATGTTTGTTTGGTGGTGACCTTTGATTACTGGTTTGAGTTTAAATAAGTGTTTACTTCAATGTCAATGTATTATATCTAAAATTGGGTTTAATTTATGTTTTTTCCCAATGCATTATTTTGGGTTGTGTGGGTTACCACGTCGTGTTTGTGTTTATGAATGTGCTTATAATTGAATTAAAATGGTGTCTACTGTGGGTTCTTTTATATCTGCTTTTAGTGGGTGTTTTTTTGTTTTTATACTTTGAGAGTCAGTTGTTAATTGTAAAGAGGTTTTAGGTTCTTATGGTTCATCTAGCTGTTTGGTGAATTTTTTTATGAGTCCTGTGGCTTCTCATAATGATTATTTTTGTTATCCTTATAATATAGATTATACTTACGGGGTATATTATATGCGTTGAGTGGATGATTGTACTTATGTATTCGCGTGTGGAATGGTCTTTTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Taenia solium

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 33
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Taenia solium

This article is about the tapeworm. For the infection, see cysticercosis.

Taenia solium is the pork tapeworm belonging to cyclophyllid cestodes in the family Taeniidae. It is an intestinal zoonotic parasite found throughout the world, and is most prevalent in countries where pork is eaten. The adult worm is found in humans and has a flat ribbon-like body, which is white in color and measures 2 to 3 metres in length. Its distinct head called scolex contains suckers and rostellum as organs of attachment. The main body called strobila consists of a chain of segments known as proglottids. Each proglottid is a complete reproductive unit, hence, the tapeworm is hermaphrodite. It completes its life cycle in human, as definitive host, and pigs, as intermediate host. It is transmitted to pigs through human faeces or contaminated fodder, and to humans through uncooked or undercooked pork. Pigs ingest embryonated eggs called morula which develop into larvae called oncospheres, and ultimately into infective larvae called cysticerci. A cyticercus grows into adult worm in human small intestine. Infection is generally harmless and asymptomatic. However, accidental infection in humans by the larval stage causes cysticercosis. The most severe form is neurocysticercosis, which affects the brain and is a major cause of epilepsy.

Human infection is diagnosed by the parasite eggs in the faeces. For complicated cysticercosis imaging techniques such as computed tomography and NMR are employed. Blood samples can also be tested using antibody reaction of ELISA. Broad spectrum anthelmintics such as praziquantel and albendazole are the most effective medications.

Description[edit]

Taenia solium adult

Adult T. solium is a triploblastic acoelomate, having no body cavity. It is normally 2 to 3 m in length, but can become very large, over 8 m long in some situations. It is white in colour and flattened into ribbon-like body. The anterior end is a knob-like head called scolex, which is 1 mm in diameter. The scolex bears four radially arranged suckers (acetabula) that surround the rostellum. These are the organs of attachment to the intestinal wall of the host. The rostellum is armed with two rows of spiny hooks, which are chitinous in nature. There can be 22 to 32 rotelllar hooks, which can be differentiated into short (130 µm) and long (180 µm) types. The elongated body is called strobila, which is connected to the scolex through a short neck. The entire body is covered by a special covering called tegument, which is an absorptive layer consisting of mat of minute hair-like microtriches. The strobila is divided into segments called proglottids. There can be 800-900 proglottids. Body growth starts from neck region so that the oldest proglottids are at the posterior end. Thus there are three distinct proglottids, namely immature proglottids towards the neck, mature proglottids in the middle, and gravid proglottids at the posterior end. A monoecious species, each mature proglottid contains a set of male and female reproductive systems. There are numerous testes and a bilobed ovary, and they open into a common genital pore. The oldest gravid proglottids are full of fertilised eggs,[1][2][3][4]

The infective larave, cysticerci, in human have three morphologically distinct types.[5] The common one is the ordinary "cellulose" cysticercus, which has a fluid-filled bladder 0.5 cm to 1.5 cm in length and an invaginated scolex. The intermediate form has a scolex, while the "racemose" has no evident scolex but is believed to be larger and much more dangerous. They are 20 cm in length and have 60 ml of fluid, and 13% of patients can have all three types in the brain.

Life cycle[edit]

T. solium is a digenetic helminth and its life cycle is indirect. It passes through pigs, as intermediate hosts, into humans, as definive hosts. From humans the eggs are released in the environment where they await ingestion by another host. Humans as the definitive hosts are directly infected from contaminated meat.

Life cycle of T. solium

Definitive host[edit]

Humans are infected by the larval stage called cysticercus (cysticercus cellulosae) from a measly pork. A cysticercus is oval-shaped containing inverted scolex (specifically "protoscolex"), which pops out externally once inside the small intestine. This process of evagination is stimulated by bile juice and digestive enzymes of the host. Using the scolex it anchors to the intestinal wall. It grows in size using nutrients from the surrounding. Its strobila lengthens as new proglottids are formed at the neck. In 10–12 weeks after initial infection, it becomes adult worm. As hermaphrodite it reproduces by self-fertilisation, or cross-fertilisation if gametes are exchanged between two different proglottids. Spermatozoan fuses with the ovum in the fertilisation duct, where zygote is produced. The zygote undergoes holoblastic and unequal cleavage resulting in three cell types, small micromeres, medium mesomeres, and large megameres. Megameres develop into syncytial layer called outer embryonic membrane. Mesomeres develop into radially striated inner embryonic membrane or embryophore. Micromeres become the morula. The morula transforms into a six-hooked embryo known as oncosphere, or sometimes hexacanth ("six hooked") larva. A single gravid proglottid can contain more than 50,000 embryonated eggs. Gravid proglottids often rupture in the intestine liberating the eggs in faeces. The intact gravid proglottids are shed off in groups of 4 or 5. The free eggs and detached proglottids are released into the environment through peristalsis. Eggs can survive in the environment for up to two months.[2][6]

Intermediate host[edit]

Pigs ingest the eggs from human faeces or vegetation contaminated with human excreta. The embryonated eggs enter the intestine where they hatch into motile oncospheres. The embryonic and basement membranes are removed by the host's digestive enzymes (particularly pepsin). Then the free oncospheres get attached on the intestinal wall using their hooks. With the help of digestive enzymes from the penetration glands, they penetrate the intestinal mucosa to enter blood and lymphatic vessels. They move along the general circulatory system to various organs, and large number are cleared in the liver. The surviving oncospheres preferentially migrate to striated muscles, as well as the brain, liver, and other tissues, where they settle to form cysts called cysticerci. A single cysticercus is spherical measuring 1–2 cm in diameter and contains invaginated protoscolex. The central space is filled with fluid like a bladder, and hence it is also called bladder worm. Cysticerci are usually formed within 70 days and may continue to grow for a year.[7]

Humans are also accidental primary hosts when they are infected by embryonated eggs, either by autoinfection or ingestion of contaminated food. As in pigs, the oncospheres hatch, enter blood circulation, and have predilection for brain tissue and other soft muscle tissues. When they settle to form cysts, clinical symptoms of cysticercosis appears. The cysticercus is often called metacestode. If they localize in the brain, serious neurocysticercosis follows.[8][9]

Pathogenesis[edit]

Intestinal infection of T. solium is called taeniasis and is quite asymptomatic. Only in severe condition intestinal irritation, anaemia, and indigestion occurs. It can also lead to loss of appetite and emaciation.

Tissue infection called cysticercosis and is clinically pathogenic. Ingestion of T. solium eggs or proglottid rupture within the host intestine can cause larvae to migrate into host tissue to cause cysticercosis. This is the most frequent and severe disease caused by T. solium. In symptomatic cases, a wide spectrum of symptoms may be expressed, including headaches, dizziness and occasional seizures. In more severe cases, dementia or hypertension can occur due to perturbation of the normal circulation of cerebrospinal fluid. (Any increase in intracranial pressure will result in a corresponding increase in arterial blood pressure, as the body seeks to maintain circulation to the brain.) The severity of cysticercosis depends on location, size and number of parasite larvae in tissues, as well as the host immune response. Other symptoms include sensory deficits, involuntary movements, and brain system dysfunction. In children, ocular location of cysts is more common than cystation in other locations of the body.[8]

In many cases cysticercosis occurs in the brain and is called neurocysticercosis, which in turn can lead to epilepsy, seizures, lesions in the brain, blindness, tumor-like growths, and low eosinophil levels. It is the cause of major neurological problems, such as hydrocephalus, paraplegy, meningitis, convulsions and even death.[10]

Diagnosis[edit]

Stained T. solium proglottid

T. solium infection is diagnosed by morphological, immunological and molecular assays. The most direct method is microscopic examination of stool for eggs. This was the only method before the 1990s and is still useful in endemic areas. But the technique is not specific as species of Taenia happen to have similar eggs. Proglottids are histologically analysed mostly by staining with India ink. The number of visible uterine branches can help identify the species; for example T. solium uteri have fewer number (only five to 10) of uterine branches on each side. Identification is simplified when scolices are recovered from stool, since scolex structure is different in different species. Suspected cases are diagnosed from blood sample by using polyclonal antibodies that are detected by ELISA. Radioactivey labelled probes are also tested with high success, but are expensive and time consuming for mass diagnosis.[7]

In case of human cysticercosis diagnosis is a sensitive problem and requires biopsy of the infected tissue or sophisticated instruments.[11] T. solium eggs and proglottids found in feces, ELISA or PCR diagnose only taeniasis and not cysticercosis. Radiological tests, such as X-ray, CT scans which demonstrate "ring-enhancing brain lesions", and MRIs, can also be used to detect diseases. X-rays are used to identify calcified larvae in the subcutaneous and muscle tissues, and CT scans and MRIs are used to find lesions in the brain.[3][12]

Prevention and control[edit]

The best way to avoid getting tapeworms is to not eat undercooked pork. Moreover, a high level of sanitation and prevention of faecal contamination of pig foods also plays a major role in prevention. Infection can be prevented with proper disposal of human faeces around pigs, cooking meat thoroughly and/or freezing the meat at −10°C for 5 days. For human cysticercosis, dirty hands are attributed to be the primary cause, and especially common among food handlers.[7] Therefore, personal hygiene such as washing one's hands before eating is an effective measure.

Epidemiology[edit]

T. solium is found worldwide, but is more common in cosmopolitan areas. Because pigs are intermediate hosts of the parasite, completion of the life cycle occurs in regions where humans live in close contact with pigs and eat undercooked pork. Therefore high prevalences are reported in Mexico, Latin America, West Africa, Russia, India, Pakistan, Manchuria and Southeast Asia.[13] In Europe it is most widespread among Slavic people.[3][14] Cysticercosis is often seen in areas where poor hygiene allows for contamination of food, soil or water supplies. Prevalence rates in the United States have shown immigrants from Mexico, Central and South America and Southeast Asia account for most of the domestic cases of cysticercosis.[15] Taeniasis and cysticercosis are very rare in predominantly Muslim countries, as Islam forbids the consumption of pork. Human cysticercosis is acquired by ingesting T. solium eggs shed in the feces of a human tapeworm carrier via gravid proglottids, so can occur in populations that neither eat pork nor share environments with pigs, although the completion of the life cycle can occur only where humans live in close contact with pigs and eat pork.

In 1990 and 1991, four unrelated members of an Orthodox Jewish community in New York City developed recurrent seizures and brain lesions, which were found to have been caused by T. solium. All of the families had housekeepers from Latin American countries and were suspected to be source of the infections.[16][17]

See also[edit]

References[edit]

  1. ^ Pawlowski, Z.S.; Prabhakar, Sudesh (2002). "Taenia solium: basic biology and transmission". In Gagandeep Singh, Sudesh Prabhakar. Taenia solium Cysticercosis from Basic to Clinical Science. Wallingford, Oxon, UK: CABI Pub. pp. 1–14. ISBN 9780851998398. 
  2. ^ a b Carter, Burton J. Bogitsh, Clint E. (2013). Human Parasitology (4th ed. ed.). Amsterdam: Academic Press. pp. 241–244. ISBN 9780124159150. 
  3. ^ a b c Gutierrez, Yezid (2000). Diagnostic Pathology of Parasitic Infections with Clinical Correlations (2nd ed. ed.). New York [u.a.]: Oxford University Press. pp. 635–652. ISBN 9780195121438. 
  4. ^ Willms, Kaethe (2008). "Morphology and Biochemistry of the Pork Tapeworm, Taenia solium". Current Topics in Medicinal Chemistry 8 (5): 375–382. doi:10.2174/156802608783790875. PMID 18393900. 
  5. ^ Rabiela, MT; Rivas, A; Flisser, A (November 1989). "Morphological types of Taenia solium cysticerci". Parasitology Today 5 (11): 357–359. doi:10.1016/0169-4758(89)90111-7. PMID 15463154. 
  6. ^ Mayta, Holger (2009). Cloning and Characterization of Two Novel Taenia Solium Antigenic Proteins and Applicability to the Diagnosis and Control of Taeniasis/cysticercosis. ProQuest. pp. 4–12. ISBN 9780549938996. 
  7. ^ a b c Garcia, Oscar H. Del Brutto, Hector H. (2014). "Taenia solium: Biological Characteristics and Life Cycle". Cysticercosis of the Human Nervous System. (1., 2014 ed.). Berlin: Springer-Verlag Berlin and Heidelberg GmbH & Co. KG. pp. 11–21. ISBN 978-3-642-39021-0. 
  8. ^ a b Junghanss, Jeremy Farrar, Peter J. Hotez, Thomas (2013). Manson's Tropical Diseases (23rd edition ed.). Oxford: Elsevier/Saunders. pp. 820–825. ISBN 9780702053061. 
  9. ^ Roth, EJ (1926). "Man as the Intermediate Host of the Taenia Solium.". British Medical Journal 2 (3427): 470–1. PMC 2523493. PMID 20772764. 
  10. ^ Flisser, A.; Avila G, Maravilla P, Mendlovic F, León-Cabrera S, Cruz-Rivera M, Garza A, Gómez B, Aguilar L, Terán N, Velasco S, Benítez M, Jimenez-Gonzalez DE (2010). "Taenia solium: current understanding of laboratory animal models of taeniosis". Parasitology 137 (03): 347. doi:10.1017/S0031182010000272. PMID 20188011. 
  11. ^ Richards F, Jr; Schantz, PM (1991). "Laboratory diagnosis of cysticercosis.". Clinics in Laboratory Medicine 11 (4): 1011–28. PMID 1802519. 
  12. ^ Webbe, G. (1994). "Human cysticercosis: Parasitology, pathology, clinical manifestations and available treatment". Pharmacology & Therapeutics 64 (1): 175–200. doi:10.1016/0163-7258(94)90038-8. PMID 7846114. 
  13. ^ Reeder, P.E.S. Palmer, M.M. (2001). Imaging of Tropical Diseases : With Epidemiological, Pathological, and Clinical Correlation (2 (revised) ed.). Heidelberg, Germany: Springer-Verlag. pp. 641–642. ISBN 978-3-540-56028-9. 
  14. ^ Hansen, NJ; Hagelskjaer, LH; Christensen, T (1992). "Neurocysticercosis: a short review and presentation of a Scandinavian case.". Scandinavian Journal of Infectious Diseases 24 (3): 255–62. PMID 1509231. 
  15. ^ Flisser A. (May 1988). "Neurocysticercosis in Mexico". Parasitology Today 4 (5): 131–137. doi:10.1016/0169-4758(88)90187-1. PMID 15463066. 
  16. ^ Dworkin, Mark S. (2010). Outbreak Investigations Around the World: Case Studies in Infectious Disease. Jones and Bartlett Publishers. pp. 192–196. ISBN 978-0-7637-5143-2. Retrieved August 9, 2011. 
  17. ^ Schantz, Moore, Anne C. et al. (September 3, 1992). "Neurocysticercosis in an Orthodox Jewish Community in New York City". New England Journal of Medicine 327 (10): 692–695. doi:10.1056/NEJM199209033271004. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!