Overview

Distribution

Range Description

This species ranges from the KwaZulu-Natal Province in eastern South Africa, northwards into Swaziland, Zimbabwe, Mozambique and southern Malawi (Chikwawa), and then into Tanzania and southern Kenya. Up to 1,800 m in eastern Zimbabwe.

There are three subspecies, O. c. crassicaudatus is known only from the KwaZulu-Natal region; O. c. kirkii Gray, 1863, ranges from Massangena, Mozambique, in the south to southern Malawi in the north; and O. c. monteiri is found in the Brachystegia miombo woodland zone from Angola in the west, to Zambia, Malawi and northern Mozambique in the east and from here north to Rwanda and western and south-eastern Kenya.

Some taxonomic authorities states that O. c. monteiri can be split into two groups with a monteiri group present from Angola, through the southern Democratic Republic of the Congo, Zambia, Zimbabwe, northern Mozambique, Malawi and southern Tanzania (Tabora). The distribution of the argentatus grouping is unclear, but it has been recorded from Rwanda, Kenya and Tanzania.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Thick-tailed galagos, or bushbabies, are found in East Africa from southern Sudan to eastern South Africa and through southern Angola.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Otolemur crassicaudatus, also known as the thick-tailed galago, is the largest galago species. Head and body length ranges from 297 to 373 mm, and tail length from 415 to 473 mm. Body size is sexually dimorphic, with males being significantly larger than females. The coloration of the fur is silvery brown to gray with the underside usually lighter in color. The fur is dense, woolly, quite long, wavy, and usually described as without luster.

The ears of O. crassicaudatus are large and can be moved independently of each other backwards and towards the base of the ear. These primates often furl and unfurl their ears, giving them a quizzical expression.

The eyes are forward pointing and large. As with most galago species, there are flat disks of thickened skin at the ends of the fingers and toes useful in grasping limbs. The fingers are long, and the toes are flattened with flattened nails. The dental formula is I 2/2, C 1/1, P 3/3, M 3/3.

Range mass: 1 to 2 kg.

Range length: 297 to 373 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 2.595 W.

  • Kappeler, P. 1991. Patterns of Sexual Dimorphism in Body Weight among Prosimian Primates. Folia Primatol, 57: 132-146.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is mostly found in coastal forest, woodland and riparian bushland. In the southern parts of the range (e.g. KwaZulu-Natal and the Limpopo Province), the species is found in riparian and coastal forest, whereas in the northern parts of the range it extends into bushland and open woodland (Skinner and Chimimba 2005). This species may possibly be found in timber plantations, and in western Swaziland have adapted to living in wattle forests. It is not uncommon in urban gardens and farmland where there is sufficient tree growth to afford them shelter and where there are orchards of tropical and semi-tropical fruits to provide food. Sleeps alone or in groups of 2-6 and generally disperses solitarily or in small groups at night to forage. It is presumed to give birth to between one and three infants per year (Skinner and Chimimba 2005).

O. c. monteiri is known from Brachystegia woodlands and riparian forests. It extends over a wide range by using corridors of vegetation along rivers and streams. On the other hand, O. c. kirkii is mostly found in coastal forest, woodland and riparian bushland, and in the northern parts of the range it extends into bushland and open woodland. It is not uncommon in urban gardens and farmland where there is sufficient tree growth to afford them shelter and where there are orchards of tropical and semi-tropical fruits to provide food.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

These animals are forest dwellers (Nowak, 1983).

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Thick-tailed bushbabies are mostly gumivorous and frugivorous; they are known to eat insects as well. In a study in South Africa, approximately 62% of the diet was gums and saps, supplemented by fruits and insects. The diet of O. crassicaudatus varies with locality. In the Transvaal, South Africa, insects were estimated to comprise 5% of the diet, whereas in Kenya, insects may account for 50 to 70% of the diet. One insect species which may serve as a seasonal food supply is Macrotermes falcigar, also known as large termites. When these termites are in the alate (winged) form, thick-tailed bushbabies have been observed eating them off the ground without using their hands.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: fruit; sap or other plant fluids

Primary Diet: omnivore

  • Happold, D., M. Happold. 1992. Termites as Food for the Thick-Tailed Bushbaby (Otolemur crassicaudatus) in Malawi. Folia Primatol, 58: 118-120.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

These animals are clearly important in local food webs. They prey upon insects, controlling the growth of insect populations. In additon, as a prey species, O. crassicaudatus may have a positive impact on the populations of its predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Accounts of predation on this species are lacking the literature covered here. However, as small, nocturnal mammals, it is likely that snakes, owls, and small carnivorous mammals may prey upon them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

This galago communicates using several vocalizations. The young make a soft clicking sound to their mother. Adults make a louder clicking noise to call to other adults. There are also loud cries, barks, and a high-pitched alarm call.

Thick-tailed galagos also communicate through olfactory signals. They urine mark and urine wash. Urine washing is a behavior that spreads the urine all over the hands and feet to leave the scent over the entire space through which the animal moves (Nowak and Paradiso, 1983).

In addition, all galagos are known to have visual communication (body postures and facial expressions) and tactile communication (primarily grooming).

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Species in the genus Otolemur have been reported to live in excess of 18 years in captivity. It is likely that wild individuals have a lower life expectency.

Range lifespan

Status: captivity:
18+ (high) years.

Average lifespan

Status: captivity:
22.7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.7 years (captivity) Observations: One captive specimen of the subspecies *monteiri* lived 22.7 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

In most types of galagos, mating can be either monogamous or polygynous. The deciding factor appears to be the population density. Males tend to maintain larger home ranges than do females. They mate with females whose ranges are encompassed by their own.

Mating System: monogamous ; polygynous

The birth season of thick-tailed galagos varies according to locality. For example, breeding is restricted to November in the Transvaal, but occurs in August and September in Zambia. Pregancies peak in August in Zanzibar and Pemba. Female estrous cycles last approximately 44 days. Gestation is 133 days.

Litter size is generally 2 young, but can be 3. Females reach sexual maturity at 2 years of age. Because male competitive behavior is usually related to size in galagos, it is likely that males reach reproductive age somewhat later than do females.

Breeding interval: The animals likely breed once annually.

Breeding season: The birth season of the thick-tailed galago varies according to locality.

Range number of offspring: 2 to 3.

Average gestation period: 133 days.

Average age at sexual or reproductive maturity (female): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 43.2 g.

Average gestation period: 130 days.

Average number of offspring: 1.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
639 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
495 days.

After birth, females leave their young in the tree while they leave to forage. They produce a rich, energy-dense milk, especially in comparison with anthropoid primates. This may be related to their lifestyle, as anthropoid primates carry their young during lactation and this galago does not (Tilden, 1997; Nowak, 1983). The role of the male in parental care has not been described, but through defense of his home range, he may unintentionally help to protect and defend the young within the territory.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Otolemur crassicaudatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2537-09|NC_012762|Otolemur crassicaudatus| AACCGCTGGCTATATTCTACTAATCACAAAGACATTGGCACCTTGTACTTAATTTTCGGCGCCTGGGCAGGAATAGTAGGAACTGCCCTC---AGCCTTTTAATTCGAGCAGAACTAGGCCAACCTGGAACCCTGCTGGGGGAC---GATCAGATCTATAATGTCATCGTCACAGCCCACGCATTCGTCATAATCTTCTTTATAGTTATGCCAATTATAATTGGAGGCTTCGGAAACTGACTAGTCCCGCTAATA---ATCGGTGCACCAGATATGGCATTTCCACGAATGAATAATATAAGCTTCTGACTGCTTCCACCCTCATTCCTCCTCCTCCTAGCCTCCTCAATAGTCGAAGCCGGAGCCGGAACCGGATGAACCGTATACCCCCCTTTAGCAGGCAACTTAGCCCATGCAGGAGCCTCCGTAGACCTA---ACAATTTTCTCACTTCATCTGGCAGGGGTGTCCTCAATCCTTGGGGCTATTAACTTTATTACAACTATTATCAACATGAAACCCCCAGCAATATCCCAATACCAAACCCCCTTGTTTGTCTGATCTGTGATTATCACAGCAGTCCTGCTACTCCTGTCCCTACCTGTTTTAGCAGCG---GGAATTACCATACTCCTCACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCGGGAGGAGGAGATCCAATCCTTTACCAACATTTATTCTGGTTCTTTGGACACCCAGAAGTGTATATCCTTATTCTACCAGGATTCGGAATAATCTCCCACATCGTATCTTACTACTCTGGTAAGAAA---GAACCATTTGGGTATATAGGAATAGTCTGAGCAATAATATCCATTGGCTTCCTAGGCTTTATCGTCTGAGCCCATCACATGTTTACAGTGGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Otolemur crassicaudatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Bearder, S.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Listed as Least Concern as the species is relatively widespread and common, present in a number of well-managed protected areas, and there are no major threats.

History
  • 2000
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
  • 1988
    Not Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although this species is rated "Lower Risk" on the IUCN Redlist, it is losing habitat due to humans clearing the land for farming and grazing animals.

As with all primates, galagos are listed in in Appendix II of CITES, limiting international trade in the animals or their parts.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a relatively common species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is expanding its range in some areas (e.g., in South Africa), and there are no current major threats. However, it may be locally threatened in parts of its range through the loss of suitable forest habitat. For example, although O. c. monteiri, was once common around Lake Victoria, it has now almost completely disappeared, together with the woodlands due to cultivation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix II of CITES. It occurs in several protected areas. Taxonomic and survey work is required to determine the relationship of the subspecies O. c. monteiri.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no significant adverse effects of O. crassicaudatus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

These animals, like other galagos, may occasionally be hunted as food. However, for the most part, they have no economic importance to humans.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brown greater galago

The brown greater galago (Otolemur crassicaudatus) is a nocturnal primate, the largest in the family of galagos.

Contents

Physical characteristics

GalagoCrassicaudatusWolf.jpg

This species has a rounded head with a short, wide snout, very large ears and relatively small eyes. The thick fur is very variable in color, depending on the subspecies: some have a grayish fur with a light brown tail tip, others a dark brown fur with a black tip.[3] The lighter colored animals mainly occur in dryer, low-lying areas, while the darker animals live in higher, wetter territories.

The brown greater galago has a head-and-body length of 26 to 47 cm (32 cm on average), a tail length of 29 to 55 cm, and a weight of 0.5 to 2 kg. On average females weigh 1.2 kg (2.6 lb), and males 1.4 kg (3.1 lb).[3]

Distribution

This species is common in Southern and East Africa. The largest populations are found in Angola, Tanzania, southern Kenya and the coast of Somalia.

Behavior

The brown greater galago is a nocturnal animal.[3] During the day, it rests in a hollow tree or in dense vegetation. Its diet consists of fruit (like berries, figs), seeds, acacia gum, flowers, insects, slugs, reptiles and small birds.

The species lives in small groups in a territory of a few hectares. The territory is marked by urine and a scent produced in a gland in the chest.[3]

Subspecies

Two subspecies of Otolemur crassicaudatus are recognised:[1]

  • O. c. crassicaudatus
  • O. c. kirkii

The IUCN considers the silvery greater galago as a third subspecies, O. c. monteiri.[2] Other sources treat it as a separate species, though with "misgivings".[4] The IUCN Red List assesses all three forms individually as Least Concern.

References

  1. ^ a b Groves, C. (2005). "Otolemur crassicaudatus". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 126. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100152. 
  2. ^ a b Bearder, S. (2008). Otolemur crassicaudatus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 1 January 2009.
  3. ^ a b c d Flannery, Sean (2007-04-01). "Greater Galago (Otolemur crassicaudatus)". The Primata. http://www.theprimata.com/otolemur_crassicaudatus.html. Retrieved 8 August 2010. 
  4. ^ Groves, C. (2005). "Otolemur monteiri". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100160. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!