Overview

Distribution

Range Description

Cebus apella apella
This is a wide ranging subspecies in the lower Amazon. The definition of Cebus apella apella of course determines the geographic range. As this is still controversial, the geographic range is correspondingly uncertain. Here we follow the taxonomy and proposed distributions of Silva Jr (2001). The taxonomic arrangement proposed by Groves (2001) was discussed by Rylands et al. (2005), especially in relation to the work of Torres de Assumpção (1983). It was not possible to delimit the ranges of the subspecies he recognized, but those of the species were mapped in Fragaszy et al. (2004). The one exception is in the lack of precision in the ranges of C. libidinosus and C. apella. Groves (2001) recognized C. libidinosus juruanus as the form occurring from the upper Juruá (type locality: Brazil: Frente a João Pessôa, Rio Juruá) extending east in a swathe through northern Mato Grosso. In the map provided in Fragaszy et al. (2004), C. libidinosus juruanus is restricted to the upper Juruá (a range proposed by Hill [1960]), and entirely surrounded by C. apella, which of course is unreasonable: it should have a range which is contiguous with other C. libidinosus subspecies. If a valid taxon, the range of C. l. juruanus should extend through northern Mato Grosso to meet the range C. l. libidinosus, but its limits are unclear. The requirements for any conservation assessment and subsequent conservation action are that the taxon is defined and its geographic distribution delineated. Silva Jr. (2001) provided a taxonomy and distribution maps. This in no way discards the taxonomy proposed by Groves (2001). Further research is needed.

The range of Cebus apella apella described here includes that of C. apella tocantinus Lönnberg, 1939, from the south of the lower to middle Amazon, Cebus libidinosus pallidus Gray, 1866 from the central and northern Bolivia (as indicated by Groves 2001), part of the range of C. macrocephalus Spix, 1823 (lower to middle Amazon north of the Rio Amazonas), and the part of that of C. libidinosus juruanus that Groves (2001) proposed extended through Rondônia to northern Mato Grosso.

The stronghold of the type species is the Guianas, and Brazil, at least east of the Rio Negro. Boher-Bentti and Cordero-Rodríguez (2000) extended it to the southern extreme of the Orinoco Delta, although it is otherwise not recognized as occurring in eastern Venezuela (Bodini and Pérez-Hernández 1987; Linares 1998). In Venezuela, it occurs in the Federal Territory of Amazonas, along both sides of the upper Rio Orinoco, its precise range being limited by savannas. The range to the west is constrained by C. macrocephalus and to the south by C. libidinosus. In the east to the interfluvium of the rios Itapecuru and Parnaiba in the state of Maranhão. In Bolivia, Cebus apella occurs south of the Madre de Dios, south to the headwaters of the ríos Mamoré and Beni, where it meets the range of C. cay occurring in southern Bolivia, the Brazilian Mato Grosso, Paraguay and Argentina. It extends into south-east Peru along the south of the Río Madre de Dios, west as far the Rio Inambari (recognized as C. a. pallidus by Aquino and Encarnación [1994]). In the southern Amazon, C. apella would be restricted by the transition to Cerrado, the bush savanna of central Brazil where C. libidinosus occurs.

Cebus apella margaritae
Cebus apella margaritae lives in four forest fragments on the east side of Margarita Island in Venezuela: El Copey Nacional Park (7,130 ha) rising to 930 m above sea level; the Serranía of Cerro Tragaplata (~4,400 ha) an unprotected area rising to 680 m above seas level; Cerro Matasiete Natural Monument (1,145 ha) rising to 660 m asl; and Cerro Taguantar (~1,000 ha) an unprotected area rising to 520 m above sea level. Monkeys were reported in Cerro Taguantar in 2007 (Ceballos-Mago, direct observation).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Cebus apella is found east of the Andes from Colombia and Venezuela to Paraguay and northern Argentina.

Biogeographic Regions: neotropical (Native )

  • Emmons, L. 1990. Neotropical Rainforest Mammals. Chicago and London: The University of Chicago Press.
  • Forbes, P., B. MacKeith, R. Perberdy. 1984. All The World's Animals: Primates. New York, Toronto: Torstar Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Brown capuchin monkeys vary in color from light brown to mustard yellow to black. The shoulders and underbelly are lighter than the rest of the body. There is a patch of coarse black fur on the crown of the head, sometimes referred to as a cap. Above the ears the black hairs form tufts of fur giving the species one of its common names, tufted capuchin monkey. Facial patterns are variable among individuals, but black sideburns extending from the cap are characteristic of Cebus apella. The hands, feet, and tail are either black or dark brown.

The tail is long and prehensile. Cebus apella is the only species of capuchin monkey known to carry its tail in a tight coil.

This species is robust and stocky. Brown capuchin monkeys have a deep lower jaw and large jaw muscles to accomodate a diet of large fruits and rough vegetation. Males are 34% larger in body size and have canines 22% larger than those of females.

Range mass: 1300 to 4800 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Cebus apella inhabits moist subtropical or tropical forests, but has also been seen in dry forest, gallery forest, disturbed and secondary forest. In northwest Argentina these monkeys live in montane forest at an elevation of 200 to 1100m. This species prefers the understory and midcanopy of the forest, but often descends from the trees to forage and play. Cebus apella has the widest range and broadest habitat tolerances of any other Cebus species.

Range elevation: 1100 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; mountains

  • Kinzey, W. 1989. New World Primates: Ecology, Evolution, and Behavior. New York: Aldine De Gruyter.
  • Nowak, R. 1991. Walker's Mammals of the World, Fifth Edition. Baltimore and London: The Johns Hopkins University Press.
  • Rowe, N. 1996. The pictorial guide to the living primates. New York: Pogonias Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Tropical lowland and submontane and montane rain forest, seasonally inundated forest, mangroves and savanna forests. Cebus apella inhabits a wide variety of vegetation types in Suriname and is probably more flexible in choice of habitat than any other primate species in the Guianas. It is common in high rain forest, low rain forest, riverbank high forest, mountain savanna forest, liana forest marsh forest (including Mora forest), swamp forest (including Euterpe Symphonia swamp forest and Mauritia flexuosa open swamp forest), swamp woodland (including Erythrina glaucaand Pterocarpus Tabebuia associations) and various secondary formations, and also has been reported from high forest and white sand savanna forest, savanna scrub, ridge forest (littoral woodland) and mangrove forest (Avicennia) along the coast (Mittermeier 1977; Mittermeier and van Roosmalen 1981). In Guyana, it is one of the species most often encountered along rivers (Muckenhirn et al. 1976). Arboreal quadrupeds, they are typically found in the lower to mid-canopy and understory (Freese and Oppenheimer 1981; Fragaszy et al. 2004; Jack 2007).

Capuchins are frugivores-insectivores, including wide variety of fruits, seeds and arthropods, frogs, nestlings and even small mammals, supplemented by stems, flowers and leaves. They are extractive, manipulative foragers (see Izawa 1979; Fernandes 1991). Largely sympatric with the untufted capuchins, eitherCebus olivaceus or C. albifrons. The species differ most markedly in their diet through their use of palm fruits (Terborgh 1983; Spironello 1991, 2001). Mean group size for Cebus apella is 18 individuals, with numbers of females exceeding the numbers of males (adult sex ratio of 0.85). Males disperse. Both sexes take up linear hierarchies, the top ranking male being dominant to the top ranking female. Subordinate males are often peripheral (Fragaszy et al. 2004). Zhang (1994, 1995a,b; Zhang and Wang 1995a,b) carried out a field study of the ecology and behaviour of this species in French Guiana.

In the Guianas, C. apella group sizes usually range from 10-20 animals (Mittermeier 1977; Spironello 1991; Zhang 1995b). Groups sometimes split into subgroups and forage on their own in different directions. The home range of the best known group in the Voltzberg site of Mittermeier (1977) was roughly 146 ha, and a second group, which ranged outside as well, covered 62 ha of his study area. Larger home ranges have been recorded by Zhang (1995b) in French Guiana (approximately 355 ha) and by Spironello (2001) north of Manaus in Brazil (around 900 ha).

Size: Adult male 1.35-4.8 kg (mean 3.05 kg); adult female: 1.76-3.4 kg (mean 2.4 kg) (Jack 2007).

Cebus apella margaritae
The vegetation cover of the mountains inhabit by Margarita Island Capuchins have particular ecological interest, because they support an isolated cloud forest at an exceptionally low altitude (ca. 600 m above sea level) contrasting with an arid lowland (Sugden 1986). Home range is about 78 ha (Márquez and Sanz 1991; Sanz and Márquez 1994). The diet is comprised of fruits, insects, flowers, leaves, seeds and piths. Margarita Island Capuchins are particularly shy and cryptic, avoiding human contact probably due to the hunting pressure.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Fruits are a large part of brown capuchin monkey's diet. This species can eat larger fruits than other species of capuchin monkey because of their robust jaws. Vegetation, seeds, pith, eggs, insects, reptiles, birds, and small mammals (such as mouse opossums) are also included in their diet. During the dry season, when food is scarce, Scheelea palm frond pith is critical to this animal's survival.

Foraging is a noisy and destructive activity. Brown capuchin monkeys move from tree to tree, ripping apart vegetation and cracking open nuts against branches. They look for vertebrate and invertebrate prey by destroying dead vegetation and capturing anything inside. Individuals who catch prey do not usually share with other group members.

Animal Foods: birds; mammals; amphibians; reptiles; eggs; carrion ; insects; terrestrial non-insect arthropods

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Brown capuchin monkeys are important predators on small animals and may disperse the seeds of some forest plants when they eat the fruit.

Cebus apella can be found in mixed species groups. They are most often found in association with squirrel monkeys (Saimiri sp.). Usually the squirrel monkeys initiate the mixed group interaction, probably in order to find food more efficiently. Squirrel monkeys follow brown capuchin monkeys to new food sources, which saves them foraging time. The association does not seem to benefit capuchin monkeys.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The dominant male protects his troop from predators by sounding alarm calls. This draws attention to himself so that his troop can escape. Capuchin monkeys are very wary of predators.

Members of a troop give sharp whistling calls at the sight of hawks and eagles, two of the most significant predators of this species. The troop is so wary of hawks and eagles that it sounds alarm whistles even if the bird flying overhead is harmless.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

These monkeys scent mark themselves by washing their hands in their own urine and rubbing their hands on their fur. This may be a way for males to advertise their sexual maturity.

Female brown capuchin monkeys in estrus try to attract the attention of the dominant male by following him and making loud calls. A wide variety of vocalizations is known from Cebus species. These were divided into 4 categories in C. olivaceus: contacting the group, contacting individuals, ending aggressive encounters, alerting the group to the presence of danger.

Gestures and facial expressions are also widely used in communication and social grooming is an important form of contact.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Typical longevity in the wild is unknown, but captive C. apella may live to 45 years old.

Range lifespan

Status: captivity:
45 (high) years.

Average lifespan

Status: captivity:
44.6 years.

Average lifespan

Sex: male

Status: captivity:
41.0 years.

Average lifespan

Status: wild:
40.0 years.

Average lifespan

Sex: male

Status: captivity:
45.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 46 years (captivity) Observations: One specimen was about 46 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Cebus apella has a polygamous mating system. Females mate preferentially with the dominant male. Other males have mating opportunities when the dominant male is not present. During the last two days of a female's estrus cycle, the dominant male is very protective and keeps the female from mating with subordinate males.

Mating System: polygynous

Cebus apella does not appear to have a breeding season, though most births may occur during the dry season or early rainy season. The ovarian cycle lasts for approximately 21 days and female's show no external genital swellings during estrus. The gestation period is 150-160 days and one infant is born, twins are very rare.

Young males leave their natal group once they reach sexual maturity. Male brown capuchin monkeys are considered sexually mature at 7 years of age. Females mature earlier and may give birth to their first offspring as early as 4 years old.

Breeding interval: Capuchins give birth once yearly.

Breeding season: Births and breeding may occur in any season, but may be more frequent during dry or early rainy seasons.

Range number of offspring: 2 (high) .

Average number of offspring: 1.

Range gestation period: 150 to 160 days.

Average age at sexual or reproductive maturity (female): 4 years.

Average age at sexual or reproductive maturity (male): 7 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 239.7 g.

Average number of offspring: 1.5.

Average age at sexual or reproductive maturity (female)

Sex: female:
1703 days.

Parenting is left to the females, although males are tolerant of juveniles. Allomothering is a common practice. Infant capuchin monkeys cling to their mothers fur during their first few months of life. Mothers travel with their infants and nurse them during that time. If a young capuchin monkey is separated from its mother, other members of the troop will respond to the infant's distress calls. Female capuchins remain in their natal group at adulthood while males disperse.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

  • Emmons, L. 1990. Neotropical Rainforest Mammals. Chicago and London: The University of Chicago Press.
  • Forbes, P., B. MacKeith, R. Perberdy. 1984. All The World's Animals: Primates. New York, Toronto: Torstar Books.
  • Kinzey, W. 1989. New World Primates: Ecology, Evolution, and Behavior. New York: Aldine De Gruyter.
  • Linn, G. 1995. American Journal of Primatology.
  • Nowak, R. 1991. Walker's Mammals of the World, Fifth Edition. Baltimore and London: The Johns Hopkins University Press.
  • Rowe, N. 1996. The pictorial guide to the living primates. New York: Pogonias Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cebus apella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGATGATTGTTCTCCACTAATCACAAGGATATTGGTACTTTATACTTACTATTTGGAGCATGAGCCGGTATAGTAGGCACTGCCTTGAGCCTCCTCATCCGAGCCGAACTAGGTCAGCCCGGTACTTTACTAGGTGACGATCAAATTTATAATGTCATCGTAACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCCATCATAATTGGGGGCTTTGGAAACTGACTAGTGCCGTTAATAATTGGTGCTCCGGACATGGCATTCCCCCGAATAAATAACATGAGCTTCTGACTCCTTCCTCCATCCTTTCTTCTACTATTAGCATCTTCTATGGTAGAAGCAGGTGCAGGAACGGGATGAACCGTATACCCCCCACTGGCTGGCAATCTGGCCCATGCAGGAGCATCCGTTGACCTTACAATTTTCTCCTTACACTTAGCCGGAGTCTCTTCTATTTTAGGGGCAATTAATTTCATCACTACTATTATCAACATAAAACCCCCTGCAATATCCCAGTATCAAACTCCCCTGTTTGTATGATCAGTACTAATTACAGCAGTTCTACTCTTACTATCCCTGCCTGTACTGGCTGCTGGAATTACAATACTTTTAACAGACCGGAATCTTAATACCACCATTTTTGATCCCGCTGGGGGAGGAGACCCTATCCTATATCAACACTTATTCTGATTTTTCGGACACTTTGAAGTTTACATTCTTATTCTGCCCGGATTCCGAATATTTCTTCCAATTGTCCTTACCTACTCCAACAAAAAGAAGCCTTTCGGTTATATAGGATTTGTATGACCAATAAATTCCATGGGCTTCCTAGGCTTAATCGTATGAGCTCACCATATATTCACAGTAGGAATAGATCTGGATACACGCGCGTATTTTACATCAGCTACCATAATCATTGCCATCCCCACTGGGGTCAAAGTATTTAGCTGGTTGGCTACACTACATGGAGGCAACATCAAGTGATCTCCTGCAATACTATGAGCCCTGGGTTTTATTTTTCTCTTCACTGTGGGTGGATTGACAGGAGTTGTATTAGCTAACTCATCATTAGATATTGTCCTACATGATACATACTACGTGGTAGCCCATTTCCATTACGTCTTATCAATAGGAGCAGTGTATGCCATTATAGGAGGCTTCCTTCACTGATTTCCATTATTTTCAGGCTATACACTCGACCAAACTTACGCTAAAATCGACTTTACTATTATATTTGTAGGTGTAAACATAACCTTCTTTCCACAACACTTTCTCGGCCTATCTGGAATACCTCGACGGTACGAGGATTATCCAGATGCCTACACTGCATGAAATATTATCTCATCCGTAGGCTCATTTATTTCACTAACAGCAGTTATTCTAATAATTTTTATAATTTGAGAAGCCTTTTCTTCAAAACGAAAAGTTCGAACTATTGAACAAATGATTACTAATCTAGAGTGATTGTATGGCTGTCCCCCTCCCTACCACACATTTGAAGAAGCTACCTACGTAAAACTCCTAAACGAAAAAGGAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cebus apella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Because of its high reproductive potential and its habitat flexibility, hunting and habitat destruction have not devastated populations as severely as they have other species of primates. However, certain subspecies may be threatened, including C. a. xanthosternos and C. a. robustus from the Atlantic forests of eastern Brazil.

Cebus apella is the most commonly seen monkey in Amazonia.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

  • Rylands, A., R. Mittermeier, E. Rodriguez-Luna. 1997. Conservation of Neotropical Primates: Threatened Species and an Analysis of Primate Diversity by Country and Region. Folia Primatologica, 68: 134-160.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Rylands, A.B., Boubli, J.-P., Mittermeier, R.A., Wallace, R.B. & Ceballos-Mago, N.

Reviewer/s
Mittermeier, R.A., Rylands, A.B. (Primate Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern as the species is widespread and there are currently no major threats resulting in a significant overall population decline that would warrant listing in a threatened category or listing as NT. Although declines need to be considered over a period of 45 years (three generations), the species is more of a habitat generalist than other species with similar life-histories. However, it is declining in some parts of its range, including southern Pará state, Tocantins state, and northern Mato Grosso.

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 2003
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The nominate subspecies is widespread and common.

Population density of the Margarita Island Capuchin has not been properly estimated yet. Results of an ongoing project about ecology and conservation of the Margarita Island Capuchin will allow the determination of densities in the near future. According to Sanz and Marquez (1994), total population is only 250-300 animals. Marquez and Sanz (1991) estimated between 0.02 and 0.23 groups/hours of observation in different forest fragments. Group size was 4.5 ind/group in average. During surveys conducted in 2007, group size varied between 2 and 15 individuals (N. Ceballos-Mago, direct observation).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Cebus apella apella
The Guianan tufted capuchin is hunted for food and as pets (this is the most common primate kept as pets), but is an adaptable species.

Cebus apella margaritae
Although part of the distribution of the Margarita Island Capuchins is within protected areas (Cerro el Copey National Park and Cerro Matasiete Natural Monument), they are still threatened by hunting pressure and by habitat loss and fragmentation. Habitat fragmentation on Margarita Island is mainly caused by road construction and growth of towns. Sanz and Marquez (1994) considered that hunting pressure for pest control could be the main factor driving this subspecies to extinction in a few years. Currently, hunting pressure for pest control has been reduced only in the Cerro el Copey National Park. Capture of monkeys for pet trade in the whole distribution area of the monkeys has increased and can be currently one of the most important threats (Ceballos-Mago direct observation). Preliminary results of surveys have revealed an important national and international illegal traffic of primates. Release of monkey pets in the habitat of the Margarita Island Capuchin is another threat for these primates (Martinez et al. 2000). Such releases must be considered in terms of the level of risk of disease transmission and hybridization.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix II.
Cebus apella apella
occurs in numerous protected areas, many of which are very large.

Brazil
Tumucumaque National Park (3,882,376 ha)
Cabo Orange National Park (630,017 ha)
Gurupí Biological Reserve (272,379 ha)
Lago Piratuba Biological Reserve (394,223 ha)
Rio Trombetas Biological Reserve (409,578 ha)
Uatumã Biological Reserve (942,786 ha)
Jari Ecological Station (207,370 ha)
Terra do Meio Ecological Station (3,373,111 ha)
Niquia Ecological Station (282,803 ha)

French Guiana
Parc amazonien de Guyane (3,300,000 ha)
Nouragues Natural Reserve (100,000a)
La Trinité Natural Reserve
Kaw Reserved Area (76,800 ha)

Guyana
Kaietur National Park (11,655 ha)
Iwokrama Forest Reserve (364,000 ha)

Suriname
Brinckheuvel Nature Reserve (6,000 ha) (probable: Mittermeier and van Roosmalen 1982)
Central Suriname Nature Reserve (1,600,000 ha) (Mittermeier and van Roosmalen 1982)
Coppename Monding Nature Reserve (12,000 ha) (probable: Mittermeier and van Roosmalen 1982)
Galibi Nature Reserve (100 ha) (Mittermeier and van Roosmalen 1982)
Sipaliwini Nature Reserve (100,000 ha) (Mittermeier and van Roosmalen 1982)
Wia-wia Nature Reserve (36,000 ha) (Mittermeier and van Roosmalen 1982)
Brownsberg Nature Park (8,400 ha) (Mittermeier and van Roosmalen 1982; Norconk et al. 2003)

Cebus apella margaritae
Several recommendations have been proposed for the conservation of the Margarita Island capuchin (Marquez and Sanz 1991; Sanz and Marquez 1994; Martinez et al. 2000; Sanz 2001, 2003):

•To survey accurately the natural population of Cebus apella margaritae.
•To carry out population demography studies.
•To determine accurately home range and use of habitat.
•To carry out productivity studies.
•To solve the monkey-farmer conflict for crop raiding.
•To determine the presence/absence of Cebus olivaceous in the mountains.
•To control the illegal hunting and the illegal traffic of monkeys.
•To evaluate risks of zoonoses.
•To declare a protected area including the mountains in the north part of the island, in order to facilitate the movements of the monkeys between those mountains.
•To conduct environmental educational programmes.
•To conduct genetic studies

Unfortunately, most of these recommendations have not yet been implemented. The regional office of INPARQUES (National Parks Institute) about seven years ago started to plan the increase in area of the Cerro El Copey National Park, in order to include the mountains in the north and the west of the park. Nevertheless, this plan has not been executed until now. There is still a need to develop proper management strategies for the Margarita capuchin monkey and its habitat. There is an ongoing project of ecology and conservation of the Margarita Island capuchin that will generate actual information about this monkey population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known negative affects of C. apella on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cebus apella has been extensively hunted for meat. These animals are also popular pets in many parts of the world. They have been trained to perform household tasks for people with disabilities and are most commonly known as the monkeys used by itinerant "organ grinders".

Positive Impacts: pet trade ; body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tufted capuchin

The tufted capuchin (Cebus apella), also known as brown capuchin, black-capped capuchin, or pin monkey is a New World primate from South America. As traditionally defined, it is one of the most widespread primates in the Neotropics, but it has recently been recommended considering the black-striped, black and Golden-bellied Capuchins as separate species in a new genus, thereby effectively limiting the tufted capuchin to the Amazon Basin and nearby regions.[1]

The tufted capuchin is an omnivorous animal, mostly feeding on fruits and invertebrates, although it sometimes feeds on small vertebrates (e.g. lizards and bird chicks) and other plant parts. It can be found in many different kinds of environment, including moist tropical and subtropical forest, dry forest, and disturbed or secondary forest.

Like other capuchins, it is a social animal, forming groups of 8 to 15 individuals that are led by an alpha or dominant male.

Taxonomy and phylogeny[edit]

At one point all tufted capuchins were classified as Cebus apella.[3][4] Under such taxonomy, the range of C. apella would extend throughout much of South America from Colombia to northern Argentina. More recent taxonomic studies have been carried out by Torres de Assumpção (1983; Torres 1988).[5] Groves (2005) recognized the following subspecies for the tufted capuchins:[1]

  • Cebus apella apella (Linnaeus, 1758)
  • Cebus apella fatuellus (Linnaeus, 1766)
  • Large-headed capuchin, Cebus apella macrocephalus Spix, 1823
  • Cebus apella margaritae Hollister, 1914
  • Cebus apella peruanus Thomas, 1901
  • Cebus apella tocantinus Lönnberg, 1939

In 2011, Jessica Lynch Alfaro et al proposed that the robust capuchins such (formerly the C. apella group) be placed in a separate genus, Sapajus, from the gracile capuchins (formerly the C. capucinus group) which retain the Cebus genus.[6][7]

Physical characteristics[edit]

The tufted capuchin is more powerfully built than the other capuchins, with rougher fur and a short, thick tail. It has a bundle of long, hardened hair on the forehead that can be raised as a sort of "wig". The fur is brownish gray, with the belly being somewhat lighter-colored than the rest of the body. The hands and feet are black. The tail is prehensile: strong and can be used for grasping, as an extra limb.

The tufted capuchin has a head-body length of 32 to 57 centimetres (13 to 22 in), a tail length of 38 to 56 centimetres (15 to 22 in), and a weight of 1.9 to 4.8 kilograms (4.2 to 10.6 lb), with the males generally being larger and heavier than the females.

Behaviour and ecology[edit]

Male tufted capuchin

The tufted capuchin is a diurnal, arboreal primate species, but it often forages on the ground to search for food or to walk longer distances between trees that are too far apart to jump.

The tufted capuchin lives in groups of two to twenty or more animals. A single group usually contains at least one adult male, but mixed groups with multiple males do also occur. In that case, one of the males is dominant. He accepts only a few monkeys in his direct surroundings, mainly younger animals and a few females. The dominant male and the group members that are close to him have the privilege to eat first in case of food scarcity, while subordinate monkeys have to wait until they are ready.

After a gestation period of 180 days, one young is born, or incidentally a twin. This young, which weighs only 200 to 250 grams, is carried on the back of its mother. The mother feeds her child for 9 months, but the young is sexually immature until its seventh year, which is quite late for a primate of its size.

Important natural enemies of the capuchin are large birds of prey. They are so afraid of those birds, that they even become alarmed when a harmless bird flies over.

The tufted capuchin rubs urine on its hands and feet in order to attract mates and reduce stress.[8]

Diet[edit]

A recently discovered characteristic of one population of this species is that it uses stones as a tool to open hard nuts. First it chooses ripe nuts from a nut palm. It uses its teeth to strip off the nut's fibrous husk. Then it leaves the nut to dry for about a week. When the nut is dry, the monkey lays the nut on a large, flat rock or fallen tree,[9] hammering the nut with a suitable stone until the nut cracks. The hammer stones are often large enough to require lifting with both hands. The anvil rock is often pock-marked with hollows as a result of repeated use.[10][11]

Besides nuts, the capuchin also eats fruit, insects and larvae, eggs and young birds, frogs, lizards, and even bats. They are also known to chase cats.

The tufted capuchin looks for its food in groups. As soon as one of the group members has found something edible, he or she may make a large whistling sound, dependent upon the proximity of other individuals and abundance of the food resource, so that the other monkeys know that there is something to eat.[12] The composition of the group is very well organized, and is determined by rank in the hierarchy. The dominant male often resides somewhere in the middle of the group just behind the front line, so that it is safer when a predator attacks. The vanguard is composed of higher-ranked females who are tolerated by the dominant male. They have the privilege to reach the food first, but they are also the most vulnerable when a predator attacks.

Tool use and manufacture[edit]

The tufted capuchin has been observed using containers to hold water, using sticks (to dig nuts, to dip for syrup, to catch ants, to reach food), using sponges to absorb juice, using stones as hammer and chisel to penetrate a barrier[13] and using stones as hammer and anvil to crack nuts.[14] While some of these tasks are relatively simple by cognitive standards (e.g. using a stick to catch ants), others, like cracking nuts with hammer and anvil are only exceeded in complexity by chimpanzees.[15]

The potential for tool use in animals like the Tufted Capuchin depends on a number of conditions that would increase its likelihood of appearing in a given species. Van Schaik proposed that the occurrence of tool use would be likely in foraging species if three factors were present: manual dexterity, intelligence, and social tolerance.[16] As it applies to manual dexterity, capuchins are capable of a limited precision grip (the ability to delicately pinch and manipulate objects with the thumb and fingertips), which is not found in any other New World monkeys and only found in limited amounts in apes.[17][18] C. apella has an encephalization ratio greater than the hominids (except humans) and a neocortex ratio that is almost as large as the apes; both of these rough indicators suggest high intelligence.[19][20] Finally, the Tufted Capuchin forms social groups typical of a complex and tolerant society.[21][22]

The tufted capuchin has been observed manufacturing tools both in captivity and in the wild. In captivity, it has been reported as making probing sticks to reach normally inaccessible containers with syrup.[23] It is also capable of understanding the concept of "sponging" and using paper towels, monkey biscuits, sticks, leaves and straw to sop up juice and then suck on the sponge to consume the juice.[23] Research in the wild has shown that capuchin tool use is every bit as extensive as in captivity with capuchins being observed using stones to dig holes to get at tubers, an activity previously only seen in humans.[24] The practice of using stones to crack nuts has arisen spontaneously in many locations such as in the Caatinga Dry Forest[24] and Serra da Capivara National Park,[25] all in Brazil and hundreds of miles apart. It has been observed cracking various nuts and fruits such as palm nuts (Attalea and Astrocaryum spp.)[26] and jatobá fruits.(Hymenaea courbaril)[25] The tufted capuchin has even been observed using stones to dislodge other stones that would later be used as hammers or shovels, an example of a more complex tool using behavior known as second-order tool use previously only found in chimpanzees.[25] Curiously, not all tufted capuchins engage in tool use. Moura and Lee (2004)[27] suggest lack of other food sources as the key factor. Ottoni and Mannu (2001),[28] Fragaszy et al. (2004)[29] and Visalberghi et al. (2005)[30] have proposed this is likely more a factor of a monkey's terrestrial habit: the more time a monkey spends on the ground, the more likely it is to profit from (and thus engage in) tool use.

In captivity, the tufted capuchin has been seen to manufacture stone tools that produced simple flakes and cores. Some of the capuchins even used these sharpened stones to cut (in a back-and-forth motion) barriers in order to reach food.[13] The importance of this behavior is that it serves as evidence of mechanical proclivity to modify stones by using behaviors already in the monkeys' repertoires, and this behavior is seen as a precursor to stone-knapping.[17] This early and limited tool use behavior has been hypothesized as similar to pre-Homo habilis and that artifacts of that time would probably resemble those of capuchins.[13]

C. apella tool manufacture and use has been analyzed for potential clues to social learning and problem solving ability, as tool manufacture and use can often shed light on such complex cognitive abilities.[13][31] Social learning, or the ability to learn from other individuals, is a controversial topic in most nonhuman species like C. apella because of the relative difficulty of determining whether a behavior was learned from imitation or a much simpler form of social learning.[32] One way of closing the gap between concurrent tool related behaviors and their likelihood of arising from imitation is by narrowing down events that would make social learning more probable such as a preference for observing experienced tool users. In this regard, Ottoni and his team found that young capuchins tended to observe the best tool users when cracking nuts.[14]

an example of a 'Doorian Fruit'
An example of the Doorian Fruit, a box that can open in one of two ways (see image for more info).

Another way of isolating imitation from other simpler behaviors is to present the capuchins with a box that has food but has two different ways of opening it. The important point is that neither way should be more advantageous so that the monkey can freely choose one. In one such study, when humans opened the door in front of the monkeys using one way only, the monkeys used that method, even when they discovered the alternative on their own.[33] In another study, capuchin alphas from two separate groups were trained to open the door in a specific way, after which the monkeys were paired with subordinates who learned to open the door in the same way.[34] When capuchins are trained in the same way and this time released into their groups, the habit is once again disseminated amongst all group members even when others discover alternative ways.[35] Nevertheless, the subject of whether or not C. apella learns by imitation is still controversial, because of the inherent difficulty in teasing out unambiguous evidence of a complex cognitive process such as imitation.[33][36]

Problem solving[edit]

Tool use and manufacture can also shed light on the many aspects of the tufted capuchin's cognitive abilities by determining how it solves some problems. Some non-primates manufacture and use objects as tools. Crows are known to make hook-tools for catching insects,[37] but such activities lack the behavioral plasticity of tool use as evidenced in tufted capuchins who found new ways to use tools that other species could not.[38] But this plasticity in tool use, while suggesting greater complexity and cognitive ability, does not suggest that the monkeys understand cause and effect. It instead implies they are only able to learn from successful efforts but not from failures nor are they able to refine and improve much.[39] Its ability to repeat successes, coupled with its complex repertoire of behavioral events helps to explain the Tufted Capuchin's extensive repertoire of innovative behaviors besides tool use.[39]

Distribution and habitat[edit]

This species lives in the northern Amazon rainforest of the Guyanas, Venezuela and Brazil and to the west of the Rio Negro, as far north as the Orinoco in Venezuela. It is also found in eastern Colombia, Ecuador, Bolivia, Peru, including the upper Andean Magdalena valley in Colombia. An introduced breeding population is well established in the northwestern peninsula of the island of Trinidad in the Republic of Trinidad and Tobago. It can be found in a large variety of forest types, mainly in tropical rainforests (up till a height of 2700 m), but also in more open forests.

The distribution overlaps with that of other species of capuchins, such as the White-fronted Capuchin (Cebus albifrons).

References[edit]

  1. ^ a b c Groves, C. P. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. p. 137. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ Rylands, A. B., Boubli, J.-P., Mittermeier, R. A. & Wallace, R. B. (2008). "Cebus apella". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 19 January 2012. 
  3. ^ Hershkovitz, Philip (1949). "Mammals of northern Colombia. Preliminary report No. 4: Monkeys (primates), with taxonomic revisions of some forms.". Proceedings of the United States National Museum 98: 1–323. 
  4. ^ Hershkovitz, Philip (1955). "Notes on American monkeys of the genus Cebus.". Journal of Mammalogy 36: 449–452. doi:10.2307/1375688. 
  5. ^ Torres, Marguerite; Fragaszy, D.M.; Izar, P.; Hinley, A.J.; Ottoni, E.B.; Visalberghi, E. (2007). "Modelling the monkey habitat in Brazil". Geospatial Today (5): 26–35. 
  6. ^ Lynch Alfaro, J.W. et al. (2011). "Explosive Pleistocene range expansion leads to widespread Amazonian sympatry between robust and gracile capuchin monkeys". Journal of Biogeography. doi:10.1111/j.1365-2699.2011.02609.x. 
  7. ^ Lynch Alfaro, J.W.; Silva, j. & Rylands, A.B. (2012). "How Different Are Robust and Gracile Capuchin Monkeys? An Argument for the Use of Sapajus and Cebus". American Journal of Primatology: 1–14. doi:10.1002/ajp.222007. 
  8. ^ "Randy monkeys wash hands, feet in urine. Scientists believe waste-bathing might also calm the primates". 2007-09-25. Retrieved 2008-01-04. 
  9. ^ Madden, M.; Fragaszy, D.M.; Izar, P.; Hinley, A.J.; Ottoni, E.B.; Visalberghi, E. (2007). "Modelling the monkey habitat in Brazil". Geospatial Today (5): 26–35. 
  10. ^ Discovery "Life" series, "Challenges of Life" episode, David Attenborough
  11. ^ Waga, IC; Dacier, A.K.; Pinha, P.S.; Tavares, M.C.H. (2005). "Spontaneous Tool Use by Wild Capuchin Monkeys (Cebus libidinosus) in the Cerrado". Folia Primatologica 77 (5): 337–344. doi:10.1159/000093698. 
  12. ^ Di Bitetti, Mario S. (2005). "Food-associated calls and audience effects in tufted capuchin monkeys, Cebus apella nigritus". Animal Behavior 69 (4): p. 911–919. doi:10.1016/j.anbehav.2004.05.021. 
  13. ^ a b c d Westergaard, Gregory Charles (February 1995). "The subsistence technology of capuchins". International Journal of Primatology 16 (1): 899–906. doi:10.1007/BF02736075. Retrieved 2009-12-04. 
  14. ^ a b Ottoni, Eduardo; Briseida Dogo de Resende; Patrícia Izar (2005). "Watching the best nutcrackers: what capuchin monkeys (Cebus apella) know about others' tool-using skills". Animal Cognition 8 (4): 215–219. doi:10.1007/s10071-004-0245-8. PMID 15719240. Retrieved 2009-12-04. 
  15. ^ Westergaard, Gregory Charles (1999). "Structural analysis of tool-use by tufted capuchins (Cebus apella) and chimpanzees (Pan troglodytes)". Animal Cognition 2 (3): 141–145. doi:10.1007/s100710050034. Retrieved 2009-12-04. 
  16. ^ van Schaik, Carel; Deaner R; Merrill M (1999). "The conditions for tool use in primates: implications for the evolution of material culture". Journal of Human Evolution 36 (6): 719–741. doi:10.1006/jhev.1999.0304. PMID 10330335. Retrieved 2009-12-04. 
  17. ^ a b Cummins-Sebree, SE; Fragaszy DM (2005). Capuchins as Stone-knappers?: an Evaluation of the Evidence. Stone Knapping: The Necessary Conditions for a Uniquely Hominin Behaviour. Cambridge, England: McDonald Institute for Archaeological Research. p. 171. ISBN 978-1-902937-34-2. 
  18. ^ Costello, M; D. Fragaszy (1988). "Prehension in Cebus and Saimiri: Grip type and hand preference". American Journal of Primatology 15 (3): 235–245. doi:10.1002/ajp.1350150306. Retrieved December 2009. 
  19. ^ Rilling, James; Thomas R. Insel (August 1999). "The primate neocortex in comparative perspective using magnetic resonance imaging". Journal of Human Evolution 37 (2): 191–223. doi:10.1006/jhev.1999.0313. PMID 10444351. Retrieved 2009-12-04. 
  20. ^ Dunbar, Robin (1998). "The social brain hypothesis". Evolutionary Anthropology: Issues, News, and Reviews 6 (5): 178–190. doi:10.1002/(SICI)1520-6505(1998)6:5<178::AID-EVAN5>3.0.CO;2-8. Retrieved 2009-12-04. 
  21. ^ Izar, Patricia (2004). "Female social relationships of Cebus apella nigritus in a southeastern Atlantic forest". Behaviour 141 (1): 71–99. doi:10.1163/156853904772746619. Retrieved 2009-12-04. 
  22. ^ Visalberghi, Elisabetta; D. Fragaszy (1995). "The behaviour of capuchin monkeys, Cebus apella, with novel food: the role of social context". Animal Behaviour 49 (4): 1089–1095. doi:10.1006/anbe.1995.0137. Retrieved 2009-12-04. 
  23. ^ a b Westergaard, Gregory Charles; D. Fragaszy (1987). "The manufacture and use of tools by capuchin monkeys (Cebus apella)". Journal of Comparative Psychology 101 (2): 159–168. doi:10.1037/0735-7036.101.2.159. Retrieved 2009-12-04. 
  24. ^ a b Moura, A.C.; Lee, PC (2004). "Capuchin stone tool use in Caatinga dry forest". Science 306 (5703): 1909. doi:10.1126/science.1102558. PMID 15591195. Retrieved 2009-12-04. 
  25. ^ a b c Mannu, Massimo; Eduardo Ottoni (2009). "The enhanced tool-kit of two groups of wild bearded capuchin monkeys in the Caatinga: tool making, associative use, and secondary tools". American Journal of Primatology 71 (3): 242–251. doi:10.1002/ajp.20642. PMID 19051323. Retrieved 2009-12-04. 
  26. ^ Fragaszy, Dorothy; Patrícia Izar; Elisabetta Visalberghi; Eduardo B. Ottoni; Marino Gomes de Oliveira (2004). "Wild capuchin monkeys (Cebus libidinosus) use anvils and stone pounding tools". American Journal of Primatology 64 (4): 359–366. doi:10.1002/ajp.20085. PMID 15580579. Retrieved 2009-12-04. 
  27. ^ Moura, A. C. de A.; Lee, P. C. (2004). "Capuchin Stone Tool Use in Caatinga Dry Forest". Science 306 (5703): 1909. doi:10.1126/science.1102558. PMID 15591195. 
  28. ^ Ottoni, Eduardo B.; Mannu, Massimo. "Semifree-ranging Tufted Capuchins (Cebus apella) Spontaneously Use Tools to Crack Open Nuts". International Journal of Primatology 22 (3): 347–358. doi:10.1023/A:1010747426841. 
  29. ^ Fragaszy, Dorothy; Izar, Patrícia; Visalberghi, Elisabetta; Ottoni, Eduardo B.; Oliveira, Marino Gomes de (2004). "Wild capuchin monkeys (Cebus libidinosus) use anvils and stone pounding tools". American Journal of Primatology 64 (4): 359–366. doi:10.1002/ajp.20085. PMID 15580579. 
  30. ^ Visalberghi; et al. (2005). "Terrestriality and Tool Use". Science: 951–952. doi:10.1126/science.308.5724.951c. 
  31. ^ Visalberghi, Elisabetta; Trinca L (1989). "Tool use in capuchin monkeys: Distinguishing between performing and understanding". Primates 30 (4): 511–521. doi:10.1007/BF02380877. Retrieved 2009-12-04. 
  32. ^ Fragaszy, Dorothy; Elisabetta Visalberghi (1989). "Social influences on the acquisition of tool-using behaviors in tufted capuchin monkeys (Cebus apella)". Journal of Comparative Psychology 103 (2): 159–170. doi:10.1037/0735-7036.103.2.159. PMID 2736909. Retrieved 2009-12-04. 
  33. ^ a b Custance, D; Whiten A; Fredman T (1999). "Social learning of an artificial fruit task in capuchin monkeys (Cebus apella)". Journal of Comparative Psychology 113 (1): 13–22. doi:10.1037/0735-7036.113.1.13. Retrieved 2009-12-04. 
  34. ^ Dindo, M; Thierry B; Whiten A (2008). "Social diffusion of novel foraging methods in brown capuchin monkeys (Cebus apella)". Proceedings of the Royal Society B 275 (1631): 187–93. doi:10.1098/rspb.2007.1318. PMC 2596191. PMID 17971322. Retrieved 2009-12-04. 
  35. ^ Dindo, M; Whiten A; De Waal F (2009). Ferrari, Pier Francesco, ed. "In-Group Conformity Sustains Different Foraging Traditions in Capuchin Monkeys (Cebus apella)". PLoS ONE 4 (11): e7858. doi:10.1371/journal.pone.0007858. PMC 2773420. PMID 19924242. Retrieved 2009-12-04. 
  36. ^ Visalberghi, Elisabetta; Fragaszy DM (2002). " Do Monkeys Ape?"-Ten Years After. Imitation in animals and artifacts. MIT Press. p. 494. ISBN 0-262-04203-7. 
  37. ^ Hunt, Gavin (1996). "Manufacture and use of hook-tools by New Caledonian crows". Nature 379 (6562): 249–251. doi:10.1038/379249a0. Retrieved 2009-12-04. 
  38. ^ Cummins-Sebree, SE; D. Fragaszy (2005). "Choosing and using tools: Capuchins (Cebus apella) use a different metric than tamarins (Saguinus oedipus)". Journal of Comparative Psychology 119 (9): 210–219. doi:10.1037/0735-7036.119.2.210. PMID 15982164. Retrieved 2009-12-04. 
  39. ^ a b Visalberghi, Elisabetta; Limognelli L. (1994). "Lack of comprehension of cause-effect relations in tool-using capuchin monkeys (Cebus apella)". Journal of Comparative Psychology 108 (1): 511–521. doi:10.1037/0735-7036.108.1.15. PMID 8174341. Retrieved 2009-12-04. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!