Overview

Distribution

Range Description

This species is known from the eastern Pacific: It is endemic to the west coast of Mexico, ranging from Magdalena Bay, Baja California, south to the Gulf of Tehuantepec (Holthuis and Villalobos 1961, Williams 1986, Holthuis 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found on rocky reefs, in clear waters to a depth of 30 m (Holthuis 1991, Briones-Fourzán and Lozano-Álvarez 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panulirus inflatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGCATGAGCTGGTATAGTGGGAACTTCTTTAAGACTTATTATTCGAGCAGAACTAGGACAACCAGGAAGACTAATTGGAGAT---GATCAAATCTATAATGTGGTTGTAACCGCCCACGCTTTTGTAATAATTTTTTTTATAGTAATGCCCATTATAATTGGAGGATTCGGAAATTGACTTGTTCCTATTATATTAGGAGCTCCCGATATGGCATTTCCCCGAATAAATAACATAAGGTTCTGGCTTTTGCCCCCATCTCTGACACTTCTTCTAGCTAGTGGAATGGTGGAAAGAGGAGTAGGCACTGGTTGAACAGTTTATCCTCCTCTTGCAGGGGCAGTAGCTCACGCTGGAGCATCAGTAGATCTAGGAATCTTCTCTCTCCATCTTGCAGGTGTGTCATCAATTCTTGGAGCCGTTAACTTTATTACAACAGTAATTAACATACGATCATCAGGTATAACATTCGACCGAATACCACTATTCGTATGATCAGTATTCATTACCGCCATTTTACTTCTTTTATCCCTTCCGGTACTAGCAGGAGCTATTACCATACTCCTCACCGATCGTAACCTAAACACATCATTCTTCGATCCGGTAGGAGGAGGAGACCCTACCCTTTATCAACACTTATTCTGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Panulirus inflatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Butler, M., Cockcroft, A. & MacDiarmid, A.

Reviewer/s
Collen, B., Livingstone, S. & Richman, N.

Contributor/s
Batchelor, A., De Silva, R., Dyer, E., Kasthala, G., Lutz, M.L., McGuinness, S., Milligan, H.T., Soulsby, A.-M. & Whitton, F.

Justification
Panulirus inflatus has been assessed as Least Concern. While this species is harvested as a food source throughout its range, it is not taken in large quantities and there is no known evidence to suggest that it is undergoing a significant population decline. Regulations are currently in place to control the harvest of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is harvested as a food source throughout its range, although it is taken in relatively low numbers (Briones-Fourzán and Lozano-Álvarez 2003). It is harvested from December to June (Pèrez-González et al. 1992). The annual landing for this species and P. gracilis, is approximately 500 - 600 tonnes (Pèrez-González et al. 2002), predominating the fishing along the western coast of Mexico (Pèrez-González 2008).
Specific population information on this species is unavailable. There is no FAO catch per unit effort (CPUE) data for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Although harvested throughout its range it is not caught in large enough quantities or at high enough intensities to be significantly impacted by this threat. However, there is evidence that fisheries are not adhering to restrictions currently in place which may be impacting the species; for example, in relation to size limits, Pèrez-González (2008) notes "during the last three decades, the mean size of the lobster catch decreased significantly in SE Gulf of California, suggesting a low rate of compliance with fishery regulations due to a lack of strict enforcement."
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are a number of fishery regulations in place for this species; minimum legal size, closed fishing season (July - October), prohibition on the collection of berried females, and control of fishing effort (Pèrez-González et al. 2002); although these are not always adhered to due to a lack of strict enforcement (Pèrez-González 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!