Overview

Brief Summary

Taxonomy

Morphology
Barbary macaques are yellowish gray to grayish brown with paler underparts and a dark pinkish face (MacDonald 1985).The Barbary macaque has an extremely short vestigial tail. This tail reduction is a uniquely derived feature of the Barbary macaque and resulted in the popular misnomer of Barbary Ape.

Evolution
Morphological evidence suggests an early divergence of M. sylvanus from other extant macaques. Barbary macaques lack some morphological specialisations of other macaques (Groves 1989). Adult males have ischial callosities that fuse across the midline, unlike other macaques that have lost this condition (Groves 1989). High-resolution restriction site mapping of the mitochondrial ribosomal genes confirm that Macaca sylvanus is the sister clade to all Asian macaques (Morales and Melnick 1998).The ancestral macaque stock originated in Africa ca. 7-6 million years ago (Ma) and dispersed into to Eurasia ca. 6–5 Ma (Fooden 2007). Species that are closely related to M. sylvanus have been recorded in the European fossil record dating from the Middle Pliocene to the Middle Pleistocene (Gentili et al 1998). Macaques became extinct in Europe during the Pleistocene. The Gibraltar colony of Barbary macaques was reintroduced, probably in historic times.The divergence of the Moroccan population and the two main Algerian subpopulations can be dated to approximately 1.6 million years ago, assuming an origin of 5.5 million years ago for the genus Macaca. The distinction between Moroccan and Algerian haplotypes provides a basis for determining of the origin of the Gibraltar macaques. The Gibraltar sample includes both Algerian and Moroccan haplotypes, implying a dual origin of the founding females (Modolo et al 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Barbary macaques have a diet of fruit, young leaves, bark, roots and occasionally invertebrates. During the winter when food is scarce they forage for bark and evergreen needles (4). As social animals they live in troops of 12 to 60 (average approximately 24) individuals with females forming the core of the troop. Where there is abundant food and little human interference the home range sizes are smaller (2). Males will establish a hierarchy based on the outcome of competitive interactions, though ranking orders change regularly as males age, leave or enter the troop. The strongest and most successful males become dominant and generally do most of the mating, although all males in the troop may potentially mate with females (5). Reproduction may be somewhat seasonal, with births corresponding to highly productive seasons. Females give birth to a single offspring every one or two years, after a gestation of about five months, and twins are rare. The young are weaned after 12 months, and reach sexual maturity at 2.5 and 4 years old in females and 4.5 and 7 years old in males (5). The mating system of this species is fascinating. Females mate with all male members of the troop, so males can never be sure of paternity (4). This promiscuous behaviour encourages males to look after one, or some of the young troop members, spending time grooming, protecting and playing with them, despite not knowing if they are their offspring (5). This may seem like an unselfish act, protecting another macaque's offspring, but because all males in the troop do the same, it is the only way the males can ensure that their offspring will survive. Young females remain within their natal group once they attain sexual maturity, whereas males disperse from their natal group. Becoming accepted into another group is, therefore, critical in the reproductive success of any individual male (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Introduction

Barbary macaques, Macaca sylvanus, are large Old World monkeys found in mountainous regions of Algeria and Morocco and on Gibraltar.The population of Barbary macaques is declining and they are becoming a threatened species. Numbers are falling because the Barbary macaques are losing their habitat to human activity such as logging and overgrazing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

This species' alternative names, the Barbary ape or rock ape are misleading; for though it lacks a tail, as do apes, it is in fact a macaque, belonging to the old world monkeys (4). A large monkey with a silky grey to brown or yellow coat and a dark pink face. Males are somewhat larger than females, though in appearance they are very similar. Like all macaques, they have powerful jaws, long canine teeth, and cheek pouches beside the lower teeth that extend down the sides of the neck (5). These pouches are used to store food when foraging and are able to hold a volume of food as large as the stomach (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Size
Barbary macaques show moderate sexual dimorphism in body size and the larger males reach attain sexual maturity and adult body weight later than females.Average body weight in wild-collected adults is 9.9kg in females and 14.5kg in males (Fooden, 2007).

Life expectancy
Lifespans of up to is 30 years have been recorded a semi free-ranging population (Fooden, 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Barbary Macaque is the only surviving primate in Africa north of the Sahara desert, the only native species of primate to occur in Europe, and the only member of the genus Macaca that can be found outside Asia. The species was once an inhabitant of parts of Europe and all of North Africa (Delson 1980; Camperio Ciani 1986). In historic times it was it was widespread throughout north Africa from Libya to Morocco, but its current distribution is limited to small relict patches of forest and scrub in Algeria and Morocco (Fa 1984; Camperio Ciani 1986; Menard and Vallet 1993; Scheffrahn et al. 1993). A semi wild population lives in Gibraltar, which is a long established introduced population (Fa 1981; von Starck 1990; Hodges and Cortes 2006).

In Morocco, M. sylvanus can still be found in the Rif mountains (northern Morocco) and the Middle and High Atlas mountains (central and southern Morocco). In Algeria, it is found in the Tellian Atlas (Petite Kabylie and Grande Kabylie mountains, and an isolated population in the Chréa National Park) (northern Algeria). More specifically, in Morocco the High Atlas populations (two anciently separated populations) are found in the Bou Tferda valley to Demnat region and around the Ourika Valley, respectively; the Rif populations are primarily on Mounts Lakraa, Tissouka, Tazoute, Bouhacham, and Djebel Moussa. In Algeria, from west to east, Barbary Macaque populations are distributed as follows: (a) Chiffa gorges (Chréa National Park); (b) Djurdjura forests and rocky cliffs (Djurdjura National Park, Grande-Kabylie); (c) Akfadou forests, including a small ‘subpopulation’ recently settled in degraded forests and maquis, near El-Kseur (Grande-Kabylie and Petite-Kabylie); (d) Cap Carbon, Aiguades and Pic des Singes (Gouraya National Park; Béjaïa, Petite-Kabylie); (e) Chaabet-el-Akhra Gorges (Kherrata; Béjaïa, Petite-Kabylie); (f) ‘Massif des Babors’ forests (Sétif and Béjaïa, Petite-Kabylie); (g) Guerrouch forest (Taza National Park; Jijel, Petite-Kabylie). Additionally, a Barbary Macaque population might still occur in Djebel Bouzegza (Boumerdes, Grande-Kabylie) (F. Belbachir pers. comm. 2007).

The species occurs from sea level to 2,600 m (Cuzin 2003), but in Morocco at least it is most common at altitudes above 1,000 m (F. Cuzin pers. comm. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Macaca sylvanus inhabits Morocco, Algeria, and Gibraltar. The majority of M. sylvanus are found in the Middle and High Atlas mountains and in the Rif mountain regions of Morocco. A smaller population is located in the Tellian Atlas mountains of Algeria. Within the Atlas mountains, M. sylvanus is restricted to the Grand Kabylie mountains, the Petit Kabylie mountains, and the Chiffa Gorges. In Gibraltar, a population of about 200 are maintained by constant reintroduction of new animals. They are the only non-human primates in Europe.

Biogeographic Regions: palearctic (Native )

  • Deag, J. 1977. The status of the Barbary Macaque Macaca sylvanus in captivity and factors influencing its distribution in the wild. Pp. 268-285 in P of Monaco, G Bourne, eds. Primate Conservation. New York, York: Academic Press.
  • Mittermeier, R., A. Rylands. 2008. "Macaca sylvanus" (On-line). Accessed March 21, 2011 at http://www.iucnredlist.org/apps/redlist/details/12561/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution habitat

Distribution
Barbary macaques (Macaca sylvanus) are now restricted to isolated forest fragments in the Atlas and Rif Mountain ranges in Morocco and Algeria. The Moroccan and Algerian populations are separated by a gap of about 700km (Fooden 2007).The species was once more widely distributed in North Africa. A large and long-established semi-wild colony is present on Gibraltar.An 18th century document preserved in the British Museum notes that “a great quantity” of Barbary macaques was introduced into the British garrison in 1740 (Fooden 2007).The Barbary macaque is now the only species of the genus Macaca found outside Asia.

Habitat
Barbary macaques inhabit mid to high altitude mixed cedar and oak forest, and scrub and cliffs (MacDonald 1985).In Algeria monkey troops were observed living in non-deciduous cedar-green oak forest, deciduous oak forest and on rocky mountainous ridges lacking arboreal vegetation. Monkey densities were higher in cedar forest than in deciduous forest, and the ceder forest troop had a more balanced sex ratio and better survival of young animals. The mountain troop had an unstable aging population with low population density (Menart et al 1985).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This species is found in Algeria, Morocco, and Gibraltar (1). It is the only primate, apart from humans, to live in Europe and the only macaque to live outside of Asia (6) (7). Legend has it that as long as Barbary macaques exist in Gibraltar, the region will remain under British rule. Thus, following an epidemic in the 1900s wiping out the macaque population, local authorities re-introduced them from the African mainland and now protect a small population of about 160 individuals (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Barbary macaques are covered in thick fur that presumably helps protect them from cold temperatures. Body color ranges from yellowish-gray to darker grayish-brown. Their chests and stomachs are much lighter than the rest of their bodies while their faces are often dark pink. Barbary macaques have noticeably short tails, ranging from 1 to 2 cm long. Females average 450 mm from head to tail, weigh about 11 kg, and display estrus with large anogenital swellings. Males are larger, weighing 16 kg and range in length from 550 to 600 mm. Like all cercopithecids, Barbary macaques have large cheek pouches for carrying food. The dental formula of a Barbary macaque is I2/2, C1/1, P2/2, M3/3.

Range mass: 11 to 16 kg.

Range length: 450 to 600 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

  • Richardson, M. 2009. "Barbary macaque" (On-line). Accessed March 21, 2011 at http://www.arkive.org/barbary-macaque/macaca-sylvanus/#text=Description.
  • Taub, D. 1980. Female choice and mating strategies among wild Barbary macaques (Macaca sylvanus). Pp. 287-367 in D Lindburg, ed. The macaques: studies in ecology, behavior, and evolution. New York, NY: Van Nostrand Reinhold Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species shows a preference for high-altitude cedar forests, and is also found in oak forests, coastal scrub, and overgrazed rocky slopes with vestigial vegetation. It is confined to inaccessible rocky areas, gorges, and montane areas (from sea level up to approximately 3500 m) due to habitat use conflicts with humans in more favourable areas. All the areas occupied by the macaque are under growing pressure from human activity and habitat availability for M. sylvanus has decreased markedly in recent decades (Camperio Ciani et al. 2005, van Lavieren 2006).

In Algeria, occupied habitats include mixed cedar (Cedrus atlantica) and oak forests; humid zen oak (Quercus canariensis) and cork oak (Quercus suber) mixes; Algerian fir (Abies numidica), cedar and zen oak mixed forests; and gorges dominated by scrub vegetation (Taub 1977; F. Belbachir pers. comm. 2007). Moroccan habitats include high cedar forests (Cedrus atlantica), cedar/holm oak (Quercus ilex) mixtures, pure holm oak forests and cliffs and gorges dominated by scrub vegetation. The cedar/oak forests of the Middle Atlas region contain the largest remaining population of M. sylvanus, and are considered to be optimal habitat for the species (Camperio Ciani et al. 2001). In habitats with cedar, macaques can reach densities of 25-40 individuals per km2 or greater, whereas in habitats without cedar much lower densities of 5-7 individuals per km2 are reported (Fa 1984; Mehlman 1989). In all occupied habitats, there is a species of oak available (F. Cuzin pers. comm., 2007).

Its diet is primarily composed of cedar (Cedrus atlantica) and the oak (Quercus sp.), which make up over 50% of its total intake. It eats fruits (33% of its intake), tree leaves (16%), and other plant parts (24%).

M. sylvanus lives in social groups of up to 80 individuals of both sexes with a modal size of 40 individuals (Ménard 2002). Life span in the wild is known to be up to 22 years (Lindenfors 2002). Females reach sexual maturity between 3.5 and 4 years of age and males between 4.5 and 7 years of age. In the wild, average age at first birth is 5.3 years for females (Ménard and Vallet 1993, 1996; Lindenfors 2002), and the birth interval is 1.3 years (Taub 1974 in Fa 1984; Ménard and Vallet 1993, 1996).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Barbary macaques prefer habitats consisting of high altitude mountains, cliffs, and gorges. Although they prefer high altitude habitats, up to 2600 m, they can also be found at sea level. Their primary habitat is cedar forests, but they are also found in mixed forests of cedar and holm-cork oak, pure oak forests, shrubby rock outcrops along coasts, and occasionally in grasslands at low elevations. During the winter they are highly arboreal, but become more terrestrial during summer.

Range elevation: 0 to 2600 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest ; mountains

  • Rowe, N. 1996. The pictorial guide to the living primates. East Hampton, NY: Pogonias Press.
  • Fa, J. 1982. A survey of population and habitat of the barbary macaque (macaca sylavanus) l. in north morocco. Biological Conservation, 24/1: 45-66. Accessed March 11, 2011 at http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6V5X-48XKB20-HR&_user=10&_coverDate=09%2F30%2F1982&_rdoc=1&_fmt=high&_orig=gateway&_origin=gateway&_sort=d&_docanchor=&view=c&_searchStrId=1687891419&_rerunOrigin=google&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=616c1d36e5853222dec43f7f7e7abea4&searchtype=a.
  • Ménard, N., D. Vallet. 1997. Behavioral responses of Barbary macaques (Macaca sylvanus) to variations in environmental conditions in Algeri. American Journal of Primatology, 43/4: 285-304. Accessed March 12, 2011 at http://onlinelibrary.wiley.com/doi/10.1002/(SICI)1098-2345(1997)43:4%3C285::AID-AJP1%3E3.0.CO;2-T/abstract.
  • Taub, D. 1977. Geographic Distribution and Habitat Diversity of the Barbary Macaque Macaca sylvanus L.. Folio Primatologica, 27/2: 108-133. Accessed March 12, 2011 at http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Retrieve&list_uids=403111&dopt=abstractplus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

In North Africa, this macaque inhabits oak and cedar forests, preferring mid and high altitude forests as well as scrub forest and cliff habitats. The climate is hot and dry in the summer and cold and snowy in the summer (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Due to dramatic changes in climate in the mountains throughout the year, the diet of Barbary macaques changes seasonally. During spring, they eat various vegetation and feast on caterpillars that live in oak tress. By summer, fruits are plentiful along with other small seeds, roots, and fungi. Barbary macaques become terrestrial foragers during spring and summer to acquire these foods. Occasionally, they also eat small vertebrates such as frogs and tadpoles. Oaks produce acorns during fall, which Barbary macaques feed on during this time. During periods of particularly high mast production, macaques may subsist on acorns for more than half the year. During winter, ground forage becomes limited and Barbary macaques become arboreal again. Arboreal forage during winter consists of the leaves, seeds, and bark of evergreens.

Animal Foods: amphibians; insects

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Other Foods: fungus

Primary Diet: omnivore

  • Melhman, P. 1988. Food resources of the wild Barbary macaque (Macaca sylvanus) in high-altitude fir forest, Ghomaran Rif, Morocco. Journal of Zoology, 214/3: 469-490. Accessed March 22, 2011 at http://onlinelibrary.wiley.com.proxy.lib.umich.edu/doi/10.1111/j.1469-7998.1988.tb03754.x/abstract.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Macaca sylvanus is omnivorous and consumes insects, fruit, and other plant materials. This species is an important seed disperser in the mountains where they reside. They are also an important prey item for eagles, golden jackals, and red foxes. Macaca sylvanus is host to a number of ecto- and endoparasites including flatworms, roundworms, sucking lice, parasitic Protozoa (Giardia), and the viruses that cause canine distemper (Paramyxoviridae) and encephalomyocarditis (Picornaviridae), which can sometimes be fatal in M. sylvanus.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Canelli, E., A. Luppi, A. Lavazza, D. Lelli, E. Sozzi, A. Moreno-Martin, D. Gelmetti, E. Pascotto, C. Sandri, W. Magnone, P. Cordioli. 2010. Encephalomyocarditis virus infection in an Italian zoo. Virology Journal, 7/64: 1-7.
  • Cohn, D., V. Smith, M. Pizzaro, L. Jones-Engel, G. Engel, A. Fuentes, E. Shaw, J. Cortes. 2007. Pediculosis in Macaca sylvanus of Gibraltar. Veterinary Parasitology, 145/1-2: 116-119.
  • Martin, L. 1950. Susceptibility of monkeys (Macaca sylvanus) to distemper. Bull. -Acad. vet. Fr., 23: 457-462.
  • San Román, S., S. Horsley. 2009. "Deforestation spells doom for Barbary Macaque" (On-line). Accessed March 21, 2011 at http://www.iucn.org/about/union/secretariat/offices/iucnmed/communication/press_releases/?3556/Deforestation-spells-doom-for-Barbary-Macaque.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The primary predator of Barbary macaques are large eagles that patrol the mountains for prey. At least one troop member is constantly vigilant for danger. Barbary macaques give a special high-frequency "ah-ah" alarm call when eagles are spotted. Upon hearing this call, they quickly escape to the lower canopy to hide. Less common predators consist of golden jackals and red foxes.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Macaca sylvanus is prey of:
Strigiformes
Vulpes
Homo sapiens
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Barbary macaques display a variety of facial expressions to show emotions. Females show rounded-mouth threats towards other females as a sign of aggression and dominance. Bared teeth show submission. Lip-smacking and teeth-chattering are signs of appeasement which are often directed at a dominant individual or towards infants. Barbary macaques also display relaxed, open-mouthed, play faces which are thought express happiness.

Sounds is a crucial part of communication in primates. Barbary macaques scream and grunt at trespassing troops. They also use a loud, high-pitched "ah-ah" call to warn troop members of potential danger. Mating calls from females during copulation have been shown to increase the likelihood of ejaculation in males. Barbary macaques are capable of recognizing individuals by calls, and mothers can recognize their infants by their cries. Young cry a string of high-pitched calls at dusk, presumably to find their mother in sleeping clusters. Troops are familiar with the vocalizations of neighboring troops as well. Studies have shown calls are learned through experience and different social groups may use different dialects.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

  • Fischer, J. 1998. Barbary macaques categorize shrill barks into two call types. Animal Behaviour, 55/4: 799-807. Accessed March 12, 2011 at http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6W9W-45KKVDP-3G&_user=10&_coverDate=04%2F30%2F1998&_rdoc=1&_fmt=high&_orig=gateway&_origin=gateway&_sort=d&_docanchor=&view=c&_searchStrId=1676080945&_rerunOrigin=google&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=7aba982828d392f470103e7aded92de5&searchtype=a.
  • Fischer, J., K. Hammerschmidt, D. Todt. 1998. Local variation in Barbary macaque shrill barks. Animal Behaviour, 56/3: 623-629. Accessed March 12, 2011 at http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6W9W-45KKV82-F&_user=10&_coverDate=09%2F30%2F1998&_rdoc=1&_fmt=high&_orig=gateway&_origin=gateway&_sort=d&_docanchor=&view=c&_searchStrId=1676055756&_rerunOrigin=scholar.google&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=91c2b6b5bbbf9e9e83048b13220a5b0c&searchtype=a.
  • Hammerschmidt, K., V. Ansorge, J. Fischer, D. Todt. 1994. Dusk calling in barbary macaques (Macaca sylvanus): Demand for social shelter. American Journal of Primatology, 32/4: 277-289. Accessed March 12, 2011 at http://onlinelibrary.wiley.com/doi/10.1002/ajp.1350320405/abstract.
  • Hammerschmidt, K., J. Fischer. 1998. Maternal discrimination of offspring vocalizations in Barbary macaques (Macaca sylvanus). Primates, 39/2: 231-236. Accessed March 12, 2011 at http://www.springerlink.com/content/a5046442mk333r13/.
  • Hammerschmidt, K., D. Todt. 1995. Individual differences in vocalisations of young Barbary macaques (Macaca sylvanus): a multi-parametric analysis to identify critical cues in acoustic signalling. Behaviour, 132/5: 381-399. Accessed March 12, 2011 at http://www.jstor.org/pss/4535271.
  • Mehlman, P. 1982. Aspects of the ecology and conservation of the Barbary macaque in the fir forest habitat of the Moroccan Rif mountains. Pp. 165-199 in J Fa, ed. The Barbary macaque. New York: Plenum Publishing Corporation.
  • Preuschoft, S. 1992. “Laughter” and “smile” in Barbary macaques (Macaca sylvanus). Ethology, 91/3: 220-236. Accessed March 22, 2011 at http://onlinelibrary.wiley.com/doi/10.1111/j.1439-0310.1992.tb00864.x/abstract.
  • Small, M. 1989. Alloparental behaviour in Barbary macaques, Macaca sylvanus. Animal Behaviour, 39/2: 297-306. Accessed March 12, 2011 at http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6W9W-4JT84SW-C&_user=10&_coverDate=02%2F28%2F1990&_rdoc=1&_fmt=high&_orig=gateway&_origin=gateway&_sort=d&_docanchor=&view=c&_searchStrId=1676024445&_rerunOrigin=scholar.google&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=bce48ba276f23c44e98ad332394d709e&searchtype=a.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Barbary macaques are diurnal. They are both aroreal and terrestrial, foraging both in the trees and on the ground. Locomotion is quadrupedal.Barbary macaques live in multimale-multifemale groups with matrilineal hierarchies, which represent the core of the social group (Thierry 2007). The size of natural groups varies from seven to 88 individuals, with an average of 27 individuals (Fooden 2007). Large groups may fission into smaller groups, with matrilines remaining together. Neighbouring groups have overlapping home rangesBarbary macaques sleep in clusters of 2-3 animals. Adult females sleep with their infants and juvenile daughters, whereas juvenile males sleep in clusters together or with adult males (Ansorge et al 1992).Communication and maintenance of social bonds involves grooming, mating and the use of diverse facial and visual expressions. The vocal repertoire of Barbary macaques incorporates screams, shrill barks, geckers, low-frequency pants and grunts, with gradation within and between call types (Fischer and Hammerschmidt, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Barbary macaques typically live 22 years in the wild. Males rarely live more than 25 years, and females appear to live slightly longer than males. Infants have a 10% mortality rate in the wild. No data has been reported for captive Barbary macaques.

Average lifespan

Status: wild:
22 years.

Average lifespan

Status: wild:
22 years.

Average lifespan

Status: wild:
22.0 years.

Average lifespan

Status: wild:
20.0 years.

Average lifespan

Sex: male

Status: captivity:
17.0 years.

  • Kuester, J., A. Paul. 1999. Male migration in Barbary macaques (Macaca sylvanus) at Affenberg Salem. International Journal of Primatology, 20/1: 85-106. Accessed March 12, 2011 at http://www.springerlink.com/content/u6w6768r181780g3/.
  • Mehlman, P. 1989. Comparative Density, Demography, and Ranging Behavior of Barbary Macaques (Macaca sylvanus) in Marginal and Prime Conifer Habitats. International Journal of Primatology, 10/4: 269-292.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29.1 years (captivity) Observations: These animals have been reported to live up to 29.1 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Barbary macaques are polygynandrous, as males and females have multiple mates. Females display estrus with large anogenital swellings. Females initiate and terminate matings and compete with each other for mates by interrupting copulation. Male rank has little effect which individuals females choose to mate with. By the time estrus is complete, each female has mated with all or nearly all males in her troop. Often, females continue to copulate even when conception is impossible. At the end of breeding season, the combined number of copulations by all the females in a troop can number in the hundreds. Female promiscuity is thought to mask the true identity of an infant's father resulting in paternal support from more than one male.

Although male Barbary macaques have little influence over who they mate with, dominant individuals tend to mate more often than subordinates and tend to mate more with dominant females. Despite competition for females, male Barbary macaques show high tolerance for each other. They compensate for intense sperm competition by having large testical-size to body-size ratios. Older males have more breeding success than younger individuals. Males use three mating strategies when attracting females. Individuals using "proximity-possession" remain in close proximity to a female, which usually ensures one's opportunity to mate. Others use the "pertinacious strategy", where they closely follow a female until they are noticed and allowed to mate. Lastly, lowest ranking males use a "peripheralize and attract strategy", where they stay far away from the female, but shake branches or carry other infants in full view of the female in order to attract her attention. Successful males then mate with a female, only mounting her once for a short period of time before both part ways.

Barbary macaques are very social. Once infants are born, the entire troop takes part in caring for infants (i.e., cooperative breeding).

Mating System: polygynandrous (promiscuous) ; cooperative breeder

Mating season of Barbary macaques begins in November and ends in December. Gestation last for 164.2 days, on average, and one offspring is usually born between April and June. Barbary macaques typically reach sexual maturity around 46 months of age, regardless of gender. Females remain in estrus for about 1 month and have their first offspring around 5 years of age. Interbirth interval ranges from 13 to 36 months, and the first offspring is generally smaller than subsequent offspring. Females reach menopause during the last 5 years of their lives, though estrus may continue for a few more years. Females often continue to copulate, even when conception is no longer possible.

Although no formal research has been conducted on Barbary macaque infants, in general, newborn primates are altricial and require intense care. Female rhesus macaque, a close relative to Barbary macaques, stay in close contact with their newborns for the first 3 months after birth. In young macaques, weight is often used as a substitute for age. Rhesus macaques are weaned between 1,300 to 1,400 grams. Depending on environmental conditions and resource abundance, infants can be weaned between 200 to 362 days. Average birth weight for Barbary macaques is 450 g.

Breeding interval: Barbary macaques breed once a year.

Breeding season: November to December

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 158 to 170 days.

Average gestation period: 164.2 days.

Average birth mass: 450 g.

Average age at sexual or reproductive maturity (female): 46 months.

Average age at sexual or reproductive maturity (male): 46 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 450 g.

Average number of offspring: 1.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
2007 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1399 days.

Barbary macaques live in matrilineal societies with youngest daughter ascendancy, thus newborn females outrank everyone else in the immediate family except their mothers. Alloparenting is common among Barbary macaques. The entire troop shows interest in newborns and displays friendly teeth-chattering or lip-smacking towards infants. Unlike many primates, Barbary macaques actively take care of unweaned infants more than weaned infants. Females often help "baby-sit" infants of other females. Infants of closely related females and of the highest ranking female usually receive the most attention. Nulliparous females (i.e., females without offspring) engage in infant-carrying more than other females, but this has not been linked to an increase in the survival of their own infants. Females who have recently lost infants are also more likely to carry others' infants. Research suggests that extensive infant handling may allow females to rise in rank. Infants receiving extra care do not experience higher survival rates than those who do not receive extra care.

Due to the promiscuous mating system of Barbary macaques, males have no way of knowing which infant is theirs. As a result, they provide paternal care to infants in their troop. For example, adult males group around infants to protect them from approaching predators. In general, males appear to show preference to male infants. Young-adult males tend to develop strong bonds with male infants, and older adult males prefer to take care of any infants from high-ranking females. Females appear to show mating preference to males that provide the most paternal care to their offspring.

Parental Investment: altricial ; male parental care ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Protecting: Male); post-independence association with parents; extended period of juvenile learning; maternal position in the dominance hierarchy affects status of young

  • Rowe, N. 1996. The pictorial guide to the living primates. East Hampton, NY: Pogonias Press.
  • Bowman, J., P. Lee. 2005. Growth and threshold weaning weights among captive Rhesus macaques. American Journal of Physical Anthropology, 96/2: 159-175. Accessed March 25, 2011 at http://onlinelibrary.wiley.com/doi/10.1002/ajpa.1330960205/pdf.
  • Brauch, K., D. Pfeffrle, K. Hodges, U. Möhle, J. Fischer, M. Heistermann. 2007. Female sexual behavior and sexual swelling size as potential cues for males to discern the female fertile phase in free-ranging Barbary macaques (Macaca sylvanus) of Gibraltar. Hormones and Behavior, 52/3: 375-383. Accessed March 12, 2011 at http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WGC-4P00866-1&_user=10&_coverDate=09%2F30%2F2007&_rdoc=1&_fmt=high&_orig=gateway&_origin=gateway&_sort=d&_docanchor=&view=c&_searchStrId=1676019347&_rerunOrigin=scholar.google&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=33faeafd6ba72e77861509a27bc4a343&searchtype=a.
  • Chapais, B. 2004. How kinship generates dominance structures: a comparative perspective. Pp. 186-187 in B Thierry, M Singh, W Kaumanns, eds. Macaque societies: a model for the study of social organization. United Kingdom: Cambridge University Press.
  • Kuester, J., A. Paul. 1996. Female-female competition and male mate choice in Barbary macaques (Macaca sylvanus). Behaviour, 133/9: 763-790. Accessed March 12, 2011 at http://www.jstor.org/pss/4535393.
  • Kuester, J., A. Paul. 1986. Male-infant relationships in semifree-ranging Barbary macaques (Macaca sylvanus) of affenberg salem/FRG: Testing the “male care” hypothesis. American Journal of Primatology, 10/4: 315-327. Accessed March 21, 2011 at http://onlinelibrary.wiley.com/doi/10.1002/ajp.1350100404/abstract.
  • Ménard, N., F. von Segesser, W. Scheffrahn, J. Pastorini, D. Vallet, B. Gaci, R. Martin, A. Gautier-Hion. 2001. Is male–infant caretaking related to paternity and/or mating activities in wild Barbary macaques (Macaca sylvanus)?. Comptes Rendus de l'Académie des Sciences - Series III - Sciences de la Vie, 324/7: 601-610. Accessed March 12, 2011 at http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6VJ5-45RFGG5-3&_user=10&_coverDate=07%2F31%2F2001&_rdoc=1&_fmt=high&_orig=gateway&_origin=gateway&_sort=d&_docanchor=&view=c&_searchStrId=1676017514&_rerunOrigin=scholar.google&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=d3f4826d7872ecdc6ad91ff9cc2c438b&searchtype=a.
  • Paul, A., J. Kuester. 1996. Infant handling by female Barbary macaques ( Macaca sylvanus ) at Affenberg Salem: testing functional and evolutionary hypotheses. Behavioral Ecology and Sociobiology, 39/2: 133-145. Accessed March 12, 2011 at http://www.springerlink.com/content/mhv8g38u0k9dpmmp/.
  • Paul, A., J. Kuester, D. Podzuweit. 1993. Reproductive senescence and terminal investment in female Barbary macaques (Macaca sylvanus) at Salem. Fologia Primatologica, 14/1: 105-124. Accessed March 12, 2011 at http://www.springerlink.com/content/u327h60207n503m2/.
  • Paul, A., J. Kuester, A. Timme, J. Arnemann. 1993. The association between rank, mating effort, and reproductive success in male Barbary macaques (Macaca sylvanus). Primates, 34/9: 491-502. Accessed March 12, 2011 at http://www.springerlink.com/content/gt44456595346l77/.
  • Pfefferle, D., K. Brauch, M. Heistermann, J. Hodges, J. Fischer. 2007. Female Barbary macaque (Macaca sylvanus) copulation calls do not reveal the fertile phase but influence mating outcome. Proceedings of the Royal Society, 275: 571-578. Accessed March 12, 2011 at http://rspb.royalsocietypublishing.org/content/275/1634/571.full.
  • Small, M. 1990. Promsicuity in barbary macaques (Macaca sylvanus). American Journal of Primatology, 20/4: 267-282. Accessed March 12, 2011 at http://onlinelibrary.wiley.com/doi/10.1002/ajp.1350200403/abstract.
  • Soltis, J. 2004. Mating systems. Pp. 137-150 in B Thierry, M Singh, W Kaumanns, eds. Macaque societies: a model for the study of social organization. United Kingdom: Cambridge University Press.
  • Taub, D. 1980. Female choice and mating strategies among wild Barbary macaques (Macaca sylvanus). Pp. 287-367 in D Lindburg, ed. The macaques: studies in ecology, behavior, and evolution. New York, NY: Van Nostrand Reinhold Company.
  • Taub, D. 1977. Geographic Distribution and Habitat Diversity of the Barbary Macaque Macaca sylvanus L.. Folio Primatologica, 27/2: 108-133. Accessed March 12, 2011 at http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Retrieve&list_uids=403111&dopt=abstractplus.
  • Thierry, B. 2004. Social epigenesis. Pp. 267-288 in B Thierry, M Singh, W Kaumanns, eds. Macaque societies: a model for the study of social organization. United Kingdom: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macaca sylvanus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0558-06|NC_002764|Macaca sylvanus| AATCGTTGACTCTTTTCAACAAACCATAAAGACATTGGAACCCTATATTTACTATTTGGCGCATGAGCTGGAATCATAGGCACAGCCCTA---AGCCTCCTCATTCGAGCTGAGCTCGGTCAACCTGGCAACCTACTGGGTAAT---GACCACATCTACAACGTCGTCGTAACGGCCCATGCATTTATTATAATCTTCTTTACAGTCATACCTATTATAATTGGAGGCTTCGGGAACTGACTGGTGCCTTTAATA---ATCGGAGCACCCGACATAGCATTTCCCCGTCTAAATAACATAAGCTTCTGACATCTTCCTCCTTCTTTCCTACTACTAATGGCATCAACAGTAGTAGAAGCTGGCGTTGGAACAGGTTGGACAGTATACCCTCCTTTAGCAGGAAACTTTTCTCACCCAGGAGCTTCCGTGGATTTAATT---ATCTTCTCCCTTCACCTGGCAGGTATCTCCTCTATCTTAGGAGCCATTAACTTTATTACCACCATCATCAACATAAAACCCCCCGCAATATCCCAATACCAAACCCCCTTATTTGTCTGATCAATCTTAATCACAGCAATCCTCCTACTCCTGTCTCTACCAGTCCTGGCCGCC---GGCATTACCATACTGCTAACAGATCGCAATCTCAACACCACTTTCTTTGATCCCGTTGGAGGAGGAGACCCTATCCTATATCAACACCTGTTTTGATTCTTCGGTCACCCCGAAGTCTACATTCTCATTCTCCCCGGTTTTGGGGTAGTCTCCCACATTGTAGCCTATTACTCTGGAAAAAAA---GAACCATTTGGGTATATGGGCATAGTTTGAGCCATAGTATCAATCGGATTTTTGGGTTTTATTGTATGAGCCCATCACATATTTACAGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macaca sylvanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bcd+4bcd

Version
3.1

Year Assessed
2008

Assessor/s
Butynski, T.M., Cortes, J., Waters, S., Fa, J., Hobbelink, M.E., van Lavieren, E., Belbachir, F., Cuzin, F., de Smet, K., Mouna, M., de Iongh, H., Menard, N. & Camperio-Ciani, A.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
Overall, the population of this species is estimated to have declined at a rate exceeding 50% over the last 3 generations (24 years). This decline is expected to continue in the future. Consequently it qualifies as Endangered. The status of this species varies in different parts of its range.

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Barbary macaques are listed as endangered on teh IUCN's Red List of Threatened Species. In Morocco and Algeria they are a federally protected species, but are still in danger of local extinction. Their greatest threat is habitat loss, predominantly from logging. As a result, macaques are pushed farther up mountains into nutrient poor areas where survival is more difficult. Resource competition with domestic goats has become an increasing problem as well. Recently, Barbary macaques have changed their feeding patterns to incorporate more bark and flowers so they can survive. Minor threats include trapping, illegal poaching, and death by herding dogs. About 300 infants are taken out of Morocco annually for pet trade. Barbary macaques are listed under Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES).

CITES: appendix ii

IUCN Red List of Threatened Species: endangered

  • Ciani, A., L. Palentini, M. Arahou, L. Martinoli, C. Capiluppi, M. Mouna. 2005. Population decline of Macaca sylvanus in the middle atlas of Morocco. Biological Conservation, 121/4: 635-641. Accessed March 12, 2011 at http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6V5X-4D2FKRH-2&_user=10&_coverDate=02%2F01%2F2005&_rdoc=1&_fmt=high&_orig=gateway&_origin=gateway&_sort=d&_docanchor=&view=c&_searchStrId=1676051680&_rerunOrigin=scholar.google&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=22434dfaf404fb662e256c75fab313a3&searchtype=a.
  • van Lavieren, E., S. Wich. 2010. Decline of the Endangered Barbary macaque Macaca sylvanus in the cedar forest of the Middle Atlas Mountains, Morocco. Oryx, 44: 133-138. Accessed March 12, 2011 at http://journals.cambridge.org.proxy.lib.umich.edu/action/displayAbstract?fromPage=online&aid=6829396.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Barbary macaque is now threatened.A major cause of population decline in Morocco and Algeria is human-caused habitat degradation and the loss of prime habitat as a result of logging and overgrazing (Camperio Ciani et al 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1), and listed on Appendix II on CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In 1999 the total number of remaining macaques was estimated at around 15,000 individuals (Von Segesser et al. 1999), although this estimate was based on incomplete data. The Moroccan population was more recently estimated to be 6,000-10,000 individuals (Ross 2004), whereas in 1975 it was about 17,000 (Taub 1975). In Algeria, the population was estimated at 5,500 30 years ago (Taub 1977) but may currently be less, although exact numbers are unknown (Hodges and Cortes 2006). On Gibraltar, the population has been maintained at c.200 individuals in recent years (Hodges and Cortes 2006).

According to Moroccan authorities the number of macaques has increased over the last decade (van Lavieren 2006). However, a number of detailed surveys have documented marked declines in population density, along with losses of a number of sites (Von Segesser et al. 1999; Camperio Ciani et al. 2005; van Lavieren 2006). The remaining subpopulations in the Rif mountains and High Atlas mountains of Morocco are fragmented and sometimes small. Fourteen isolated populations were identified in the High Atlas (Cuzin 2003). Algerian subpopulations are also fragmented (Mehlman 1989; Fa 1984; Von Segesser et al. 1999). In 1999, just seven widely separated isolated populations existed, whereas 35 years ago they were found in at least six additional localities in Algeria (Von Segesser et al. 1999). The remaining isolated populations are now completely separated by distances of 50-100 km, with no corridors. The only area where M. sylvanus is thought to occur in relative abundance is the cedar forest area of the central Middle Atlas, which represents the largest refuge of the North African forest ecosystem. In the 1980s it was estimated that 65-75% of the world's remaining population of Macaca sylvanus lived in this area (Camperio Ciani 1986). The populations in the Middle Atlas outside the central region were found to be much lower in density (Taub 1975). The central region of the Middle Atlas thus has a crucial role in the survival of the species. In the mid-1970s, population densities in the central Middle Atlas cedar forest were variously estimated at 60-70 individuals per km2 (Deag 1974) or 43 per km2 (Taub 1975). Subsequent studies showed that the population density in this region declined from 44 to 25 individuals per km2 over the last two decades of the 20th century (Camperio Ciani et al. 1999). In 2005, surveys in the Middle Atlas showed an average density of 15 to 20 individuals per km2 (van Lavieren 2006), in some areas dropping to an average density of 7-10 individuals per km2 (Camperio Ciani et al. 2005). Surveys conducted in 2006-2007 show that some habitat fragments contained only one or a few small groups. The population density in these fragments was little more than 0 individuals per km2 and local extinction appears imminent (N. Ménard pers. comm. 2008).

These data indicate that, in the central Middle Atlas (the global stronghold of the species), average population density has declined by c.50-80% over the last 30 years. Because of political unrest, many other macaque populations have not been censused since 1990 (K. de Smet pers. comm. 2007), so the population trend in these areas cannot be quantified but a declining trend is suspected.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The main threat to this species is habitat loss due to intensive logging, charcoal-burning, firewood-collecting, and land clearance for agriculture at lower altitudes. Habitat degradation resulting from overgrazing by livestock (a problem which is exacerbated by drought) is particularly likely to affect the long-term future of this species. Illegal live trade is also a serious problem. Additional threats include persecution, predation by feral dogs, inappropriate artificial feeding with sweet or salty foods by tourists and local inhabitants, and pollution of the wadis (rivers) associated with forests (E. van Lavieren pers. comm. 2006, F. Belbachir pers. comm. 2007). The shooting of monkeys as a result of crop raiding and cedar bark stripping was reported by Deag (1977), but the current extent of this activity is unknown. Conflicts with local people have been reported in Algeria, as a result of crop-raiding by macaques (e.g., villages in Djurdjura National Park in the Grande-Kabylie region: F. Belbachir pers. comm. 2007). The importance of different threats varies in different parts of the species' range; it is difficult to generalize.

The destruction and degradation of the macaque’s forest habitat is the most serious threat to the species. Severe habitat loss, fragmentation and degradation have been caused by domestic and industrial consumption of wood, use of fire, clearing for cultivation and overgrazing by sheep and goat herds (Taub 1977, Fa 1984, Camperio Ciani 1986, Menard and Vallet, 1993). This is exacerbated by poor forestry management (often Cedrus atlanticus is favoured and efforts are made to reduce Quercus ilex, but the latter is a crucial resource for macaques: Ménard and Vallet, 1986, 1997).). Additionally, in recent years shepherds have increasingly settled near water sources. As shepherd tribes move into the forest, they often enclose open water sources with cement wells so they can extract water for their herds. As a result, macaques and other wildlife have been excluded from water sources in areas where it was previously accessible to them (Camperio Ciani et al. 2003).

Live trade is also a significant threat to the wild M. sylvanus population. Most of the specimens taken from the wild are for the international pet trade. In comparison with the international trade, offtake for local purposes is relatively low, although M. sylvanus are kept fairly frequently as pets in Morocco (van Lavieren 2004) and local commercial use (remunerated photography in tourist areas and restaurants) has been reported in Algeria (F. Belbachir pers. comm. 2007). M. sylvanus seems to be rarely used for food, except for some old reports in Algeria (Deag 1977). Reports of capture for the international pet trade date back to 1977 (Deag 1977), and since then the trade has increased markedly (van Lavieren 2004). Sanctuaries and zoos in Europe have become overstocked with Barbary Macaque infants offered to them by authorities and ex-owners, most infants coming straight from the wild (van Lavieren 2004). Infant M. sylvanus are offered openly and covertly for sale on markets all over Morocco, and prices of up to 200 Euro per animal have been recorded (van Lavieren 2004). Prices of about 100 Euros per animal have been recorded in Algeria, with Chaabet-el-Akhra gorges (Béjaïa) and Yakouren (Akfadou) being critical locations where illegal trade occur (F. Belbachir pers. comm. 2007). It is estimated that up to 300 infants are taken annually from the Moroccan habitats (van Lavieren 2004). The maximum sustainable offtake of macaques in the Central Middle Atlas region has been estimated at between 200 and 250 individuals per year (van Lavieren 2004). If the estimate of 300 macaques taken annually from the wild is correct, then the offtake exceeds sustainability by up to 50% per year in this population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This species is threatened by habitat loss from logging and human settlements, as well as hunting (8). In Algeria forest fires and livestock grazing are additional problems, and some young animals are captured as pets. In Morocco the problems of logging and overgrazing are exacerbated by drought. Moroccan forestry authorities have considered culling macaques because of their bark stripping. They were once found throughout North Africa but now only exist in small areas (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
M. sylvanus receives some protection under national and international legislation. Collection and export of M. sylvanus are regulated by a system of permits in Morocco, but enforcement of the legislation is inadequate. Deag (1977) mentions a maximum quota for trade of 100 macaques per year in Morocco. The species is listed on Appendix II of CITES (EC 338/97, Annex B). In 2000, the European Community suspended imports of M. sylvanus from Algeria and Morocco under the provisions of Article 4.6b of EC Regulation 338/97 because such trade was deemed to have a harmful effect on the species' status.

Over the last few decades there have been repeated surveys of the species in the wild, mainly carried out by scientists from outside the range states. The national authorities are aware of these surveys but do not always support or agree with the outcome (E. van Lavieren pers. comm. 2006). The Moroccan authorities initiated studies on the ecology, demography and genetics of the Moroccan Middle Atlas population to run from 2006-2008 (M. Mouna pers. comm. 2006, N. Menard pers. comm. 2008). These studies are conducted by N. Menard’s team and will provide new information on population demographics and density.

In both Morocco and Algeria, the national forestry departments are responsible for the management and the protection of flora and fauna. There has been much debate about appropriate management of M. sylvanus. The national forestry department in Morocco contends that there are too many macaques in the region (due to the disappearance of predators such as the leopard Panthera pardus), and that they are responsible for the degradation of cedar forests through their bark stripping behaviour. Consequently culls and translocations have been carried out in some areas (F. Cuzin pers. comm. 2007). However, field studies and surveys indicate that the population is declining and that bark stripping behaviour is potentially induced by water shortage (Camperio Ciani et al. 2001, 2003), although the latter assertion is controversial as bark-stripping has been observed to occur when drinking water is freely available and water content in bark is lower than that found in other available food resources (Menard and Qarro 1999). An alternative hypothesis is that Barbary Macaques strip cedar bark when some nutrients they search for are unavailable in other food resources (N. Ménard unpubl. data).

A number of activities have been undertaken to increase public awareness and reduce illegal trade in this species. AAP (a Netherlands-based sanctuary for exotic animals) has initiated a project to combat illegal trade of Barbary Macaques into Europe, involving inter alia awareness raising among potential buyers, cooperation with authorities in the consuming countries and training of customs officers in Spain (E. van Lavieren pers. comm. 2006). In Algeria, the ecological association Amazer-N’-Kefrida carried out public education and awareness raising campaigns in 2006 and 2007, against illegal trade, commercial uses, and improper artificial feeding of Barbary Macaques, closely collaborating with the Gendarmerie Nationale (National Gendarmery), the Algerian Customs, the Laboratory of Ecology and Environment of the Université de Béjaïa, the General Forests Directorate, and the National Parks (F. Belbachir pers. comm. 2007).

Most habitats of M. sylvanus in Algeria have national park status. This is not the case for all the habitats in Morocco. A part of the Rif mountains has national park status, and there are plans to make the cedar/mixed forest in the central Middle Atlas a national park, but a large part of the species' habitat in Morocco lies outside protected areas. Protected areas containing populations of this species include the Toubkal National Park, Eastern High Atlas N.P., Ifran N.P., Talassemtane N.P., Bou Hachem Reserve and Djebel Moussa N.P. in Morocco, and the Djurdjura, Taza, Chréa, and Gouraya National Parks in Algeria. However, the parks in Algeria and Morocco suffer from significant human impact, and all these areas required much stricter protection than is currently in place. Barbary Macaques breed well in captivity. The possibility of reintroducing animals to northern Tunisia, where they went extinct in the 1900s, should also be studied.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Seen as a symbol of Gibraltar and valued as a tourist attraction, these macaques are protected to some extent (4). In Algeria, this species is protected in several national parks, but there are few active conservation policies elsewhere. There have been proposals to re-introduce them to the Kouf National Park in Libya, and also to re-introduce them to Tunisia (9). The World Conservation Union recommends further population studies of the Barbary macaque, and also the investigation of the bark-stripping problem in Morocco. National park protection must also be implemented more effectively (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Barbary macaques Macaca sylvanus occasionally raid gardens or farms, which has led to trapping and illegal poaching.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Due to their low numbers in the wild, Barbary macaques are not commonly used in labs, but some labs still utilize them for biomedical research. There is also a small illegal pet trade for them. In Gibraltar they attract a large number of tourists.

Positive Impacts: pet trade ; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Barbary macaque

The Barbary Macaque (play /məˈkɑːk/; Macaca sylvanus), or Common macaque, is a macaque with no tail. Found in the Atlas Mountains of Algeria and Morocco with a small population, of unknown origin, in Gibraltar, the Barbary Macaque is one of the best-known Old World monkey species. Besides humans, they are the only primates that live freely in Europe. Although the species is commonly referred to as the "Barbary Ape", the Barbary Macaque is a true monkey, not an ape.

Contents

Appearance

Skull and brain, as illustrated in Gervais' Histoire naturelle des mammifères

The monkey is yellowish-brown to grey with lighter undersides, growing to a maximum size of 75 cm (30 in) and 16 kg (29 lb). Its face is a dark pink and its tail is vestigial. The front limbs of this monkey are longer than its hind limbs. Females are somewhat smaller than males.

Ecology

Dwelling in forests of cedar, pine and oak, the Barbary Macaque may frequent elevations of 2,100 m (6,900 ft) or more. It is a diurnal animal, dividing its time more or less equally between arboreal and terrestrial territory. Mostly herbivorous, this monkey feeds on leaves, roots, and fruit, but will also eat insects. By day, the Barbary Macaque patrols a territory which may span several square kilometres; it peacefully co-exists with other primate species, sharing watering holes without incident. The Barbary Macaque moves about energetically on all fours, occasionally rising erect on its hind limbs to survey for threats.

Female Barbary macacque with young suckling at Mediterranean Steps, Gibraltar.
illustration from the XIXth century
Distribución de M. sylvanus

The Barbary Macaque is a gregarious monkey, forming mixed groups of several females and males; the troop of 10 to 100 individuals is matriarchal, with its hierarchy determined by lineage to the lead female. Unlike other macaques, the males participate in rearing the young; much time is spent playing and grooming with them. In this way, a strong social bond is formed between a male and his offspring, both the male's own and those of others in the troop. This may be a result of selectiveness on the part of the females, who seem to prefer highly parental males.

The mating season runs from November through March. After a gestation period of 147 to 192 days, typically one baby per female is born; twins are a rarity. The monkeys reach maturity at 3 to 4 years of age, and may live for 20 years or more.

Status

Wild populations of Barbary macaques (Macaca sylvanus) have suffered a major decline in recent years to the point of being declared in 2009 as an "endangered species" by the IUCN. In the Middle Atlas mountains are located three quarters of the world population. Its habitat is restricted to rocky areas with sparse vegetation which are unsuitable for agriculture. The populations are isolated and increasingly inbreeding, with the risks that this situation creates. The species is listed globally as Vulnerable, and is declining.

The species is besides poached for live specimens as pets in illegal pet trade, and clandestine collectors. Spain is the main entry point in Europe. Today, there are no accurate data on the location and number of individuals that are out of their habitat. An unknown number of individuals are included in zoological collections, at other institutions, or in private hands, in storage or waiting to be relocated to appropriate destinations.

The habitat of the Barbary Macaque is under threat from increased logging activity; they are listed as endangered by the IUCN Red List. Local farmers view the monkeys as pests, and engage in extermination of the species. Once common throughout northern Africa and southern Europe, there are estimated to be just 12,000 to 21,000 Barbary Macaques left in Morocco and Algeria.[3] Once their distribution was much more extensive, reaching Tunisia and Libya. There is not now a continuous range, but rather isolated areas. During the Pleistocene this species inhabited the Mediterranean coasts and Europe, reaching Italy, Hungary, Spain and France, as far north as Germany and the British Isles. The species decreased with the arrival of the Ice Age, becoming extinct in the Iberian peninsula 30,000 years ago.

The skull of a Barbary Macaque was discovered during excavation in the 1970s at the pre-Christian Navan Fort in County Armagh, Northern Ireland. Carbon dating tests suggest it died there in the 3rd century BC.

Human use

Many of the mistaken ideas about human anatomy contained in the writings of Galen are apparently due to his use of these animals, the only anthropoid available to him, in dissections. Strong cultural taboos of his time prevented his performing any actual dissections of human cadavers, even in his role as physician and teacher of physicians.

Gibraltar population

Gibraltar Barbary Macaque feet and hands

The last wild population in Europe is that of Gibraltar, which unlike that of North Africa is thriving. At present, according to the census carried out by Andrew Stimpson, there are some 300 animals in five troops occupying the area of the Upper Rock, though occasional forays into the town may result in damages to personal property.

See also

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 164. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100565. 
  2. ^ Butynski, T. M., Cortes, J., Water, S., Fa, J., Hobbelink, M. E., van Lavieren, E., Belbachir, F., Cuzin, F., de Smet, K., Mouna, M., de Iongh, H., Menard, N. & Camperio-Ciani, A. (2008). Macaca sylvanus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ C. Michael Hogan (2008) Barbary Macaque: Macaca sylvanus, GlobalTwitcher.com
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!