Overview

Brief Summary

Biology

The white-bellied spider monkey is active during the day and spends most of its time in the canopy (2). It feeds mainly on ripe fruit; the composition of the diet changes depending on what fruits are available at a given time (7). Group size varies throughout the year, becoming larger when fruit is particularly abundant (2). Males cooperate to defend the boundaries of the territory against other groups (2). Mating occurs throughout the year. Females give birth to a single young following a gestation period of around 225 days. Upon reaching maturity, young females disperse from their natal group, whereas males remain (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Like all spider monkeys, the white-bellied spider monkey, also known as the long-haired spider monkey, has long, slender limbs and very mobile shoulder joints that aid in swinging hand-over-hand below branches (2) (4). The thumbs are either absent or reduced to a small stump, resulting in a hook-like hand structure that facilitates fast swinging below the branches (5). A further adaptation to this arboreal lifestyle is the extremely flexible prehensile tail that is used as an extra limb (2). The coat is black or brown, while the underparts, hindlimbs and the base of the tail are paler brownish-white (2). In one-third of the population, there is a yellowish-brown or white triangular patch on the forehead (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Ranges in north-eastern Peru, eastern Ecuador, lowland Colombia, east of the Cordillera Oriental, southern Venezuela, and north-western Brazil, west as far as the Rio Branco. The distribution of this species is not well known, and defies easy description. In Colombia, Defler (2003, 2004) informed that it has been recorded in the piedmont and Cordillera Oriental only as far north as the Río Upía drainage in the department of Boyacá. It occurs in the region of the Sierra de La Macarena, eastern Caquetá and the Coehmaní rapids in the south-east of the department of Caquetá. It is rare west of the Río Yarí. It has been seen on the upper Río Mesay, and recorded opposite the mouth of the Río Pirá-Paraná on the right bank of the Río Apaporis, and on the lower right bank of the Apaporis at a salado (clay-lick) site near the Estrella rapids (Defler 2003, 2004). According to Defler (2003, 2004), there is no evidence for its occurrence between the ríos Caquetá and Putumayo, except in the most westerly, upper reaches. Ateles belzebuth extends south along the piedmont into Ecuador, but is evidently absent south of the middle and lower Putumayo (Province of Sucumbíos) and is restricted to the south of Río Napo (de la Torre 2000; Tirira 2007). From there it occurs throughout the Ecuadorian Amazon into northern Peru. The distribution map of Aquino and Encarnación (1994a, p.120) shows the occurrence of A. belzebuth throughout northern Peru, between the Río Putumayo and Amazonas and along the left bank of the Río Ucayali, and including the basins of the ríos Napo, Tigre, Marañón, Pastaza, Pacaya and Samiria, south as far as the Río Cushabatay, a tributary pf the Río Ucayali (Ateles chamek replacing it south of the Cushabatay). The range in Peru extends right through the Putumayo/Napo interfluvium up to the Ecuadorian border, but it would seem ends near the mouth of the Río Aguarico, and not extending into Ecuador between these rivers (Tirira 2007). Its occurrence between the Rios Putumayo and Amazonas in Peru would indicate that it occurs in the Colombian trapezium, but there is no evidence that this is so (Defler 2003, 2004). In Brazil, it is believed to occur north of the Rio Solimões as far as the mouth of the Rio Japurá, east to the Rio Negro and west (right) bank of the Rio Branco. It is absent from the interfluvium of the Rios Solimões and Negro, east of the mouth of the Rio Japurá and south from opposite the mouth of the Rio Branco. Ateles belzebuth occurs throughout the region north of the Rio Negro and west of the Rio Branco in Brazil, extending into Venezuela north towards the Río Orinoco (limited by the llanos/forest interface) and in the east to the left bank of the Río Caura (Bodini and Pérez-Hernández 1987). It would seem that there are no known localities which connect the Brazilian/Venezuelan populations with those of south-western Colombia, Ecuador and northern Peru. The occurrence of this species between the Ríos Putumayo and Amazonas-Napo requires further field research. The species has been observed at altitudes up to 1,300 m on the eastern slope of the Cordillera Oriental (Hernández-Camacho and Cooper 1976).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

White-bellied spider monkeys, Ateles belzebuth, are found in the northeastern portion of the Amazon in South America. Colombia, Venezuela, Peru, Ecuador, and Brazil are all countries that this species is known to inhabit.

Biogeographic Regions: neotropical (Native )

  • Cant, J., D. Youlatos, M. Rose. 2003. Suspensory locomotion of Lagothrix lagothricha and Ateles belzebuth in Yasuni National Park, Ecuador. Journal of Human Evolution, 4: 685-699.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This New World monkey is found in Colombia, Brazil, Ecuador, Peru and Venezuela (1). Its range in Colombia has previously been greatly overestimated; it is found in the lowlands where there has been massive colonisation by humans, as well as in the piedmont forests of the north. It is currently the most threatened species in the Colombian Amazon (6). In Ecuador, the population has declined by 30% in the previous three generations (1). In Brazil, this monkey is found to the north-west of the Amazon (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

A. belzebuth has a similar shape to A. paniscus, with arms and legs longer than the body. These monkeys also have a prehensile tail. A. belzebuth differs from A. paniscus in that it has a pale or white triangular patch on the forehead. Another distinguishing characteristic of this species is that the dorsal side of the animal can range from black to dark or light brown whereas the ventral side is pale brown to white. These animals have bright whitish eyeshine. The prehensile tail of these monkeys is used for locomotion and foraging, and can range from 61 to 88 cm in length. The legs of this species are long and slender. Weight ranges from 5.9 to 10.4 kg. Male body length that ranges from 42 to 50 cm, whereas females can be anywhere from 34 to 59 cm.

Range mass: 5.9 to 10.4 kg.

Range length: 34 to 59 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

  • Schafer-Witt, C., C. Welker. 1990. New World Monkeys. Pp. 250-251 in B Grzimek, ed. Grzimek's Encyclopedia of Mammals, Vol. 2, 2 Edition. New York: McGraw-Hill Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is dependent on high primary forest. Generally associated with terra firma clay soil forests.

Spider monkeys travel and forage in the upper levels of the forest. They spend much time in the canopy and also use the middle and lower strata, but are rarely seen in the understorey. In accordance with their use of the highest levels of the forest, they are highly suspensory. When travelling they spend more time hanging from branches, moving by brachiation and arm swinging, and climbing than they do walking or running on all fours. They are highly frugivorous and feed largely on the mature, soft parts of a very wide variety of fruits, which comprise 83% of their diet and are found mainly in the emergent trees and upper part of the forest canopy (Van Roosmalen and Klein 1988). They also eat young leaves and flowers (both especially at times of fruit shortage during the beginning of the dry season), and besides such as young seeds, floral buds, pseudobulbs, aerial roots, bark, decaying wood, and honey, and very occasionally small insects such as termites and caterpillars. They play a significant role as seed dispersers. Van Roosmalen (1985; Van Roosmalen and Klein 1988) found that A. paniscus was dispersing the seeds of at least 138 species (93.5% of all fruits species used) through their ingestion and subsequent defecation (endozoochory). A further 10 species were being dispersed by the monkeys carrying them off some distance from the tree before dropping them (exozoochory). In only 23 species were the seeds being ruined or eaten (seed predation).

Spider monkeys live in groups of up to 20-30 individuals (for review see Van Roosmalen and Klein 1988). However, they are very rarely all seen together, and nearly always to be found travelling, feeding and resting small in groups of varying size and composition, the only persistent association being that of a mother and her offspring (McFarland Symington 1990). Izawa et al. (1979) reported on subgroup sizes of Ateles belzebuth in La Macarena, Colombia. Group members will also travel on their own. Each female in the group has a “core area” of the group’s home range which she uses most. Subgroups observed by Klein and Klein (1976) were most frequently of 1-4 individuals. Klein and Klein (1976, 1977) estimated 259-388 ha ranges with 20-30% overlap for A. belzebuth in La Macarena National Park, Colombia. Castellanos (1997) estimated a home range of 148 ha on the Río Tawadu in the Río Caura basin, Venezuela. Ateles are rarely seen in association with other primates and mostly they are occasional and ephemeral, resulting from the simultaneous occupation of fruiting trees.

Field studies of the behaviour and ecology of this species have been carried put by Klein and Klein (1975, 1976, 1977) and Ahumada (1989, 1992) in La Macarena, Colombia, Nunes (1988, 1996) in the Maracá Ecological Station, Brazil, and Pozo (2001, 2004a, 2004b, 2004c) in the Yasuní National Park, Ecuador. Castellanos (1995, 1997; Castellanos and Chanin 1996) studied the feeding ecology of Ateles belzebuth along the middle and lower reaches of the Río Tawadu, a tributary of the Río Nichare, a tributary of the Rio Caura.

Six estimated birth dates given by Klein (1971) for A. belzebuth, were spread throughout the year (December, January, April, September, October and November). Spider monkeys apparently reach sexual maturity at 4-5 years of age (Klein 1972; Eisenberg 1973, 1976). They give birth to single offspring after a long gestation period of 226-232 days, with a minimum theoretical interbirth interval in captivity of 17.5 months, but in the wild probably as long as 28-30 months (Eisenberg 1973, 1976). Late maturation and long inter-birth intervals make it difficult for them to recover from hunting and other threats.

Size
H&B 46-50 cm; TL 74-81 cm.
Adult male weight mean 8.3 kg (n=10), adult female weight mean 7.9 kg (Smith and Jungers 1997).
Adult male weight 7.3-9.8 kg (mean 8.5 kg, n=12), adult female weight 5.8-10.4 kg (mean 8.1 kg, n=15) (Ford and Davis 1992).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

White-bellied spider monkeys are found in the rainforests of northern South America. They live in the upper levels of tall forests and can be found at a maximum elevation of 1,800 m.

Range elevation: 1,800 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits subtropical or tropical lowland and montane forests (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of A. belzebuth consists mainly of fruits, but these primates will also eat seeds, leaves, and sometimes dead wood. The amount of time an animal spends about 22% if its time foraging versus 15% of its time moving. Of the time these animals spend feeding, about 83% of the time is spent obtaining ripe fruits. About 7% of their foarging time is spent eating leaves, and the remaining 10% is used getting other food items.

Most feeding occurs during the early morning and late afternoon and occasionally the animal is known to feed during nights with a bright moon.

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers; sap or other plant fluids

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Although it occurs with only a few species of seeds, A. belzebuth is known to occasionally increase the rate of germination of some plants. Because these animals eat mostly fruits that are rich in lipids, they may be the best dispersers for fruits that fall into this category.

Ecosystem Impact: disperses seeds

  • Stevenson, P., M. Castellanos, J. Pizarro, M. Garavito. 2001. Effects of Seed Dispersal by Three Ateline Monkey Species on Seed Germination at TiniguaNational Park, Colombia. International Journal of Primatology, 23: 1187-1204. Accessed February 12, 2004 at http://80-www.kluweronline.com.proxy.lib.umich.edu/issn/0164-0291/contents.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Possible predators of this species may include felids or birds of prey such as eagles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

A. belzebuth communicates with long calls to identify other members of the group and their territory. It also uses barks and screams which are probably used to signal danger. Tactile communication, in the form of both aggression and affiliative touching (like grooming) also occurs. Visual signals, such as approaching a conspecific, provide important communication about intentions, willingness to mate, and possibly dominance position.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

  • Broekema, I. 2002. "The Primate Foundation of Panama" (On-line). Accessed March 10, 2004 at http://www.primatesofpanama.org/index.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of this species is unknown, but is similar to other spider monkeys. In captivity, the lifespan is 30 to 40 years for other species of spider monkeys.

Range lifespan

Status: captivity:
30 to 40 years.

Average lifespan

Status: captivity:
28.0 years.

Average lifespan

Sex: male

Status: captivity:
26.0 years.

Average lifespan

Sex: female

Status: captivity:
26.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 37 years (captivity) Observations: One wild born specimen of the *hybridus* subspecies was about 37 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

A. belzebuth live in groups in which there are three times as many females as there are males. The total number of individuals in a group ranges from 20 to 40. Mating occurs randomly, and females will mate with one or several males in one day. The reproduction of this species is similar to that of other members of Atelinae especially the A. geoffroyi and A. paniscus. Variation occurs with the species.

Mating System: polygynandrous (promiscuous)

Females give birth to one offspring every 2 to 4 years. Their estrus cycle is 24 to 27 days in length, and gestation length is between 210 and 225 days.

Copulations are initiated by females, who approach males. Like other species of Ateles, it is likely that this pattern of initiating copulation leads to high levels of female mate choice, and reduces aggression between males.

Although not reported for this species, males in other species of spider monkeys which have been studied ejaculate after one mount and one series of thrusts.

The timing of sexual maturity in A. belzebuth is not known, but is probably similar to other species in the genus. In these species, sexual maturity of both males and females occurs sometime between 4 and 5.5 years of age.

Breeding interval: These animals can breed every two years.

Breeding season: Breeding is aseasonal in this species.

Average number of offspring: 1.

Range gestation period: 210 to 225 days.

Average age at sexual or reproductive maturity (female): 4 years.

Average age at sexual or reproductive maturity (male): 5 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1826 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1461 days.

The exact time of weaning in this species is not known, but is similar to that of other spider monkeys. At 12 to 15 months the infants are weaned, but independence is not achieved until at least 17 months of age. As in most primates, females provide the bulk of parental care. Male parental behavior for this species has not been mentioned.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents; extended period of juvenile learning

  • Hrdy, S., P. Whitten. 1987. Patterning of Sexual Activity. Pp. 370-384 in B Smuts, D Cheney, R seyfarth, R Wrangham, T Strusaker, eds. Primate Societies. Chicago and London: The University of Chicago Press.
  • Robinson, J., C. Janson. 1986. Capuchins, Squirrel Monkeys, and Atelines: Socioecological Convergence with Old World Primates. Pp. 69-82 in B Smuts, D Cheney, R Seyfarth, R Wrangham, T Struhsaker, eds. Primate Societies. Chicago: University of Chicago Press.
  • Rudolph, E. 2002. "Threatened Andean Species at the Ecozoological San Martin" (On-line). Accessed February 10, 2004 at http://www.sanmartinzoo.org/images/animals/spidermonkeyANDEAN.html.
  • Schafer-Witt, C., C. Welker. 1990. New World Monkeys. Pp. 250-251 in B Grzimek, ed. Grzimek's Encyclopedia of Mammals, Vol. 2, 2 Edition. New York: McGraw-Hill Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ateles belzebuth

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA2266-09|FJ785422|Ateles belzebuth| ACTCGCTGATTATTCTCAACCAACCATAAAGACATCGGAACACTATACCTACTATTTGGCGCATGAGCAGGGGCAGTAGGAACAGCCCTA---AGCCTCCTAATTCGAGCGGAACTCGGTCAACCAGGGAGTCTAATAGAAGAC---GATCATGTTTATAATGTAATCGTTACCTCCCATGCATTTATCATAATTTTCTTTATAGTCATGCCAATTATAATTGGAGGCTTTGGAAACTGACTTGTTCCCTTAATA---ATTGGTGCCCCCGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTTCTACCCCCATCCCTCTTACTTCTACTCGCATCATCAACCCTAGAGGCCGGCGCCGGTACTGGCTGAACAGTTTACCCACCCTTAGCAGGAAATATATCACACCCAGGAGCCTCTGTAGATCTG---ACTATTTTTTCACTCCACCTAGCAGGTGTTTCTTCCATTTTAGGGGCCATTAACTTTATTACAACAATTATTAATATAAAACCCCCAGCCATAACCCAATACCAAACACCTCTCTTTGTCTGATCAGTCCTTATTACAGCAGTTCTCCTACTTCTATCCCTTCCAGTTCTAGCTGCT---GGAATTACAATATTATTAACTGACCGCAATCTTAATACTACCTTTTTTGACCCCGCTGGTGGAGGAGACCCAATCTTATATCAACATTTATTCTGATTCTTTGGACACCCTGAAGTATATATTCTCATTCTCCCTGGATTTGGAATAATTTCACATATTGTAACATATTACTCTAACAAAAAA---GAACCATTCGGTTATATAGGAATGGTATGAGCCATAATATCTATTGGCTTCCTAGGATTTATCGTATGAGCTCACCATATATTTACTGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ateles belzebuth

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Boubli, J.-P., Di Fiore, A., Stevenson, P., Link, A., Marsh, L. & Morales, A.L.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
Listed as Endangered as there is reason to believe the species has declined by at least 50% over the past 45 years (three generations) due primarily to hunting and habitat loss.

History
  • 2003
    Vulnerable
    (IUCN 2003)
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Vulnerable
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

A. belzebuth is considered endangered by IUCN, and is listed on CITES Appendix I. The major threats to this species are loss of habitat through deforestation and hunting. National parks in Colombia aid to the conservation of A. belzebuth as well as specific protected habitats and isolation of the habitats from development.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1). Listed under Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Still common within protected areas. Klein and Klein (1976) estimated a population density of 15-18 individuals/km² in La Macarena, Colombia. Ateles population densities in various species and study sites are discussed by McFarland Symington (1988), who concluded that the main factors involve the abundance and productivity of certain key plant resources.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The major threat is heavy subsistence and market hunting for food (to the point of local extirpation). There is also some mining taking place within its range resulting in localized habitat loss. In south-eastern Colombia, habitat loss takes place due to clearance of forest for coca plantations, accompanied by fumigation of coca plantations in south-eastern Colombia that results in defoliation of contiguous forests.

In Peru, Aquino and Encarnación (1994a) indicated that it is extinct in large areas of its distributional range, and reported that "small remnant populations, subject to a strong hunting pressure, are known from the Río Alto Curaray, an affluent if the Río Napo" (p.40).

In Ecuador, Tirira (2007) recorded that it is rare near human settlements, it is hunted, and in demand for pets, but can be common in undisturbed forests where it is not molested. Defler et al. (2003; Defler 2003, 2004) consider it to be the most endangered of any of the Colombian Amazonian primates, its range being coincident with the most heavily colonized parts of the region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The most serious threats facing this spider monkey are hunting and deforestation for agriculture and for logging (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is confirmed, or may occur, in a number of protected areas:

Brazil
Pico da Neblina National Park (2,298,154 ha)
Maracá Ecological Station (103,995 ha) (Nunes et al. 1988))
Juamí-Japurá Ecological Station (832,078 ha) (in range)
Serra da Mocidade National Park (373,130 ha) (in range)
Niquiá Ecological Station (282,830 ha) (in range)
Amazonas National Forest (1,573,100 ha) (in range)
Roraima National Forest (2,664,685 ha) (in range)

Colombia
Amacayacu Natural National Park (293,000 ha) (possibly in range: Defler 2004)
Cahuinarí Natural National Park (575,500 ha) (possibly in range: Defler 2004)
Serrania de Chiribiquete Natural National Park (1,280,000 ha) (in range: Defler 2004)
Cordillera de los Picachos Natural National Park (286,600 ha) (Defler 2004)
Cueva de los Guacharos Natural National Park (9,000 ha) (in range: Defler 2004)
La Paya Natural National Park (442,000 ha) (possibly in range: Defler 2004; reported by interview Palanco-Ochoa et al., 1999)
Tinigua Natural National Park (201,875 ha) (Defler 2004)
Serranía de la Macarena Natural National Park (630,000 ha) (Ahumada 1989, 1992)
Nukak Natural National Reserve (855,000 ha) (in range: Defler 2004)
Puinawai Natural National Reserve (1,092,500 ha) (in range: Defler 2004)

Ecuador
Podocarpus National Park (146,280 ha) (Tirira 2007)
Sumaco-Napo Galeras National Park (205,249 ha) (Tirira 2007)
Yasuní National Park (982,300 ha) (Pozo 2001; Tirira 2007)
Cayambe-Coca Ecological Reserve (403,100 ha) (Tirira 2007)
Cofán-Bermejo Ecological Reserve (55,451 ha) (Tirira 2007)

Peru
Pacaya-Samiria National Reserve (2,080,000 ha) (in range: Aquino and Encarnación 1994a). Soini et al. (1989) informed that it exists in low numbers in the Pacaya-Samiria basin. Neville et al. (1976) reported one sighting of Ateles chamek in the reserve.

Venezuela
Serrania de la Neblina National Park (1,360,000 ha) (in range)
Parima Tapirapecó National Park (3,420,000 ha) (in range)
Duida-Marahuaca National Park (210,000 ha) (in range)
Jauá-Sarisarinama National Park (330,000 ha) (in range)
Yapacana National Park (320,000 ha) (in range).

It is listed on Appendix II of CITES.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The white-bellied spider monkey occurs in a number of protected areas in Colombia (La Macarena, Tinigua and Picachos) but there has been extensive human colonisation around these parks and so there is a need for hunting to be controlled in these areas. Unfortunately, the presence of insurgents in some areas complicates park management (6). There is a substantial subpopulation of this species in Colombia between the Rios Caguan and Yari. This area is, at the present time, relatively isolated, but developments that may enable colonists to move into the area will quickly endanger this subpopulation (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of A. belzebuth on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known benefits this species provides to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-fronted spider monkey

The white-fronted spider monkey (Ateles belzebuth), also known as the long-haired or white-bellied spider monkey, is an endangered species of spider monkey, a type of New World monkey. It is found in the north-western Amazon in Colombia, Ecuador, Venezuela, Peru and Brazil, ranging as far south as the lower Ucayali River and as far east as the Branco River.[2] In the past, the Peruvian, brown and white-cheeked spider monkeys have been treated as subspecies of A. belzebuth. As presently defined, the white-fronted spider monkey is monotypic.[1] It has a whitish belly and a pale patch on the forehead, which, despite the name white-fronted spider monkey, often is orange-buff.[3][4] They live in groups of 20 to 40 individuals, splitting into small parties of 1 to 9 when in activity.[5]

Vernacular names include mono prieto, mico prieto and marimonda (Colombia).

Contents

Locomotion

All members of Ateles are semi-brachiators, and this species has an intermembral index of 105. They have a fairly dorsally placed scapula to allow for increased mobility involved in brachiation. Their prehensile tail with a hairless gripping pad at the end also allows for this locomotion, which then means they have increased caudal vertebrae, with about 31 caudal vertebrae as opposed to another platyrrhine like Cebus with only 23 on average. This tail allows for additional grasping of branches, which means there is less lateral movement while brachiating which increases efficiency. The hairless gripping pad of the underside of the tip of their tail is often compared to a finger, since it allows surface gripping. Their curved hands with long metacarpal bones allows for easy brachiation. They do not have an external thumb, which sets them apart from most other primates.

Dentition

Ateles belzebuth has a dental formula of 2.1.3.3. As far as patterns within the teeth, there is a lot of variation but the following are often found within Ateles. Larger incisors and small molars reflect the largely frugivorous diet, with a diastema separating the upper canines from the upper incisors, for the lower incisor. The upper premolars have one to two cusps, with the first premolar having only one cusp, a paracone. The second premolar has a paracone and protocone cusp connected by transverse crest. The third premolar has three cusps, paracone, metacone, and protocone, with the metacone and protocone connected by a crista oblique. There is a recorded hypocone on the third premolar. In the bottom premolars, the first premolar has one cusp although it can be bicuspid. The second and third premolar generally have 2-3 cusps, although the second bottom premolar has an entoconid and hypoconid and the third bottom premolar in belzebuth has five cusps with a small hypoconulid. Upper molars generally have four cusps although the third molar may not have a hypocone (might even have only two cusps). With the bottom molars, there are generally four cusps and a fifth cusp on the third molar.

References

  1. ^ a b Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 150. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100394. 
  2. ^ a b Boubli, J.-P., Di Fiore, A., Stevenson, P., Link, A., Marsh, L. & Morales, A.L. (2008). "Ateles belzebuth". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/2276. Retrieved 19 January 2012.  Database entry includes justification for why this species is endangered.
  3. ^ Sumac Muyu Foundation (2009). Photo of Ateles belzebuth. Flickr
  4. ^ raskin227 (2009). Photo of Ateles belzebuth. Flickr
  5. ^ Louise Emmons and Francois Feer (1997). Neotropical Rainforest Mammals. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!