Overview

Brief Summary

Biology

The Tibetan macaque has a multimale-multifemale social system in which females remain in their natal group, but males disperse shortly after adolescence (at about eight years old) (5) (6). Macaque societies are hierarchical, with higher-ranking individuals getting better access to the resources, namely food and sexually-receptive females. As such, an alpha male (the highest-ranking male) dominates the group, and is typically fairly young (eight to nine years old) and strong. With age, the male's rank decreases, and there will always be challenges by others for the dominant position. Studies of Tibetan macaques at Emei Shan and Huang Shan, China, found the average tenure for an alpha male only lasted about one year. When troop size becomes quite large (in the 40 to 50 range) and competition grows over increasingly stretched resources, some individuals (males, females and juveniles) split from the main group to form a new, smaller group, known as 'fissioning', and move on to a different home range. Usually, it is the lowest-ranking individuals that will split from the main group (5). Females first breed at around five years of age (5). A single offspring is produced after 6 months gestation, with most infants being born in January and February (5) (6). Young nurse for a year, although they may continue to do so longer if their mother does not give birth again the following year. Males of the group may also be involved in 'alloparenting' care (5). This diurnal species spends most of its time on the ground, where it forages for leaves, fruit, grass and, to a lesser extent, flowers, seeds, roots and insects (5) (7). When available, bamboo shoots, fruits and leaves are particularly favoured (5) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The Tibetan macaque is a large primate with a short, stump-like tail, a diagnostic feature of the species (4). The fur is brown on the back and creamy-buff to grey on underparts, with a prominent, pale-buff beard and full-cheek whiskers framing the hairless face (4). The bare facial skin is pale pink in males, and a more vivid, reddish-pink in females, particularly around the eyes (5). A long, thick, dense coat helps this species to cope with the cold environment at the high altitudes at which it is found (5). As with other macaques, cheek pouches are used to carry food whilst foraging (6). Infants have silver and black fur (7), which darkens with maturation, although the final colour can vary between anything from a pale, yellowish brown to a dark, brownish-black (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Macaca thibetana occurs in east-central China (Anhui, Fujian, southern Gansu, Guangdong, Guangxi, Guizhou, Jiangxi, Shaanxi, northern Sichuan, Tibet, northern Yunnan, and Zhejiang). It is found in China from 25-33°N, 102°30’-119°30’E; the range extends south into Guangxi at 23°48’N, about 110°E, and as far west as the Yangtze Gorge in western and north-western Sichuan (Groves 2001). Reports from Arunachal Pradesh, India appear to be based on misidentifications (S. Molur pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in east-central China (Fujian, Guangdong, Guangxi, Guizhou, Shaanxi, Sichuan, Tibet and Yunnan) and northeastern India (Arunachal Pradesh, Assam and Meghalaya) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Type for Macaca thibetana
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): F. Smith
Locality: Kuatun, Fujian, China, Asia
  • Type: Howell, A. B. 1928 Mar 16. Proc. Biol. Soc. Washington. 41: 41.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found mainly in broadleaf evergreen forest, both primary and secondary, as well as subtropical and deciduous forest. The species ranges from 1,000 to 2,500 m in elevation (Corbet and Hill 1992). It is predominantly terrestrial (Corbet and Hill 1992) and diurnal, and prefers to sleep in caves. It is frugivorous, but will also consume flowers berries, seeds, leaves, stems, stalks, and invertebrates.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This species occupies subtropical, deciduous and broadleaf evergreen forests, at between 800 and 2,500 m above sea level (2) (6) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 27 years (captivity) Observations: One wild born female lived 25.2 years in captivity, though she was probably less than 27 years of age when she died (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macaca thibetana

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1901-09|EU294187|Macaca thibetana| AATCGCTGACTCTTTTCAACGAACCATAAAGACATCGGAACCCTATATTTACTATTTGGTGCGTGAGCTGGAGTCATAGGCACCGCCCTG---AGCCTTCTCATTCGAGCTGAACTAGGCCAACCCGGCAACCTATTAGGCAAC---GACCACATCTACAACGTTGTTGTAACGGCCCATGCTTTCATTATAATCTTCTTTACAGTTATACCCATTATAATTGGGGGGTTCGGGAACTGATTAGTACCCCTAATA---ATCGGCGCTCCTGACATAGCATTTCCCCGTTTAAACAATATAAGCTTCTGACTCCTCCCTCCTTCTTTCCTGCTATTAATAGCATCAGCCGTAGTAGAAGCTGGCGCCGGAACAGGCTGAACAGTATACCCCCCTCTAGCAGGAAATTTCTCCCACCCAGGAGCTTCTGTAGATTTA---GTTATCTTCTCCCTCCACCTAGCAGGTATTTCCTCCATCTTGGGGGCCATCAACTTTATTACCACTATTATCAACATAAAACCCCCTGCACTATCCCAATACCAGACTCCTTTATTCGTCTGATCAATCTTAATCACAGCTATCCTTCTACTCCTCTCCCTACCGGTCTTAGCTGCT---GGCATTACCATACTGCTAACAGATCGCAATCTCAATACTACCTTCTTTGACCCTGTTGGAGGAGGAGACCCTATCCTATACCAACACCTATTTTGATTCTTCGGTCACCCCGAAGTCTACATCCTCATTCTTCCCGGCTTTGGGATAGTCTCTCACATTGTAGCCCACCACTCTGGGAAAAAA---GAACCGTTTGGGTATATGGGTATAGTTTGGGCTATAATATCAATTGGGTTTTTAGGCTTTATTGTATGAGCCCACCACATATTTACAGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macaca thibetana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Yongcheng, L. & Richardson, M.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Justification
Listed as Near Threatened as although the species is widespread, there has been significant habitat loss and decline in the last 25-30 years (approximately three generations), nearly qualifying the species for Vulnerable under criterion A2cd. There has been a halt in much of the deforestation, so the major threats seem to have stabilized, and the decline of the species is likely not nearly as significant.

History
  • 2000
    Lower Risk/conservation dependent
  • 1996
    Lower Risk/conservation dependent
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower risk/conservation dependent (LR/cd) on the IUCN Red List 2006 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population of this species is very large, and in some regions it is very common.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There has been serious deforestation across its range, but recent measures seem to have stabilized the situation, and the future decline of the species will probably not be as serious as its past decline. Locally, non-targeted hunting is a minor threat, as is trapping.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Fights between adults, especially males, are a common source of injuries and occasionally death, and infants and juveniles also often fall victim to frustrated adults. Nevertheless, by far the most serious threat to the Tibetan macaque comes from humans. Habitat destruction, herbicide and pesticide poisoning, human transmitted diseases and illegal poaching have all had a negative impact on the survival of this species (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed under CITES Appendix II. There is little information available regarding its status in protected areas, although L. Yongcheng (pers. comm.) reports that it is found in at least 60 nature reserves within its range in China. It is almost never seen in captivity outside of Asia, and is quite rare in zoos even there (M. Richardson pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Tibetan macaques are protected by Chinese law (5), and are listed on Appendix II of CITES, limiting international trade in the species (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tibetan macaque

The Tibetan macaque (Macaca thibetana), also known as the Chinese stump-tailed macaque or Milne-Edwards' macaque, is found from eastern Tibet east to Guangdong and north to Shaanxi in China and has recently been reported from north-eastern India.[3] This species lives in subtropical forests (mixed deciduous to evergreen) at altitude that range from 800 to 2500 meters. The Tibetan macaque has a long dense brown fur with whiskers but a hairless face. The infants have silver and black fur that changes to its adult color at the age of two. Its diet consists mostly of fruit, but it will also consume seeds, leaves, berries and flowers as well as invertebrates. It is a gregarious animal and lives in multi-male and multi-female groups. The life span of the Tibetan macaque is over 20 years.

There are four recognized subspecies of this macaque:

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 164. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100566. 
  2. ^ Yongcheng, L. & Richardson, M. (2008). Macaca thibetana. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ Kumar, S., Mishra, C., & Sinha, A. 2005. Discovery of the Tibetan macaque Macaca thibetana in Arunachal Pradesh, India. Current Science 88(9) p. 1387. PDF
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Tibetan Macaque

The Tibetan Macaque (Macaca thibetana), also known as the Chinese Stump-tailed Macaque or Milne-Edwards' Macaque, is found from eastern Tibet east to Guangdong and north to Shaanxi in China and has recently been reported from north-eastern India.[3] This species lives in subtropical forests (mixed deciduous to evergreen) at altitude that range from 800 to 2500 meters. The Tibetan Macaque has a long dense brown fur with whiskers but a hairless face. The infants have silver and black fur that changes to its adult color at the age of two. Its diet consists mostly of fruit, but it will also consume seeds, leaves, berries and flowers as well as invertebrates. It is a gregarious animal and lives in multi-male and multi-female groups. The life span of the Tibetan Macaque is over 20 years.

There are four recognized subspecies of this macaque:

References

  1. ^ Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 164. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100566. 
  2. ^ Yongcheng, L. & Richardson, M. (2008). Macaca thibetana. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ Kumar, S., Mishra, C., & Sinha, A. 2005. Discovery of the Tibetan macaque Macaca thibetana in Arunachal Pradesh, India. Current Science 88(9) p. 1387. PDF
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!