Overview

Brief Summary

Taxonomy

The aye aye is the only surviving member of the family Daubentoniidae - 1 of 5 families of lemuriform primates that are found only on the island of Madagascar. Early naturalists found the aye aye difficult to place taxonomically due to its bewildering combination of morphological characteristics, and it was variously classified as a squirrel, rodent or primate.A detailed anatomical investigation by Richard Owen secured their status as primates - he later became the first Director of the Natural History Museum.Subfossils of a giant form of extinct aye aye, Daubentonia robusta, are found at sites in the south and southwest of Madagascar.The extinct species weighed 2 to 5 times as much as the living aye aye and may have been driven to extinction as a result of human actions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Aye-ayes are nocturnal and solitary creatures (5). The day is spent within a nest constructed from twigs and often located high in the crown of tall trees; different nests are utilized on consecutive days and by different individuals (5). Males have large overlapping home ranges, of between 100 and 200 hectares, which encompass those of several females; individuals scent mark their home range by rubbing parts of their neck, cheeks and rump regions onto branches (2). There is no fixed breeding season and females advertise their readiness to mate through distinctive calls (2). A single offspring is born after a gestation period of 160 to 170 days (2) (6) and remains within the nest for around two months before emerging (5). It is thought that females may have intervals of up to three years between births (2). The extraordinary morphology of the aye-aye's hands are adaptations for foraging; the extended middle digit is used for a number of purposes, such as scooping the pulp out of fruits such as coconuts and ramy nuts (Canarium madagascariensis) (2). However, the aye-aye is probably best known for its technique of finding the insects and larvae that make up the majority of its diet; the middle finger is used to tap at branches and the sound produced reveals cavities where insects might be found (5). In this respect, these primates occupy a niche that is filled by woodpeckers elsewhere (4). Once prey is located, aye-ayes tear through the wood with their strong upper incisors and then remove the prize with their long finger (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Aye ayes possess a unique combination of highly derived morphological features.The incisors (front teeth) have been reduced to a single pair that grows continuously, as in rodents.These teeth are used to gnaw into hard-shelled fruit such as coconuts and to tear bark off trees. Aye ayes have a specialised thin, flexible middle finger that is used during foraging tasks that require high mobility and precision.Like most lemurs, ayes ayes have retained a reflective layer of tissue in the eye - the tapetum lucidum - that improves vision in low-light conditions and causes eye-shine.Ayes ayes have long, coarse hair, large ears and a bushy tail that is longer than their body.They are the largest nocturnal primate with both males and females weighing approximately 2.6 kilograms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

Daubentonia madagascariensis, known as the aye aye, is a nocturnal primate found only on the island of Madagascar and is considered by many to be the strangest of all primates.The aye aye is disadvantaged by its unusual and even sinister appearance and behaviour, such as:
  • huge, spidery-looking hands with a tapping bony finger
  • coarse black fur
  • bushy tail
  • bat like ears
  • widely spaced shining eyes
  • nocturnal habits
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The bizarre aye-aye is one of the most unusual primates on the planet, so much so that it was originally classified as a rodent (2). The thick coat is slate grey to brown with white flecks from the long guard hairs, which are lighter at the tip (2). The face is paler than the rest of the body with large, leathery ears and prominent, yellowish-orange eyes (2). The hands are the most striking feature of this animal; the elongated, thin fingers have curved, claw-like nails (4) and the third digit is extremely thin so that it appears to be little more than skin and bone (2). The aye-aye is the largest nocturnal primate and has a long bushy tail (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the island of Madagascar. Recent confirmed sightings document the Aye-aye's presence in eastern forests from Ampanefana in the north to Andohahela National Park in the south, and in western forests from Montagne d'Ambre in the north to at least the Tsingy de Bemaraha National Park. There is also an introduced population on the island of Nosy Mangabe and Aye-Aye island, above Mananara Nord (see Mittermeier et al. 2008 and references therein). Sea-level to 1,875 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Daubentonia madagascariensis, commonly known as the aye-aye, is endemic to Madagascar. Aye-ayes can be found widely distributed across the island.

Biogeographic Regions: ethiopian (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Malagasy Republic (=Madagascar)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Endemic to Madagascar, the aye-aye is now known to be more wide-ranging than was previously thought, occurring in dry forests in the northwest and west of the island as well as the rainforest of the east coast (4). However, in all localities it appears only at very low densities (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Aye-ayes have a head-body length from 360 to 440 mm and a long bushy tail. The coat is long, coarse, and either dark brown or black in color, with scattered white guard hairs. The face and throat are pale gray and facial features include yellow-orange or sandy brown eyes surrounded by dark markings, large triangular ears, a short snout, and a pink nose. There is no significant sexual dimorphism between males and females.

Aye-ayes have highly specialized digits. The third digit of the hand is slender, elongated, and flexible, and is especially important in feeding behaviors. Aye-ayes have a dental formula of I:1/1, C:0/0, PM:1/0, M:3/3. The incisors are large and ever-growing, with enamel coating only the anterior surface. There is a large diastema present in both the upper and lower jaws.

Range mass: 2570 to 2615 g.

Range length: 360 to 440 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Feistner, A., E. Sterling, Dodo. 1995. Body Mass and Sexual Dimoorphism in the Aye-Aye. Journal of the Wildlife Preservation Trusts, vol. 31: 73-76.
  • Soligo, C. 2005. Anatomy of the Hand and Arm in Daubentonia Madagascariensis. Folia Primatologica, vol. 76 issue 5: 262-300.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The nocturnal aye-aye is quite adaptable and is known from a variety of habitats including primary rain forest, deciduous forest, secondary growth, cultivated areas, dry scrub forest, coconut groves, and mangrove swamps; the southern spiny desert appears to be the only habitat in which the species does not occur. Its presence in many areas appears to be determined largely by its primary food resource, the seeds of ramy (Canarium spp.) although there are also other dietary staples (Mittermeier et al. 2008, and references therein).

During the day, Aye-ayes sleep in nests, tree forks or vine tangles. Nests may be occupied for a few days at a time and several individuals may use the same nest at different times. Males occupy much larger home ranges than females, 125-215 ha compared to 30-40 ha; interestingly, aye-ayes appear to spend more time moving along the ground than any other lemur except Lemur catta (Sterling 1993). Recent evidence suggests that Aye-ayes are not strictly solitary, but also forage in tandem and may exhibit differing relationships between animals of the same sex (Sterling and Richard 1995). There appears to be no restricted mating season and a single young is born. Females begin breeding at three or four years, and indications are that females give birth every two to three years (Petter and Peyrieras 1970).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Daubentonia madagascariensis can be found in a wide variety of environments including primary and secondary rainforest, deciduous forest, cultivated plantations, and occasionally dry scrub forest and mangrove forest. They spend most of their time in the upper two levels of the canopy.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

  • Ancrenaz, M., I. Lackamancrenaz, N. Mundy. 1994. Field Observations of Aye-Ayes. Folia Primatologica, vol. 62 issue 1-3: 22-36.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found in a range of habitats from primary rainforest to dry deciduous forest (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

To fulfill basic needs for growth and maintenance, aye-ayes require a diet rich in fats and proteins. In the wild roughly 240 to 342 kilocalories are consumed daily and the calorie intake is steady throughout the year, although it is slightly lower in the cold season relative to the hot, wet, and dry seasons. Aye-ayes have a varied diet consisting of fruits, nuts, and plant exudates. Breadfruit, banana, coconuts, and ramy nuts are among the favored foods, but bamboo, nectar from the traveler’s tree, lychees, and mangoes may also be consumed. Aye-ayes use their specialized third digit to pierce the outer skin of fruits and scoop out the contents.

Xylophagous, or wood boring, insect larvae make up another important component of the aye-aye diet, especially cerambycid beetle larvae. Aye-ayes have several derived features and a unique percussive foraging method to detect the presence of these larvae in trees. The specialized third digit is used to tap on wood in search of hollow spaces below the surface of the bark. There are conflicting views on whether aye-ayes can detect the sound of reverberations in these cavities or whether they can detect breaks in the integrity of the wood. Once a cavity is found, the aye-aye uses its large, procumbent incisors to gnaw through the bark and extracts the larvae with its long and slender third digit. There are several other features that may be related to foraging behaviors. These include an enlarged frontal cortex and an increased volume of the olfactory lobe, as well as large, naked ears, which enhance hearing.

Animal Foods: insects

Plant Foods: leaves; seeds, grains, and nuts; fruit; nectar; sap or other plant fluids

Primary Diet: carnivore (Insectivore ); herbivore (Frugivore )

  • Dierenfeld, E., C. Ashbourne, A. Feistner. 1994. Dietary-intake, Food Composition and Nutrient Intake in Wild and Captive Aye-Ayes. Folia Primatologica, vol. 62 issue 1-3: 115-124.
  • Erickson, C. 1995. Feeding Sites for Extractive Foragaing by the Aye-Aye. American Journal of Primatology, vol. 35 issue 3: 235-240.
  • Erickson, C., S. Nowiki, L. Dollar, N. Goehring. 1998. Precursive Foraging: Stimuli for Prey Location by Aye-Ayes. International Journal of Primatology, vol. 19 issue 1: 111-122.
  • Kaufman, J., E. Ahrens, D. Laidlaw. 2005. Anatomical Analysis of an Aye-Aye Brain Combining History, Structural Magnetic Resonance Imanging and Diffusion-Tensor Imaging. Anatomical Record, vol. 287A issue 1: 1026-1037.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Aye-ayes may help to disperse fruiting tree seeds through their frugivory. They are also important predators of wood-boring beetle larvae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Aye-ayes may be prey for fossas, Cryptoprocta ferox, one of Madagascar’s largest carnivores. However, little is known about predation on aye-ayes. Their nocturnal and arboreal habits may protect them from much predation.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Distribution ecology

Aye ayes can be found along the entire east coast of Madagascar and have been sighted in other parts of Madagascar.Their preferred habitat is moist forest but aye ayes also occur in dry forests and in cultivated areas, which brings them into conflict with humans.Sightings of aye ayes are rare through most of its natural range. But signs of their presence include:
  • nests
  • gnaw marks on trees
  • gnaw mark on ramy nuts
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Aye-ayes communicate using a number of vocalizations. A distinctive scream indicates aggression, and a closed mouth version of this scream can indicate protest. A brief descending whimper is heard in connection with competition over food resources. A “tiss” sound serves as a response to the appearance of humans or lemurs, and a “hai-hai” vocalization can be heard during attempts to flee from captors.

Communication Channels: acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Aye ayes have a diverse diet including:
  • insects
  • seeds
  • fruit
  • nectar
  • fungus
The aye aye can locate wood-boring insect larvae by rapidly tapping its thin bony finger on a branch of a tree to locate a cavity and listen for the sounds of the grub burrowing under the bark.On locating a grub, the aye aye will rip off the overlying bark with its incisors and insert its bony middle finger into the cavity to extract the grub.Aye ayes also use their fingers to scoop out the pulp and juice from coconuts, and occasionally to extract the contents of an egg.The aye aye is nocturnal. During the day the animals sleep in nests, which may be elaborately constructed and used for several days.Males have large home ranges which overlap with those of at least one female and may overlap with those of other males. Females have smaller home ranges which they share with their young and do not overlap with those of other females.Aye ayes have an extended breeding season or may even breed year-round.Female aye ayes give birth to a single young every 2 to 3 years. Aye aye infants develop relatively slowly and have a long period of dependence compared to other lemurs. This prolonged period of dependency enables the infant to learn complex foraging techniques from its mother.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

A captive female lived to an age of 23.3 years.

Range lifespan

Status: captivity:
23.3 (high) years.

Average lifespan

Status: captivity:
23.3 years.

Average lifespan

Status: captivity:
24.3 years.

Average lifespan

Sex: female

Status: captivity:
5.4 years.

Average lifespan

Status: captivity:
23.0 years.

  • de Magalhães, J. 2007. "Daubentonia madagascariensis" (On-line). AnAge: The Animal Ageing Resource. Accessed December 18, 2007 at ttp://www.genomics.senescence.info/species/entry.php?species=Daubentonia_madagascariensis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.3 years (captivity) Observations: One captive specimen lived 23.3 years at Amsterdam Zoo (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

During each mating cycle females typically mate with more than one male, representing a multi-male, multi-female mating system.

Mating System: polygynandrous (promiscuous)

Aye-ayes have an extended mating season. Observations in the wild showed a five month period from October to February when individuals were mating, or there were visible signs of females in estrus. Female estrous cycles range from 21 to 65 days and are characterized by changes in the vulva, which is usually small and gray, and becomes large and red during these cycles.

There is a gestation period of 152 to 172 days, and infants are typically born between February and September. There is a 2 to 3 year interval between births. This long interbirth interval may be due to the relatively slow development of young and high levels of parental investment.

Aye-ayes have an average neonatal weight of 90 to 140g and will grow to be roughly 2615 g for males and 2570 g for females. Infants have a coat that is similar in color to adults, but they are distinguished in appearance by their green eyes and floppy ears. Infants also have a deciduous dental formula of: I:1-2/1-2, C1/1, PM:2/2. This deciduous dentition is shed at 20 weeks.

Breeding interval: Female aye-ayes give birth every 2 to 3 years.

Breeding season: Mating occurs from October to February.

Average number of offspring: 1.

Range gestation period: 152 to 172 days.

Range weaning age: 20 (high) weeks.

Average age at sexual or reproductive maturity (female): 2.5 years.

Average age at sexual or reproductive maturity (male): 2.5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 109 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
882 days.

Aye-ayes have a relatively slow rate of development, compared to other Strepsirrhini. Observations of this species in the first year of development showed that young first left the nest at 8 weeks. They began feeding on solid food regularly at 20 weeks, the same time that the deciduous dentition is lost, and were still food begging and making attempts to suckle at one year old. This extended period of dependence is probably related to their highly specialized feeding behaviors. Young aye-ayes typically achieve adult proficiency in locomotion by 9 months and reach sexual maturity by 2.5 years.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • AnkelSimons, F. 1996. Deciduous Dentition of the Aye-Aye. American Journal of Primatology, vol. 39 issue 2: 87-97.
  • Feistner, A., C. Ashbourne. 1994. Infant Development in a Captive Bred Aye-Aye. Folia Primatologica, vol. 62 issue 1-3: 74-92.
  • Feistner, A., E. Sterling, Dodo. 1995. Body Mass and Sexual Dimoorphism in the Aye-Aye. Journal of the Wildlife Preservation Trusts, vol. 31: 73-76.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Eyes improve foraging abilities: aye-aye
 

The eyes of aye-ayes aid in nocturnal foraging because they may be able to perceive color at night.

   
  "While color vision perception is thought to be adaptively correlated with foraging efficiency for diurnal mammals, those that forage exclusively at night may not need color vision nor have the capacity for it. Indeed, although the basic condition for mammals is dichromacy, diverse nocturnal mammals have only monochromatic vision, resulting from functional loss of the short-wavelength sensitive opsin gene. However, many nocturnal primates maintain intact two opsin genes and thus have dichromatic capacity. The evolutionary significance of this surprising observation has not yet been elucidated. We used a molecular population genetics approach to test evolutionary hypotheses for the two intact opsin genes of the fully nocturnal aye-aye (Daubentonia madagascariensis), a highly unusual and endangered Madagascar primate. No evidence of gene degradation in either opsin gene was observed for any of 8 aye-aye individuals examined. Furthermore, levels of nucleotide diversity for opsin gene functional sites were lower than those for 15 neutrally evolving intergenic regions (>25 kb in total), which is consistent with a history of purifying selection on aye-aye opsin genes. The most likely explanation for these findings is that dichromacy is advantageous for aye-ayes despite their nocturnal activity pattern. We speculate that dichromatic nocturnal primates may be able to perceive color while foraging under moonlight conditions, and suggest that behavioral and ecological comparisons among dichromatic and monochromatic nocturnal primates will help to elucidate the specific activities for which color vision perception is advantageous." (Perry et al. 2007:1963)
  Learn more about this functional adaptation.
  • Perry, George H.; Martin, Robert D.; Verrelli, Brian C. 2007. Signatures of Functional Constraint at Aye-aye Opsin Genes: The Potential of Adaptive Color Vision in a Nocturnal Primate. Mol. Biol. Evol. 24(9): 1963-1970.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Daubentonia madagascariensis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1725-08|AM905039|Daubentonia madagascariensis| AACCGTTGACTGTACTCAACAAACCATAAAGATATCGGAACCCTCTACCTCCTTTTTGGTGCTTGGGCAGGTATAGTAGGAACAGCCCTA---AGCCTTCTAATTCGAGCAGAACTTGGTCAACCAGGGACCCTACTAGGCGAT---GACCAAATCTATAACGTCATTGTAACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCCATTATAATTGGAGGCTTCGGAAATTGACTGGTGCCTTTAATA---ATCGGAGCCCCTGATATAGCCTTCCCCCGTATAAATAACATGAGTTTCTGACTACTCCCCCCGTCCTTTCTTCTCCTCCTTGCCTCCTCAATAGTGGAGGCAGGGGCCGGCACAGGATGAACCGTATACCCCCCTTTAGCAGGAAATCTGGCTCACGCCGGAGCCTCCGTAGACTTA---ACTATTTTTTCACTCCACTTAGCAGGAGTCTCATCAATCCTTGGGGCCATTAACTTTATTACAACAATTATCAACATGAAACCACCAGCTATATCACAATACCAAACCCCCTTATTCGTATGGTCCGTAATAATCACTGCCATTCTACTTTTACTATCCCTTCCAGTCCTAGCAGCT---GGGATTACCATACTCCTAACCGACCGCAACCTAAACACTACCTTCTTTGACCCTGCCGGAGGAGGAGACCCCATTCTATATCAACACCTATTCTGATTTTTCGGCCACCCTGAAGTTTACATCTTAATTCTCCCGGGCTTCGGCATAATCTCCCACATCGTCACGTACTATTCCGGAAAAAAA---GAACCTTTCGGCTACATAGGCATAGTATGAGCTATAATATCTATTGGCTTTCTAGGTTTCATCGTATGGGCCCACCACATGTTCACAGTGGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Daubentonia madagascariensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Andrainarivo, C., Andriaholinirina, V.N., Feistner, A., Felix, T., Ganzhorn, J., Garbutt, N., Golden, C., Konstant, B., Louis Jr., E., Meyers, D., Mittermeier, R.A., Perieras, A., Princee, F., Rabarivola, J.C., Rakotosamimanana, B., Rasamimanana, H., Ratsimbazafy, J., Raveloarinoro, G., Razafimanantsoa, A., Rumpler, Y., Schwitzer, C., Thalmann, U., Wilmé, L. & Wright, P.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
Listed as Near Threatened as although the species is now known to be widespread and adaptable, it is thought to have undergone a reduction of 20-25% over the past 24 years (assuming a generation length of 8 years) due primarily to a decline in area and quality of habitat and ongoing levels of exploitation/persecution. Almost qualifies as threatened under criterion A2cd.

History
  • 2000
    Endangered
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Daubentonia madagascariensis has been listed as an endangered species since the 1970s. In 1992 the IUCN estimated the total population to be between 1,000 and 10,000 individuals. The rapid loss of their natural habitat due to encroachment by humans is the main threat to this species. In addition, aye-ayes are hunted or killed on the spot by native Malagasy who see them as crop pests or bad omens. Currently, aye-ayes can be found in at least 16 protected areas across Madagascar. There is an effort to develop breeding colonies of captive aye-ayes.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Daubentonia madagascariensis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The aye aye is under threat from continued habitat destruction.In addition, there are many superstitious beliefs attached to the aye aye.The aye aye is disadvantaged by its unusual and even sinister appearance and behaviour - notably its huge spidery looking hands with a tapping bony finger, coarse black fur, bushy tail, bat-like ears, widely spaced shining eyes and nocturnal habits.In parts of Madagascar, simply catching sight of an aye aye has been regarded as an ill omen or as the cause of previous bad fortune.Aye ayes may approach the outskirts of a village in search or mangos, coconuts and other crops. An aye aye sighted near a village risks being killed and the corpse may be tied to a roadside pole outside a village so that the bad luck will be carried away.For many years, aye ayes were considered to be near extinction and in an effort to save those that remained, 9 aye ayes were captured and released onto the small island of Nosy Mangabe in 1966. Studies in the 1990s suggest the population had taken hold and appeared to be thriving.Aye ayes are now known to be more widely distributed on Madagascar and are found in several protected areas, but generally at low population densities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Despite the Aye-aye?s widespread distribution, it is still killed as a crop pest, and a harbinger of evil, and habitat destruction remains a localized threat throughout the range. In addition, trees such as Intsia bijugia and Canarium madagascariense, which are dietary staples for this species, are also cut preferentially for the construction of boats, houses, and coffins (e.g., Iwana and Iwakawa, 1988). There is also some evidence that it is hunted for food in some areas (e.g., Makira, C. Golden pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Aye-ayes are at risk from the widespread deforestation that is threatening all of Madagascar's primates, as forests are cleared to make way for agriculture and development (2). This species exists at low densities and therefore requires large areas of suitable habitat for a viable population to exist (2). These bizarre-looking animals are the subject of many beliefs in Madagascar and in some regions are seen as ill omens and are persecuted as a result (2). Aye-ayes will feed on plantation crops such as coconuts and lychees and may therefore be treated as pests in some areas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix I of CITES. Daubentonia madagascariensis is reported to occur in numerous protected areas, including 12 national parks (Andohahela, Andringitra, Mamamara Nord, Mantadia, Marojejy, Masoala, Midongy du Sud, Montagne d?Ambre, Ranomafana, Tsingy de Bemaraha, Tsingy de Namoroka, Verezenantsoro, and Zahamena), and 13 special reserves (Ambatovaky, Analamazaotra, Analamerana, Anjanaharibé-Sud, Ankarana, Bora, Forêt d?Ambre, Kalambatritra, Manombo, Manongarivo, Marotandrano, Nosy Mangabe, and Pic d?Ivohibe). In addition, the Aye-aye has been sighted in the north-eastern forests of Daraina, which was declared a new protected area in 2005 (Mittermeier et al. 2008). There is a captive breeding program involving various institutions, and a EEP and an SSP.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Aye-ayes have been recorded from a number of protected areas within Madagascar (6), including Ankarana Reserve, Ranomafana National Park, Andasibe-Mantadia National Park and Nosy Mangabe Special Reserve (8). Captive breeding colonies exist at the Duke Primate Centre, North Carolina (6), at the Jersey Wildlife Preservation Trust (7) and at London Zoo (8). Due to the elusive nature of the aye-aye, population estimates are extremely difficult, but the species is believed to be in decline (2). These concerted conservation efforts will be vital in securing the future of this intriguing and unique mammal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Aye-ayes may inhabit cultivated areas and farmlands, including coconut and lychee plantations. As a result, they are sometimes considered crop pests.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Aye-ayes are fascinating animals that are important members of native Malagasy ecosystems.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Aye-aye

Aye-aye!<-- This template has to be "warmed up" before it can be used, for some reason -->

Filozoa

The Aye-aye (Daubentonia madagascariensis) is a lemur, a strepsirrhine primate native to Madagascar that combines rodent-like teeth and a special thin middle finger to fill the same ecological niche as a woodpecker. It is the world's largest nocturnal primate, and is characterized by its unusual method of finding food; it taps on trees to find grubs, then gnaws holes in the wood and inserts its narrow middle finger to pull the grubs out. The only other animal species known to find food in this way is the Striped Possum.[4] From an ecological point of view the Aye-aye fills the niche of a woodpecker as it is capable of penetrating wood to extract the invertebrates within.[5][6]

The Aye-aye is the only extant member of the genus Daubentonia and family Daubentoniidae (although it is currently classified as Near Threatened by the IUCN); a second species, Daubentonia robusta, appears to have become extinct at some point within the last 1000 years.[7]

Contents

Etymology

Its binomial name honours the French naturalist Louis-Jean-Marie Daubenton and the island on which it is found, Madagascar. Among some Malagasy, the Aye-aye is imitatively called "Hay-hay"[8] for a vocalization it is claimed to make. It is supposedly from the European acceptance of this name that its common name was derived.[9] However, the Aye-aye makes no such vocalization. The name was also hypothesized to be of European origin, with a European observer overhearing an exclamation of fear and surprise ("aiee!-aiee!") by Malagasy who encountered it. However, the name exists in remote villages, so it is unlikely to be of European origins. Another hypothesis is that it derives from "heh heh," which is Malagasy for, "I don't know." If correct, then the name might have originated from Malagasy people saying "heh heh" to Europeans in order to avoid saying the name of a feared, magical animal.[10]

Classification

  • Order Primates[2]
    • Suborder Strepsirrhini: non-tarsier prosimians
      • Family Daubentoniidae
        • Genus Daubentonia
          • Aye-aye (Daubentonia madagascariensis)
          • Giant Aye-aye (Daubentonia robusta)
      • Family Cheirogaleidae
      • Family Lemuridae
      • Family Lepilemuridae
      • Family Indriidae

Due to its derived morphological features, the classification of the Aye-aye has been debated since its discovery. The possession of continually growing incisors (front teeth) parallels those of rodents, leading early naturalists to mistakenly classify the Aye-aye within mammalian order Rodentia.[11]

The Aye-aye's classification with the order Primates has been just as uncertain. It has been considered a highly derived member of the Indridae family, a basal branch of the strepsirrhine suborder, and of indeterminate relation to all living primates.[12] In 1931, Anthony and Coupin classified the Aye-aye under infraorder Chiromyiformes, a sister group to the other strepsirrhines. Colin Groves upheld this classification in 2005 because he was not entirely convinced the Aye-aye formed a clade with the rest of the Malagasy lemurs,[1] despite molecular tests that had shown Daubentoniidae was basal to all Lemuriformes,[12] deriving from the same lemur ancestor that rafted to Madagascar during the Paleocene or Eocene. In 2008, Russell Mittermeier, Colin Groves, and others ignored addressing higher-level taxonomy by defining lemurs as monophyletic and containing five living families, including Daubentoniidae.[2]

Habitat

The Aye-aye lives primarily on the east coast of Madagascar. Its natural habitat is rainforest or deciduous forest, but many live in cultivated areas due to deforesting. Rainforest Aye-ayes, the most common, dwell in canopy areas, and are usually sighted upwards of 700 meters altitude. The Aye-aye sleeps during the day in nests built in the forks of trees.[citation needed]

Behavior

Social interaction

The Aye-aye is classically considered 'solitary', but recent research suggests that they are more social than once thought. It usually sticks to foraging in its own personal home range, or territory. The home ranges of males often overlap and the males can be very social with each other. Female home ranges never overlap, though a male's home range often overlaps that of several females. The male Aye-Aye live in large areas that are up to 80 acres (320,000 m2) while female have smaller living space that goes up to 20 acres (81,000 m2). Regular scent marking with their cheeks and neck is a way that aye-ayes let others know of their presence and repel intruders from their territory.[13] Like many other prosimians, the female Aye-aye is dominant to the male. The Aye-aye is not monogamous by any means, and often competes with each other for mates. Males are very aggressive in this regard, and sometimes even pull other males off a female during mating. Outside of mating, males and females interact only occasionally, usually while foraging.[citation needed]

The father will sometimes share food with the infant, but otherwise infants' primary source of social interaction is with their mothers. Mothers and infants often wrestle, chase, and play "peek-a-boo" for entertainment. After 13 weeks, infants are usually ready to interact with other young Aye-ayes, usually by play-fighting.[citation needed]

Foraging

An Aye-aye foraging, c.1863, Joseph Wolf. Held at the Natural History Museum, London

The Aye-aye begins foraging anywhere between 30 minutes before or 3 hours after sunset. Up to 80% of the night is spent foraging in the canopy, separated by occasional rest periods. The monkey-like body of the Aye-aye enables it to move vertically with ease. It climbs trees by making successive vertical leaps, much like a squirrel. Horizontal movement is more difficult, but the Aye-aye rarely descends to jump to another tree, and can often cross up to 4 km (2.5 mi) a night.[citation needed]

Infants are fully dextrous within a month of birth. At first they can only climb on a branch hanging upside down, but they gradually work their way up to the various acrobatic feats that adults can perform. Curiously, walking and running on the ground is often hardest for an Aye-aye to master.[citation needed]

Though foraging is mostly solitary, it will occasionally forage in groups. Individual movements within the group are coordinated using both sound (vocalisations) and scent signals.[citation needed]

Diet

Gnawed limb

The Aye-aye commonly eats nuts, grubs, fruits, nectar, seeds, and fungi, classifying it as an omnivore. It often picks fruit off trees as it moves through the canopy, often barely stopping to do so. An Aye-aye not lucky enough to live in its natural habitat will often steal coconuts, mangoes, sugar cane, lychees and eggs from villages and plantations. Aye-ayes tap on the trunks and branches of the trees they visit up to 8 times per second and listen to the echo produced to find hollow chambers inside. Once a chamber is found they chew a hole into the wood and get grubs out of that hole with their narrow and bony middle fingers.[citation needed]

History

The original meaning of the name Aye-aye has been lost, as the originating language is extinct. There is a hypothesis that the word "aye aye" signifies simply a cry of alarm to alert others to the presence of this animal, which many Malagasy consider an ill omen.[citation needed]

The Aye-aye was thought to be extinct in 1933, but was rediscovered in 1957. Nine individuals were transported to Nosy Mangabe, an island near Maroantsetra off eastern Madagascar, in 1966.[14] Recent research shows that the Aye-aye is more widespread than was previously thought, but is still categorized as Near Threatened.[3]

There are several Aye-ayes kept in zoos. The largest collection of Aye-ayes and the most successful breeding program with a current population of 22 individuals is at the Duke Lemur Center at Duke University, Durham, North Carolina, US. Several also reside outside of the US at various locations.{{Citation needed|date=July 2010}

Superstition and public controversy

Illustration of an Aye-aye (Daubentonia robusta)

The Aye-aye is a near threatened species not only because its habitat is being destroyed, but also due to native superstition. Besides being a general nuisance in villages, ancient Malagasy legend said that the Aye-aye was a symbol of death. It is viewed as a good omen in some areas, but these areas are a minority.[citation needed]

Researchers in Madagascar report remarkable fearlessness in the Aye-aye; some accounts tell of individual animals strolling nonchalantly in village streets or even walking right up to naturalists in the rainforest and sniffing their shoes. [15]

However, public contempt goes beyond this. The Aye-aye is often viewed as a harbinger of evil and killed on sight. Others believe that should one point its narrow middle finger at someone, they are condemned to death. Some say the appearance of an Aye-aye in a village predicts the death of a villager, and the only way to prevent this is to kill the Aye-aye. The Sakalava people go so far as to claim Aye-ayes sneak into houses through the thatched roofs and murder the sleeping occupants by using their middle finger to puncture the victim's aorta.[5]

Incidents of Aye-aye killings increase every year as its forest habitats are destroyed and it is forced to raid plantations and villages. Because of the superstition surrounding it, this often ends in death. On the other hand, the superstition can prevent people from hunting them for food.[citation needed]

References

  1. ^ a b Groves, Colin P. (16 November 2005). "Order Primates (pp. 111-184)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 121. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=12100099. 
  2. ^ a b c Mittermeier, R. A.; Ganzhorn, J. U.; Konstant, W. R.; Glander, K.; Tattersall, I.; Groves, C. P.; Rylands, A. B.; Hapke, A. et al. (2008). "Lemur Diversity in Madagascar" (PDF). International Journal of Primatology 29 (6): 1607–1656. doi:10.1007/s10764-008-9317-y. http://www.aeecl.org/documents/28.pdf.  edit
  3. ^ a b Andrainarivo, C., et al. (2008). Daubentonia madagascariensis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 1 January 2009.
  4. ^ "Striped Possum". Philadelphia Zoo. http://www.philadelphiazoo.org/zoo/Meet-Our-Animals/Mammals/Other-Mammals/Striped-possum.htm. Retrieved July 2009. "[The stripped possum] have some unusual characteristics that differentiate them from other possums. The fourth finger on each front paw is thin and elongated, their tongue is unusually long and their incisors project forward like chisels. These characteristics are similar to those of a totally unrelated species – the aye aye - a nocturnal lemur from Madagascar." 
  5. ^ a b Piper, Ross (2007). Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals. Greenwood Press. 
  6. ^ Beck, R. M. D. (2009). "Was the Oligo-Miocene Australian metatherian Yalkaparidon a ‘mammalian woodpecker’?". Biological Journal of the Linnean Society 97: 1–17. doi:10.1111/j.1095-8312.2009.01171.x.  edit
  7. ^ Nowak, R. M. (editor) (1999). Walker's Mammals of the World, 6th edition. Baltimore, Md.: Johns Hopkins University Press. pp. 533–534 (vol. 1). ISBN 0801857899. 
  8. ^ Mittermeier, R.A.; Konstant, W.R.; Hawkins, F.; Louis, E.E.; Langrand, O.; Ratsimbazafy, J.; Rasoloarison, R.; Ganzhorn, J.U. et al. (2006). Lemurs of Madagascar. Illustrated by S.D. Nash (2nd ed.). Conservation International. pp. 405–415. ISBN 1-881173-88-7. 
  9. ^ Ruud, Jørgen (1970). Taboo: A Study of Malagasy Customs and Beliefs (2nd ed.). Oslo University Press. pp. 97–101. ASIN B0006FE92Y. 
  10. ^ Simons, E. L.; Meyers, D. M. (2001). "Folklore and Beliefs about the Aye aye (Daubentonia madagascariensis)". Lemur News 6: 11–16. 
  11. ^ Ankel-Simons, Friderun (2007). Primate Anatomy (3rd ed.). Academic Press. ISBN 0-12-372576-3. 
  12. ^ a b Yoder, A. D.; Vilgalys, R.; Ruvolo, M. (1996). "Molecular evolutionary dynamics of cytochrome b in strepsirrhine primates: the phylogenetic significance of third-position transversions" (PDF). Molecular biology and evolution 13 (10): 1339–50. ISSN 0737-4038. PMID 8952078. http://www.biology.duke.edu/yoderlab/reprints/1996YoderVilgalysMBE.pdf.  edit
  13. ^ "Aye-Aye". Durrell Wildlife Conservation Trust. 2006-10-26. http://www.durrellwildlife.org/index.cfm?p=403. Retrieved 2007-08-07. 
  14. ^ Burton, Maurice; Burton; Robert (1970). The international wildlife encyclopedia, Volume 1. Marshall Cavendish. pp. 112–113. ISBN 9780761472667. http://books.google.com/books?id=FuExHhF9IvIC&pg=PA112. 
  15. ^ Harmless Creature Killed Because of Superstition, David Knowles, March 27, 2010
  • Durrell, Gerald (1994). The Aye-Aye And I: A Rescue Mission in Madagascar. Pocket Books. ISBN 0671884395.  - recounts Durrell's expedition to collect Aye-aye's from the wild for captive breeding at Jersey Zoo.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!