Overview

Distribution

Range Description

A montane night monkey, occurring in the Cordilleras Central and Oriental, from about 1,000 to 1,500 m upward to the treeline at 3,000 to 3,200 m (Hernández-Camacho and Cooper 1986). Following the range map in Defler (2003, 2004), it extends south as far as region of the headwaters of the rios Caquetá and Orteguaza. Tirira (2007) provisionally regards the montane night monkeys occurring in the subtropical humid forest along the Cordillera Oriental of the Andes (altitudes 940-1,800 m) as belonging to this species, although he points out (p.160) that its identity has yet to be confirmed. There are few records and all are based on sightings in the wild; the few museum specimens have yet to be studied in this regard. The possibility remains that it may be a variant of A. vociferans occurring otherwise throughout eastern Ecuador and adjacent northern Peru (Aquino and Encarnación 1994a), or even an as yet unrecognized, distinct species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Aotus lemurinus , commonly known as the owl monkey or night monkey, is found in Central and South America. They occur from Panama to northeastern Argentina, and from Peru and Equador to Guyana and Brazil.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Aotus lemurinus can be recognized by its small rounded head and owl-like face. Their brown eyes are large and round. Their thick white eyebrows lie below three black stripes on their head. A large black spot is found between their eyes. The eyeshine from these nocturnal monkeys is a bright reddish orange. Fur is dense and wooly and is usually grey in color. The color of the underparts of the monkey ranges from a pale yellow to a bright orange. Their tail is non-prehensile and mostly black, but may have brown or dark orange coloring on it. The tail always has a black tip. Their fingers are long and slender, with expanded pads on the tips. This monkey exhibits no sexual dimorphism. Weight ranges from 0.5 to 1.3 kg.

Range mass: 0.5 to 1.3 kg.

Average mass: 0.0009 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Night monkeys typically occur in primary and secondary forest (including disturbed forest and selectively logged forest), submontane and montane (cloud forests) in the Andes to 3,200 m above sea level in Colombia, and possibly Ecuador (altitudes of 940 to 1,800 m) (Hernández-Camacho and Cooper 1976; Defler 2003, 2004; Tirira 2007). Aquino and Encarnación (1994b) reviewed the habitat and forest preferences of the genus.

Night monkeys are nocturnal: they are most active at dawn and dusk. The only exception is Aotus azarae azarae of the Chaco of southern Bolivia, Paraguay and Argentina, which is cathemeral (active during night and day). They are frugivorous; their diet includes fruit, nectar and flowers, leaves, and small animal prey such as insects (Wright 1989; Fernandez-Duque 2007).

They are socially monogamous, living in small groups of an adult pair and offspring of different ages (infant, one or two juveniles and sometimes a subadult. In A. a. azarae, a significant number of adults range alone. They may be subadults that have left their natal groups or older adults which have been evicted from their groups by competitors (Fernandez-Duque and Huntington 2002; Fernandez-Duque 2004). Both sexes disperse. Males care for the infants (carry them) (Rotundo et al. 2002, 2005). Lone adults were observed by Villavicencio Galindo (2003) in northern Colombia. Night monkeys are territorial—groups occupy overlapping territories of 5-18 ha (depending on the species and location) (Wright 1978, 1981; Fernandez-Duque 2007). Wright (1994) and Fernandez-Duque (2007) review the behaviour and ecology of the genus.

Captive male A. lemurinus reach sexual maturity when 2 years old, and captive female A. vociferans and A. nancymaae first breed when 3-4 years old (Dixson 1983; Fernandez-Duque 2007). In the wild, male A. azarae reach adult weight only when about 4 years old, and age at first reproduction is about 5 years of age (Juárez et al. 2003; Fernandez-Duque 2004). A female A. azaraewas found to breed for the first time at 58 months of age (Fernandez-Duque et al. 2002). Single offspring are the rule. Wright (1985) recorded births between August and February for A. nigriceps in Peru (Manu National Park), and Aquino et al. (1990) indicated a birth season between December and March) for A. nancymaae in north-eastern Peru.

Size:
Adult male weight average 0.920±0.075 kg (n=7, range 0.608-1.15 kg), adult female weight 0.859±0.088 kg (n=6, range 0.578-1.05 kg) (Hernández-Camacho and Defler 1985). NB: This could refer to griseimembra, considered by Hernández-Camacho and Defler (1985) to be a subspecies of A. lemurinus.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Owl monkeys occupy a variety of habitats. They are found from moist rainforest to dry scrub. Aotus lemurinus is most common in dense forest, where many vines are present. They can be found in all levels of the forest but are rarely found on the ground.

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Aotus lemurinus feeds at night, where they typically feed in the canopy. Their diet is broad, including fruit, flower nectar, foliage, and insects. These monkeys have also been known to feed on small birds and mammals.

Animal Foods: birds; mammals; insects

Plant Foods: leaves; fruit; nectar

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Range lifespan

Status: captivity:
33.8 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.8 years (captivity) Observations: One wild-born specimen was at least 33.8 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Aotus lemurinus is a monogamous mammal.

Mating System: monogamous

Aotus lemurinus reaches sexual maturity at approximately 2.5 years of age. Females have an ovarian cycle which ranges from 13 to 19 days. There is no external indication of estrous. Males initiate reproduction. Reciprocal grooming has been observed in this species only prior to mating. Gestation period is 133 days. Females give birth to single young or sometimes twins.

Range number of offspring: 1 to 2.

Average gestation period: 133 days.

Average age at sexual or reproductive maturity (female): 2.5 years.

Average age at sexual or reproductive maturity (male): 2.5 years.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 98 g.

Average gestation period: 135 days.

Average number of offspring: 1.

The male and female both care for the young.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aotus lemurinus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA2267-09|FJ785421|Aotus lemurinus| AACCGCTGATTATTTTCAACCAACCATAAAGACATCGGAACACTATATCTATTATTTGGTGCTTGAGCGGGGGCAGTGGGAACAGCCCTA---AGCCTTTTAATTCGAGCAGAATTAGGTCAACCAGGAAGTCTGATGGAAGAT---GATCATGTATACAACGTTATTGTTACTGCCCACGCATTCATTATAATTTTCTTTATAGTAATACCGATTATAATCGGGGGATTTGGAAACTGACTAGTTCCCCTAATA---ATTGGTGCCCCAGACATAGCATTCCCCCGAATAAATAATATAAGCTTCTGACTTCTACCCCCATCTCTACTGCTCTTACTTGCATCCTCAACTCTAGAAGCCGGCGCAGGAACCGGCTGAACAGTCTATCCACCCTTAGCAGGAAATATATCACACCCAGGAGCCTCTGTAGATCTA---ACTATTTTCTCACTTCATCTGGCAGGTATTTCTTCAATTCTAGGAGCCATTAACTTTATTACAACAATCATTAATATAAAGCCCCCAGCCATGACCCAATACCAAACACCCCTTTTTGTCTGATCCGTCCTTATCACAGCAGTCCTCTTACTCCTCTCTCTTCCAGTCCTAGCCGCC---GGAATTACTATACTGCTCACCGACCGTAACCTTAATACTACTTTCTTTGATCCTGCCGGTGGCGGCGACCCTATTCTATATCAACACCTATTTTGATTCTTCGGACACCCTGAAGTATATATTCTTATTCTACCGGGCTTTGGAATAATTTCACATATCGTAACATATTACTCCAACAAAAAA---GAACCATTTGGGTATATAGGAATAGTCTGAGCTATAATATCCATTGGTTTCCTAGGATTTATTGTATGAGCCCATCACATATTTACAGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aotus lemurinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2c

Version
3.1

Year Assessed
2008

Assessor/s
Morales-Jiménez, A.L. & de la Torre, S.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
This species is listed as Vulnerable as it is expected to have undergone a decline exceeding 30% over the past three generations (24 years) mainly as a result of habitat loss due to deforestation, expanding illicit crops, coffee and armed conflict.

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Aotus lemurinus populations have suffered due to collection for biomedical research and some hunting.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information available. Aquino and Encarnación (1994b) reviewed population structure and densities for the genus.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Much of the habitat of this night monkey is congruent with human disturbance, including deforestation, expanding illicit crops, coffee and armed conflict.

Many Aotus in Colombia have been released from captivity outside of their range and could be hybridizing; however, very little is known of the effects of this practice.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is confirmed, or may occur, in the following protected areas:

Colombia
Puracé Natural National Park (83,000 ha) (in range, Defler 2003, 2004)
Tama National Natural Park (48,000 ha) (in range, Defler 2003, 2004)

Ecuador
Llanganates National Park (219,707 ha) (Tirira 2007)
Sumaco Napo Galeras National Park (205,249 ha) (Tirira 2007)
Cofán-Bermejo Ecological Reserve (55,451 ha) (Tirira 2007)

It is listed on Appendix II of CITES.

Most urgent is the protection of any forests that provide habitat for populations in northern Colombia. Censuses of populations and habitat are needed to better assess the population status of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Aotus lemurinus is commonly used in biomedical research.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gray-bellied night monkey

The gray-bellied night monkey (Aotus lemurinus), also called the lemurine owl monkey, is a small New World monkey of the family Aotidae. Native to tropical and subtropical forests of South America,[3] the gray-bellied night monkey faces a significant threat from hunting, harvesting for use in pharmaceutical research and habitat destruction.

Contents

Physical description

Like other members of their genus, this species is nocturnal; its small, round head is striped with black and is dominated by two large, brown eyes. The overall effect is not unlike an owl; the monkey's eyes shine a reddish orange by reflected light. Its white eyebrows are bushy, with a patch of darker fur between them. Its grey fur is described as dense and woolly, with the animal's underside being yellow to orange in colour. Its brownish black to orange tail is not prehensile and invariably tipped with black.

The gray-bellied night monkey has slender limbs with long, delicate fingers; its fingertip pads are wide. Adults may attain a weight of 1.3 kilograms; there is no sexual dimorphism observed.

Habitat and diet

Found in both dry and moist areas, the gray-bellied night monkey occupies all levels of the forest canopy; however, it is seldom found on the ground. It prefers dense vegetation with tangles of vines where the trees are evenly dispersed. Its range is from Colombia and north-eastern Argentina to Ecuador and Panama; it is also found in the tropical Andes.

By day the monkey slumber in the cavities of trees or in dense thickets; by night, it searches the canopy for a variety of food items. Primarily a frugivore (fruit-eating), this monkey also eats vegetation, insects, nectar, and even other small mammals and birds when fruit is scarce.

Behaviour and reproduction

Most active during twilight hours and periods of bright moonlight, the gray-bellied night monkey troop consists of a mated pair and their offspring, up to five individuals in total. This species is noted for the monogamous pair-bond it forms; parental duties are shared between the lead pair and the juveniles. However, it is the male who assumes the bulk of care giving and rearing responsibilities; the female serves only to nurse the infants. Remarkably, even if the male dies the female will refuse to take over from him.

Characteristically vociferous, the monkey produces a range of calls: from soft clicks and low-pitched guttural rumblings to owl-like hoots and high-pitched shrieks when threatened. When not feeding, the monkey is typically inactive. Like other members of its genus, the gray-bellied night monkey claims a relatively small territory of about 0.1 km². Scent is central to this monkey's intraspecies communication; territories are marked with brown, oily secretions from the base of the tail.

Birthing peaks at the end of the dry season and in the midst of the wet season. Gestation averages 133 days, usually resulting in a single infant; twins are a rarity. There is only one litter per year. Sexual maturity is reached at 2.5 to 3.5 years of age, at which point the offspring disperse; that is, they leave the troop in search of an unattached mate.

Classification

There have been up to four subspecies of the gray-bellied night monkey.[1] All but the nominate subspecies have been elevated to full species rank.[4] The three species formally considered subspecies are:

Additionally, Hershkovitz's night monkey Aotus hershkovitzi is now considered to be a junior synonym for A. lemurinus.[4]

References

  1. ^ a b Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 140. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100305. 
  2. ^ Morales-Jiménez, A.L. & de la Torre, S. (2008). "Aotus lemurinus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/1808. Retrieved 20 January 2012. 
  3. ^ Rylands, A., Groves, C., Mittermeier, R., Cortes-Ortiz, L. & Hines, J. H. (2006). "Taxonomy and Distribution of Mesoamrican Primates". In Estrada, A., Garber, P., Pavelka, M. & Luecke, L.. New Perspectives in the Study of Mesoamrican Primates. pp. 43–47. ISBN 0-387-25854-X. 
  4. ^ a b Defler, T. R., & Bueno, M. L. (2007). "Aotus Diversity and the Species Problem". Primate Conservation 2007 (22): 55–70. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!