Overview

Distribution

Range Description

Based on a specimen collected at Maipures, near the mouth of the Río Tomo on the Río Orinoco, Defler and Bueno (2007) indicated that the night monkeys of eastern central Colombia north of the Río Guaviare are probably A. brumbacki.

Hershkovitz (1983) proposed that A. trivirgatus was the form in Colombia between the Rios Vaupés and Inirida, but Defler (2003, 2004) indicated that A. vociferans occurred in this region and that A. trivirgatus as such is restricted to the east of the Ríos Negro, lower Guainia, and Atabapo and, below the mouth the Río Atabapo, the Río Orinoco. To the north, in Venezuela, A. trivirgatus occurs south of the Río Orinoco and east as far the middle Rio Caroni. The extension east beyond the Río Caura is based on just one locality on the upper Caroni (Bodini and Pérez-Hernandez 1987; Linares 1998). A. trivrigatus is confined to north (left bank) of the Rio Negro to its mouth, extending east, north of the Rio Amazonas, as far as the Rio Trombetas. North it reaches the Serra da Pacaraima, but does not it seem extend into Guyana. In the state of Roraima, the Rio Mucajaí is indicated (by Hershkovitz (1983) as marking its northern limits.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Aotus trivirgatus cover most of tropical South America. From north to south they are found from Panama to northern Argentina. From east to west their range extends from the mouth of the Amazon to its headwaters in Peru and Ecuador. (Macdonald 1997)

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Both males and females of Aotus trivirgatus are similar in size with a body length of 24 to 47 cm. Tail length ranges from 22 to 42 cm. Coats range from grizzled brown, gray or reddish backs and off white to orange undersides. Coat color changes from one geographical location to another and for this reason, among others, A. trivirgatus is often separated into many different species or sub-species by different researchers. Aotus trivirgatus is the only nocturnal primate of the neotropics [See comments below]. They have the largest olfactory bulbs and accessory olfactory bulbs of all the New World monkeys presumably due to their reliance on smell during nocturnal activity. They also have large brown/orange eyes. The distinctive markings of the face include a triangular black patch between the eyes and black stripes on the sides, framing their otherwise white face.

(Macdonald 1997, Hershkovitz 1983, Wright 1994)

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 800 g.

Average basal metabolic rate: 2.499 W.

  • Hershkovitz, P. 1983. Two new species of night monkeys, genus Aotus (Cebidae, Platyrrhihi) A preliminary report of Aotus taxonomy. American Journal of Primatology, 4: 209-243.
  • Macdonald, D. 1997. Encyclopedia of Mammals. NY: Facts on File Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Night monkeys typically occur in primary and secondary forest (including disturbed forest and selectively logged forest), seasonally flooded and terra firma, lowland forest, submontane forest (Hernández-Camacho and Cooper 1976; Defler 2003, 2004). Aquino and Encarnación (1994b) reviewed the habitat and forest preferences of the genus.

Night monkeys are nocturnal: they are most active at dawn and dusk. The only exception is Aotus azarae azarae of the Chaco of southern Bolivia, Paraguay and Argentina, which is cathemeral (active during night and day). They are frugivorous; their diet includes fruit, nectar and flower (seasonally important for the A. a. azarae in the Chaco), leaves, and small animals prey such as insects (Wright 1989; Fernandez-Duque 2007).

They are socially monogamous, living in small groups of an adult pair and offspring of different ages (infant, one or two juveniles and sometimes a subadult. In A. a. azarae a significant number of adults range alone. They may be subadults that have left their natal groups or older adults which have been evicted from their groups by competitors (Fernandez-Duque and Huntington 2002; Fernandez-Duque 2004). Both sexes disperse. Males care for the infants (carry them) (Rotundo et al. 2002, 2005). Lone adults were observed by Villavicencio Galindo (2003) in northern Colombia. Night monkeys are territorial—groups occupy overlapping territories of 5-18 ha (depending on the species and location) (Wright 1978, 1981; Fernandez-Duque 2007). Wright (1994) and Fernandez-Duque (2007) review the behaviour and ecology of the genus.

Captive male A. lemurinus reach sexual maturity when 2 years old, and captive female A. vociferans and A. nancymaae first breed when 3-4 years old (Dixson 1983; Fernandez-Duque 2007). In the wild, male A. azarae reach adult weight only when about 4 years old, and age at first reproduction is about 5 years of age (Juárez et al. 2003; Fernandez-Duque 2004). Single offspring are the rule. Wright (1985) recorded births between August and February for A. nigriceps in Peru (Manu National Park), and Aquino et al. (1990) indicated a birth season between December and March for A. nancymaae in north-eastern Peru.

Size:
Adult male weight average 1.2 kg (n=1), adult female weight 1.0 kg (n=1) (Fernandes 1993).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Aotus trivirgatus can be found from sea level to 3200 feet elevation, in habitats ranging from rain forests and cloud forests to bordering savanna. They have a narrow range of temperature tolerance between 28 and 30 degrees C. They are arboreal creatures and are generally found traveling from one fruit tree to another throughout the season. Aotus trivirgatus is found to prefer large canopied fruit trees.

(Baer et al. 1994)

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Aotus trivirgatus eat primarily fruits, insects, nectar and leaves. They will also complement their diet with lizards, frogs and eggs for protein. During times when food is scarce, they seek out mostly nectar, figs and insects. At this time of year they seem to have the advantage over similar sized diurnal species that were chased away from these food sources by larger diurnal monkey.

(Baer et al. 1994)

Animal Foods: amphibians; reptiles; eggs; insects

Plant Foods: leaves; fruit; nectar

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
18.5 years.

Average lifespan

Status: captivity:
25.3 years.

Average lifespan

Status: wild:
20.0 years.

Average lifespan

Status: wild:
12.0 years.

Average lifespan

Status: captivity:
19.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30.1 years (captivity) Observations: One captive specimen was still alive at 30.1 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Aotus trivirgatus live in monogamous pairs. There is evidence of long term pair bonding.

Mating System: monogamous

Aotus seem to rely most heavily on calls to find mates. Since calls are not common among Aotus trivirgatus, a hoot usually indicates a lone male or female looking for a mate. Copulations generally take place at night, though they have been observed in the day. Females give birth to only one offspring each year and rarely twins. Infants are large and precocial at birth. Gestation length is 133 days. Mating takes place around August and September such that infants are born in the season of high fruit production. (Baer et al. 1994, Macdonald 1997)

Average birth mass: 88.5 g.

Average gestation period: 142 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
821 days.

Males are the primary caregiver of infants. Care includes carrying, guarding, playing with and sharing food with infants. This demands a significant amount of energy, as the males carry infants up to four months of age and often lag behind the rest of the group. Mothers nurse their young every 2 to 3 hours. Infants are large in comparison to their parents' body mass and grow quickly. Infant size and growth might explain the evolutionary adaptation of monogamy and male parental care, since infants demand more care than a single mother can provide.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Protecting: Male); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aotus trivirgatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0180-06|AY250707|Aotus trivirgatus| AACCGCTGATTATTTTCAACCAACCATAAAGACATCGGAACACTATATCTATTATTTGGTGCTTGAGCGGGGGCAGTGGGAACAGCCCTA---AGCCTTTTAATTCGAGCAGAATTAGGTCAACCAGGAAGTCTGATGGAAGAT---GATCATGTATACAACGTTATTGTTACTGCCCACGCATTCATTATAATTTTCTTTATAGTAATACCGATTATAATCGGGGGATTTGGAAACTGACTAGTTCCCCTAATA---ATTGGTGCCCCAGACATAGCATTCCCCCGAATAAATAATATAAGCTTCTGACTTCTACCCCCATCTCTACTGCTCTTACTTGCATCCTCAACTCTAGAAGCCGGCGCAGGAACCGGCTGAACAGTCTATCCACCCTTAGCAGGAAATATATCACACCCAGGAGCCTCTGTAGATCTA---ACTATTTTCTCACTTCATCTGGCAGGTATTTCTTCAATTCTAGGAGCCATTAACTTTATTACAACAATCGTTAATATAAAGCCCCCAGCCATGACCCAATACCAAACACCCCTTTTTGTCTGATCCGTCCTTATCACAGCAGTCCTCTTACTCCTCTCTCTTCCAGTCCTAGCCGCC---GGAATTACTATACTGCTCACCGACCGTAACCTTAATACTACTTTCTTTGATCCTGCCGGTGGCGGCGACCCTATTCTATATCAACACCTATTTTGATTCTTCGGACACCCTGAAGTATATATTCTTATTCTACCGGGCTTTGGAATAATTTCACATATCGTAACATATTACTCCAACAAAAAA---GAACCATTTGGGTATATAGGAATAGTCTGAGCTATAATATCCATTGGTTTCCTAGGATTTATTGTATGAGCCCATCACATATTTACAGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aotus trivirgatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Veiga, L.M. & Rylands, A.B.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
This species is listed as Least Concern due to its wide range, presumed large populations, and because there are no major threats believed to be resulting in a significant population decline at present.

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Aotus trivirgatus are being threaten by extensive deforestation of the tropical rainforests of South America. They are sensitive to clear cutting as well as selective deforestation, because this limits the diversity of diets within each group's limited territory. Owl monkeys are also hunted for their meat, skins, skulls, and teeth. They are hunted primarily by subsistence hunters who have been forced to turn to these smaller monkeys for food because larger game is no longer available. Trade to the U.S. and other countries as lab animals and pets also diminished the populations in the 70's. Today government bans in most South American counties and the U.S. limit export and import, thus reducing the impact of trapping as a threat. Protected areas in many South American countries have also helped in the conservation of this species. Unfortunately, due to economic and political problems, bans on hunting, trapping and deforestation in many of these areas are not enforced. (Baer et al. 1994)

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Bolivar, Colombia, Green (1978) estimated a density of 0.5 groups/km² or 1.5 individuals/km². Aquino and Encarnación (1994b) reviewed population structure and densities for the genus.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This is a wide-ranging species, and there is no evidence of any particular threat other than habitat loss.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Brazil, the species is confirmed, or may occur, in the following protected areas:

Pico da Neblina National Park (2,298,154 ha) (in range)
Rio Trombetas Biological Reserve (409,578 ha) (in range)
Uatumã Biological Reserve (942,786 ha) (in range)
Anavilhanas Ecological Station (343,897 ha) (in range)
Caracaraí Ecological Station (85,957 ha) (in range)
Niquiá Ecological Station (282,830 ha) (in range).

It is listed on Appendix II of CITES.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Aotus trivirgatus have been used as a food source by many indigenous peoples of the neotropics. More recently they have proved invaluable as laboratory animals and have been used for various studies and experiments in testing human diseases and potential treatments. One example is the role that A. trivirgatus have had in testing antimalarial drugs, since they too can be carriers of the human malaria parasites. Commercially there is also a market for owl monkeys as pets. (Baer et al. 1994, Geiman and Meagher 1967)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Three-striped night monkey

The three-striped night monkey (Aotus trivirgatus), also known as northern night monkey or northern owl monkey, is one of several species of owl monkeys currently recognised. It is found in Venezuela and north-central Brazil.

Until 1983, all the owl monkeys were regarded as subspecies of Aotus trivirgatus, and all were referred to as douroucoulis. The use of the name douroucouli exclusively for the three-striped night monkey is not universally accepted; some authors use it for the entire genus, or for the grey-necked group of species within it (to which A. trivirgatus belongs).

Like other owl monkeys, the three-striped night monkey lives in woodlands including rain forest. It is mainly black, with striking white markings on its face. Its body size is 27–48 cm, and its tail is about the same length again. Adults weigh up to 1 kg. It has very large eyes, and is most active on moonlit nights, feeding on fruit, nuts, leaves, insects and other small invertebrates, and birds' eggs.

The three-striped night monkey forms pair bonds which are broken only by the death of one partner. It lives in family groups, with the immature young staying with their parents until sexual maturity at the age of 3 or 4. Normally only one infant is born, after a gestation period of a little over 4 months.

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 141. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100313. 
  2. ^ Veiga, L. M. & Rylands, A. B. (2008). "Aotus trivirgatus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/41543. Retrieved 20 January 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!