Overview

Distribution

Range Description

Cebus albifrons extends from northern coastal Colombia (C. a. malitiosus) along the northern slopes of the Sierra Santa Marta, south the Río Magdalena valley into the Department of Tolima (exact southern limit unclear) and the lower Río Cauca valley to the eastern parts of central Antioquia and southern parts of the Department of Sucre in the west (Hernández-Camacho and Cooper 1976; Defler 2004). It occurs in western Ecuador and extreme north-eastern Peru and from the eastern slopes of the Andes in Peru and Ecuador to the Venezuelan Amazon, south through eastern Peru, east to the Rio Tapajós in Brazil, and south into northern and central Bolivia.

Cebus albifrons albifrons. (Brazil, Colombia, Ecuador, Peru, Venezuela)
In Colombia, Defler (2004) indicated that C. a. albifrons is the form occurring in the Department of Arauca (south of the Río Arauca) and also in Vichada between the ríos Meta and Tuparro. A population also occurs between the upper reaches of the ríos Vaupés and Isan in the Department of Vaupes (Hernández-Camacho and Cooper 1976). Its occurrence in other parts of central Colombia, east of the Cordillera Oriental is otherwise supposed but not yet ascertained. Cebus a. albifrons occurs throughout the Colombian Amazon north of the Rio Napo and east of the Río Ucayali in Peru south as far as right bank of the upper Río Purus (Aquino and Encarnación 1994). It occurs in the Venezuelan Amazon, south into Brazil into the states of Amazonas and Roraima, along the right (west) banks of the Rios Branco and Negro, and further east south of the Rio Amazonas as far as the Rio Tapajós, south through the Madeira-Tapajós interfluvium to the north-west Mato Grosso and northern Rondônia, extending south of the Madre de Dios, across the Río Beni basin to Río Mamoré-Guaporé to about 17ºS (Brown and Rumiz 1986; Anderson 1997). The range limits in the southern part of the distributions of C. a .cuscinus and C. a. albifrons are poorly defined.

Cebus albifrons cuscinus. (Bolivia, Brazil, Colombia, Ecuador, Peru)
This capuchin (here considered a senior synonym of C. albifrons yuracus, following Groves [2001]) occurs south of the Río Guamés in Colombia according to Hernández-Camacho and Cooper (1976) and Defler (2004). However, they place C. albifrons albifrons between the Rios Putumayo and Amazonas in the Colombian trapezium. Aquino and Encarnación (1994), on the other hand, regard the form between the Napo and Putumayo to be C. a. yuracus (= cuscinus). So, the identity of the White-fronted Capuchin between the Napo and Putumayo is confused. A provisional hypothesis would be that that, from the Rio Guamés, C. a. cuscinus south of the Rio Aguarico in Ecuador and south of the Río Napo as far as the Amazonas, in Peru. It extends south along the left (west) bank of the Río Ucayali, occurring along south (right) bank of the Purus to the Rio Acre and taking in the far north-west corner of Bolivia., north of the Río Madre de Dios (Brown and Rumiz 1986; Aquino and Encarnacíon 1994; Anderson 1997). The range limits in the southern part of the distributions of C. a .cuscinus and C. a. albifrons are poorly defined.

Cebus albifrons cesarae. (Colombia)
Cebus a. cesarae, is a well-defined, light coloured subspecies occurring in the Department of Magdalena, southward from Ciénaga Grande, and the lowlands of the Department of Cesar, right bank and north of the Río Magdalena as far as the west bank of the Río César, north to the deciduous and gallery forests of the Río Ranchería, Department of Guajira (Hernández-Camacho and Cooper 1976; Defler 2004).

Cebus albifrons malitiosus. (Colombia)
Central and northern Colombia. Deciduous and humid forests of the northern slopes of the Santa Marta Mountains at least as high as 1,300 m, although the eastern and southern limits of its range are not well defined (Hernández-Camacho and Cooper 1976; Defler 2004).

Cebus albifrons versicolor. (Colombia)
Cauca-Magdalena interfluvium, including the eastern parts of central Antioquia and southern parts of Sucre to the west. It extends north along the slopes of the northernmost reaches of the Cordillera Oriental and along the Serranía de Perijá, west of Lake Maracaibo, and east of Lake Maracaibo to the Serranía de Merida (Bodini and Pérez-Hernández 1987; Bodini 1989; Linares 1998). To the east of the Cordillera Oriental it occurs in Norte de Santander, and Santander (Hernández-Camacho and Cooper 1976; Defler 2004).

Cebus albifrons trinitatis. (Trinidad)
An isolated population on the Island of Trinidad.

Cebus albifrons aequatorialis. (Ecuador, Peru)
All of western Ecuador along the Pacific coast, extending into the Department of Tumbes in Peru (Encarnación and Cook 1998; Tirira and da la Torre 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Cebus albifrons is found in northwestern South America, including Ecuador, Colombia, Venezuela, eastern Peru, and much of Amazonian Brazil (Hill, 1960).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Cebus albifrons is one of the smaller species of the capuchin group. The head is small in comparison to the body and the torso is slender with long, narrow limbs. C. albifrons has a complex color pattern. Overall they are light brown on the back with a lighter ventral side, often in shades of yellow and red. Dorsal fur is long and soft, which contrasts to the short and coarser fur of the venter. The crown of the head has a round, dark patch. Females may have a tuft of hair anterior to this patch. The face is covered by sparse, pale colored hair under which the peach colored flesh is visible. A thin border of white surrounds the face. A stripe, slightly darker than the body color, runs parallel to the spine. The limbs are a range of yellows and red browns. Sexual dimorphism occurs in the species with the males being larger than the females, the tail of the male may be lighter at the tip. Seasonal coat changes can occur; in the dry season, the coat is overall paler, in the rainy season the coat darkens (Hill, 1960).

Range mass: 1100 to 3300 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits dry, deciduous forest in the north of its range, tropical lowland and submontane and montane rain forest, seasonally inundated forest, and savanna forests. Arboreal quadrupeds, they are typically found in the lower to mid-canopy and understorey (Freese and Oppenheimer 1981; Fragaszy et al. 2004; Jack 2007; Tirira 2007).

Frugivores-insectivores. They are extractive, manipulative foragers. Largely sympatric with the tufted capuchins, eitherCebus apella or C. macrocephalus, but the species differ most markedly in their diet through their use of palm fruits (Terborgh 1983; Spironello 1991, 2001). Mean group size for Cebus albifrons is 19.8 individuals, with numbers of males similar to numers of females (adult sex ratio of 1.08). Males disperse. Both sexes take up linear hierarchies, with males dominant to females (Fragaszy et al. 2004). A field study of the ecology and behaviour of C. albifrons albifrons was carried out by Defler (1979a,b) in the llanos of El Tuparro Natinal Park, Colombia. There he observed groups of 8-15 individuals, with one group using a home range of about 120 ha. Groups of up to 35 indviduals use home ranges of similar size (120-150 ha in the tropical humds forests of Ecuador (Tirira 2007).

Size: Adult male 1.7 kg-3.3 kg (mean 2.48 kg); adult female: 1.4-2.3 kg (mean 1.8 kg) (Jack 2007).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

White-fronted capuchins are found in rainforest habitats from sea-level to 2000 meters (Hill, 1960).

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Fruit is the main food and is generally prefered over other available foods. C. albifrons occasionally eats insects or other small invertebrates. According to a year-long study in Peru's Manu National Park, white-fronted capuchins only seek out invertebrates when traveling to fruiting trees, or when droughts reduce fruit availability. Other food sources in times of drought include palm nuts, figs, and nectar. (Terborgh, 1992).

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit; nectar

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: female

Status: captivity:
40.5 years.

Average lifespan

Sex: male

Status: captivity:
25.0 years.

Average lifespan

Status: captivity:
44.0 years.

Average lifespan

Status: wild:
40.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 40.4 years (captivity) Observations: One captive specimen lived 40.4 years (Richard Weigl 2005). There is also one unverified claim of one animal of unknown sex living 44 years in captivity (Hakeem et al. 1996).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

As in other Cebus species, C. albifrons does not appear to have a breeding season, though most births may coincide with the dry season (Nowak, 1991). Peak mating periods are determined by geographic location. Females in estrus actively respond to males who seek to mate. It appears that males may be able to detect females in estrus by chemical cues in her urine (Smuts et al., 1987).

Cebus albifrons gives birth to a single young every 1 to 2 years, with a gestation period of about 150 to 160 days. If the infant dies shortly after birth, the female mates in the next breeding season, but if the infant lives, the female postpones breeding an extra year in order to take care of the infant (Smuts et al., 1987).

Breeding interval: Cebus albifrons gives birth to a single young every 1 to 2 years

Breeding season: Peak mating periods are determined by geographic location.

Average number of offspring: 1.

Range gestation period: 150 to 160 days.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 233 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1310 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1310 days.

Infant care is not restricted to the maternal female in C. albifrons. Other group members will come to the aid of infants in distress and dominant males often care for infants. When infants are under 2 months old other females care for, nurse, and feed them (Smuts et al., 1987).

Males disperse from their natal group upon reaching sexual maturity, females remain with their natal group.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Protecting: Male, Female); post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cebus albifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0094-06|AJ309866|Cebus albifrons| AATCGCTGACTATTTTCAACTAACCATAAAGATATTGGTACACTGTATTTAATATTTGGTGCATGAGCCGGAGCAACAGGAACAGCCTTA---AGTCTTCTAATTCGAGCTGAGCTGGGCCAACCAGGAAGCCTAATAGAAGAC---GACCATGTTTACAATGTTATTGTTACCTCTCACGCATTTATTATAATCTTCTTCATGGTCATACCAATTATAATTGGCGGCTTCGGGAATTGATTAGTGCCTCTAATA---ATCGGCGCCCCCGATATAGCTTTTCCTCGTATAAATAATATAAGCTTCTGACTCCTCCCCCCATCCCTTCTTCTCCTACTTGCCTCTTCAACTCTAGAGGCTGGTGTTGGAACTGGCTGAACAGTCTACCCTCCCCTGGCAGGAAATATATCACACCCTGGAGCCTCTGTAGACTTA---ACTATCTTTTCACTGCATCTAGCGGGTATTTCCTCTATTCTAGGGGCTATTAACTTTATTACAACAATTATTAATATAAAACCACCAGCCACAACCCAATATCAAACACCCCTATTTGTATGATCCGTACTCATTACAGCAATCCTTCTACTTCTCTCCCTCCCAGTCCTAGCTGCT---GGAATTACTATACTATTAACCGACCGTAACCTTAACACCACTTTCTTCGACCCTGCTGGTGGTGGTGACCCCATTCTATATCAACACCTATTTTGATTTTTTGGTCACCCCGAAGTTTATATCCTTATTTTACCAGGGTTTGGGATAATCTCACATATTGTAACATATTACTCTAACAAAAAA---GAGCCATTTGGGTATATAGGAATAGTTTGAGCCATAATATCCATTGGCTTCCTAGGCTTTATCGTATGAGCTCACCATATATTCACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cebus albifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
de la Torre, S., Morales, A. L., Link, A. & Cornejo, F.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
This species is listed as Least Concern due to its wide range, presumed large population, and because it is unlikely to be undergoing a decline that would warrant listing in a threatened category.

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 2000
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Because they are restricted to rainforest habitats, populations of C. albifrons are threatened by habitat destruction due to logging and forest clearing. They are not currently endangered because their habitats continue to be fairly widespread and population numbers remain fairly high. White-fronted capuchins are also hunted for meat in some areas. While this hunting is not excessive and simply maintains the population at a slightly lower level, it is a potential threat (Smuts et al., 1987).

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In eastern Vichada (El Tuparro), Colombia, ecological densities of this species reach 30 individuals/km² (Defler 1979a). Densties on the Río Purité, Colombia, (four sites) were found to range from 4.4 to 15.8 individuals/km² (Defler 2004).
Desnties of Cebus albifrons tend to be lower when sympatric with Cebus macrocephalus (Defler 2004). Freese (1975) estimated a density of 24 individuals/km² in Manu National Park, Peru.

Peres (1988) estimated population densities of Cebus albifrons albifrons at a number of sites in the Braziliian Amazon: Lago da Fortuna (terra firma forest) 7.81 individuals/km²; Lago da Fortuna (várzea forest) 45.8 individuals/km²; Igarapé Açú (terra firma forest) 15.47 individuals/km²; SM1 (terra firma forest) 9.5 individuals/km²; São Domingos(terra firma forest) 25.64 individuals/km².

Rylands (1982) estimated a population density of 4.7-7.5 individuals/km² at Aripuanã, northern Mato Grosso (terra firma forest).

The total population of Cebus albifrons trinitatis is estimated at around 61 with an effective population size of 35 (Census from December 1996 to November 2000, by Kimberly A. Phillips). In Bush Bush Wildlife Sanctuary and the immediate area (Nariva Swamp - a 24,000-ha wetland) surrounding the sanctuary, the subpopulation was 49. Troops were commonly encountered in Bush Bush. However, in Trinity Hills Wildlife Sanctuary, the subpopulation totals 12 and capuchins are encountered very rarely (Agoramoorthy and Hsu 1995; Phillips and Abercrombie 2003).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The major threat to this species across its range is hunting combined with forest loss and fragmentation. .

On Trinidad, Cebus albifrons trinitatis the two subpopulations in Trinity Hills Wildlife Sanctuary and Bush Bush Wildlife Sanctuary are entirely isolated. In Trinity Hills, hunting is allowed in some areas adjacent to the sanctuary. Hunting camps are established near the border of the sanctuary, though the extent of incursions into the sanctuary per se is unknown. In Bush Bush, the main threats are habitat destruction due to illegal logging and planting of marijuana, which occurs regularly (Phillips and Abercrombie 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix II. It occurs in a number of protected areas across its range:

Cebus albifrons trinitatis

Trinity Hills Wildlife Sanctuary (6483 ha) (Bacon and ffrench 1972)
Bush Bush Wildlife Sanctuary and immediate surrounding area (1,550 ha) (Bacon and ffrench 1972)

Cebus albifrons versicolor

Colombia
Nevado del Huila National Park (158,000 ha) ? (Defler 1994)
Catatumbo-Bari National Park (158,125 ha) (Defler 1994)

Venezuela
Perija National Park (295,288 ha)?

Cebus albifrons malitiosus

Tayrona National Park (15,000 ha) (Defler 1994)
Sierra Nevada de Sanata Marta National Park (383,000 ha) (Defler 1994)

Cebus albifrons cesarae

Macuira National Park (25,000 ha)? (Defler 1994)
Los Flamencos Fauna and Flora Sanctuary (7,000 ha)? (Defler 1994)
Ciénaga Grande de Santa Marta Fauna and Flora Sanctuary (23,000 ha) (Defler 1994)

Cebus albifrons albifrons

Brazil
Amazonas National Park
Serra do Divisor Narional Park

Colombia
Amacayacu Natural National Park (293,000 ha) (Defler 1994)
Cahuinarí Natural National Park (575,500 ha)? (Defler 1994)
Serrania de Chiribiquete Natural National Park (1,280,000 ha)
La Paya Natural National Park (442,000 ha) (Defler 1994)
Serranía de la Macarena Natural National Park (630,000 ha)
Chiribiquete Natural National Park (1,280,000 ha)? (Defler 1994)
Puinawai Natrual Reserve (1,092,000 ha)? (Defler 1994)
Nukak Natural Reserve (855,000 ha)? (Defler 1994)
El Tuparro National Park (548,000 ha) (Defler 1979a,b)

Ecuador
Sangay National Park (517,765 ha) (Tirira 2007)
Sumaco-Napo Galeras National Park (205,249 ha) (Tirira 2007)
Yasuní National Park (982,300 ha) (Tirira 2007)
Cayambe Coca Ecological Reserve (403,103 ha) (Tirira 2007)
Cofán-Bermejo Ecological Reserve (55,451 ha) (Tirira 2007)
Cuyabeno Faunal Protection Reserve (Tirira 2007)

Peru
Manu National Park (1,532,806 ha) (Terborgh 1983)
Pacaya-Samiria National Reserve (2,080,000 ha)

Venezuela
Serrania de la Neblina National Park (1,360,000 ha) (in range)
Parima Tapirapecó National Park (3,420,000 ha) (in range)
Jauá-Sarisarinama National Park (330,000 ha) (in range)
Yapacana National Park (320,000 ha) (in range)

Cebus albifrons aequatorialis

Ecuador
Machalilla National Park (56,814 ha)
Mache-Chindul Ecological Reserve (119,172 ha)
Manglares Churute Ecological Reserve (49,894 ha)
Cotacachi-Cayapas Ecological Reserve (243,638 ha)

Peru
Cerros de Amotape National Park (91,300 ha)
Tumbes Reserved Zone
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

None known, Cebus albifrons do not raid human food crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

White-fronted capuchins help to disperse the seeds of fruits they eat in their feces. This may carry propagules to an area that might not normally be reached, far from the perimeter of the tree. (Terborgh, 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!