Overview

Brief Summary

Biology

The cotton-headed top tamarin is diurnal and arboreal, feeding on fruit, insects, tender vegetation, small vertebrates and bird eggs (6) (10). With the exception of smaller prey, animals are killed with a bite to the head (3). Cotton-headed tamarins obtain the water they need by licking leaves that are wet with rain or dew, rather than expose themselves to predation by venturing down onto the forest floor (5). When not feeding, much time is spent in social grooming. Like other tamarins, they run their clawed digits through each other's fur, examining it, and use their teeth, lips and tongue to pick off particles (8). These social monkeys live in groups of 3 – 13 individuals, with the average being around 7 (2). Their home ranges extend from 7-10 hectares and often overlap with those of other groups, with contact between groups being agonistic (5). These tamarins are territorial, scent marking their home ranges and defending them with showy confrontations, fluffing up their fur and making loud calls to scare away intruders and attract individuals from their own group (6). There can be more than one adult male and female in the group but only one female actually breeds (3) (5). Reproduction in other females is suppressed by the behavioural domination of the reproductive female, and by the effects of her pheromones and genital gland scent (6). Males and other group members play a major role in caring for the young (8). The co-operative breeding system of tamarins appears to be unique amongst primates, and serves to help the breeding female care for the offspring (7). Lactation and feeding the young demands a great deal of energy, and so males and other group members often carry the young, allowing the female more time to forage and feed, while other members of the group also help by surrendering food morsels to the young and the breeding female (7). This explains why the female is usually larger in size than the male. In fact, research suggests that smaller males are often preferred mating partners by the females as they are more nimble in the forest and therefore better food gatherers (6). Like other tamarins, the cotton-headed tamarin usually gives birth to twins (8) (9). The gestation period is around 140 days (2), and the offspring, born helpless (3), are carried everywhere rather than being left in nests (9). The co-operative care of the group is key to the infant's development, for they become independent after only two months. This unique breeding system is also essential as it enables tamarins to maintain a high reproductive rate (6). Once established as breeders in a group, a female can produce twins once a year, and sometimes twice (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The stunning cotton-headed tamarin is one of South America's most endangered primates (5). Its name describes the fantastic crest of long white hair flowing around the black face like a mane of white cotton (6). Its body is small and covered with thick fur, with a brown back and shoulders, and white to yellow chest and limbs (6). The fore and hind limbs are similar in size, allowing it to move quadrupedally through the forest, running along branches or jumping short distances between tree braches (7) (8). Like marmosets and other tamarins, the ancestral primate nails on their toes and fingers have evolved into claws on all but their big toes, allowing them to climb in a squirrel-like fashion in the trees (6) (9). This small monkey has a long tail, which assists in balance; it is reddish orange towards the base and black towards the tip (5). Males and females look the same in appearance, as do the young (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Saguinus oedipus occurs in north-western Colombia between the Río Atrato and the lower Río Cauca (west of the Río Cauca and the Isla de Mompos) and Magdalena, in the Departments of Atlantico, Sucre, Cordoba, and western Bolivar, north-western Antiquoia (from the Uraba region, west of the Río Cauca) and north-eastern Choco, east of the Río Atrato, from sea level up to 1,500 m (Hernández-Camacho and Cooper 1976; Hershkovitz 1977; Hernández-Camacho and Defler 1989; Mast et al. 1993 ).

The south-western boundary of the cotton-top?s range has not been clearly identified. Mast et al. (1983) suggested that it may extend to Villa Arteaga on the Río Sucio (Hershkovitz 1977), which included reports of Cotton-top Tamarins in Los Katios National Park. However, Barbosa et al. (1988) were unable to find any evidence of Cotton-top Tamarins in this area nor in Los Katios, where they observed only Saguinus geoffroyi.

Groups have been seen in the Islas del Rosario and Tayrona National Park in the Sierra Nevada de Santa Marta (Mast et al. 1993; A. Savage and L. H. Giraldo, pers. obs.). However, these populations were founded by captive animals that were released into the area (Mast et al. 1993) and these remnant populations are here considered as outside of the historic range of the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Northwest Colombia

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Costa Rica to Colombia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Confined to Colombia, but formerly much more widespread across the country (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Cotton-top tamarins are distinguished from other members of the genus Saguinus by possessing a crest of long whitish hair from the forehead to the nape flowing over the shoulders. Their back is brown and the underparts of the arms and legs are whitish to yellow. The rump and inner sides of thighs are reddish-orange. The base of the tail is also reddish-orange, while the tip is blackish.

Characteristics that distinguish callitrichids from other new world monkeys are modified claws instead of nails on all digits and the presence of two rather than three molars on each side of the jaw.

Range mass: 260 to 380 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in humid forest in the south to dry deciduous forest in the north; recorded from primary and secondary forests. Known at altitudes up to 400 m, but could occur in higher elevations in the upper valley of the Río Sinu (Defler 2004).

Marmosets and tamarins are distinguished from the other monkeys of the New World by their small size, modified claws rather than nails on all digits except the big toe, the presence of two as opposed to three molar teeth in either side of each jaw, and by the occurrence of twin births. They eat fruits, flowers, nectar, plant exudates (gums, saps, latex) and animal prey (including frogs, snails, lizards, spiders and insects). Marmosets have morphological and behavioural adaptations for gouging trees trunks, branches and vines of certain species to stimulate the flow of gum, which they eat, and in some species form a notable component of the diet. The dentition of the tamarins (Saguinus and Leontopithecus) does not provide for gouging and they eat gums only when readily available.

Tamarins live in extended family groups of between four and 15 individuals, but usually 2-8. Saguinus oedipus lives in groups of 2-9. Savage et al. (1996a,b) observed reproductively active groups that ranged in size from 3-6. Generally, only one female per group breeds during a particular breeding season. Lives in groups of 2-9 individuals.

Size:
Tamarins are monomorphic - exhibiting only minor differences in body and canine size.
Adults H&B 20.8-25.9 cm, TL 33.0-41.0 cm (Hershkovitz 1977)
Weight 416.5 g (n = 10) (Savage 1990).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Cotton-top tamarins inhabit tropical rainforests, open woodlands, and secondary growth. They are sensitive to any alteration in their habitat.

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This species is found in tropical rainforest edges and secondary forests. It has been found in a variety of habitats from wetland tropical forest, to moist woodland forest and dry thorn forest savannah (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Cotton-top tamarins are primarily insectivorous; insects being 40% of their diet. They also eat a large amount of fruit which consists of 38.4% of their diet. Feeding on exudates, which is known as gum feeding, takes up 14.4% of their diet. Saguinus oedipus have an interesting characteristic which consists of food associated calls that are correlated with food preferences. Certain calls made by cotton-top tamarins were strictly associated with a feeding context and were not used in non-feeding contexts. However, it should be noted that there is a 3% error, when these specific calls are made in non-feeding contexts.

Animal Foods: insects

Plant Foods: fruit; sap or other plant fluids

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: male

Status: captivity:
23.1 years.

Average lifespan

Status: captivity:
23.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26.2 years (captivity) Observations: One 26.2 year old animal was still alive in captivity (Richard Weigl 2005). Amyloid-beta protein plaque deposits typical of Alzheimer's disease, but not neurofibrillary tangles, were observed in the brains of animals over 12 years of age, suggesting these animals may develop early Alzheimer's disease pathology (Lemere et al. 2008).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Saguinus oedipus has a monogamous breeding system. This species has a form of cooperative breeding, which isn't present in many other Primates. It consists of adult 'helpers' staying in the family and gaining breeding experience instead of breeding themselves. This may result in the highest reproductive potential of all primates.

Mating System: monogamous ; cooperative breeder

Cotton-top tamarins are reproductively active seasonally with females being seen pregnant or suckling young only from January to June. They have an estrous cycle of 15 days and gestation lasts approximately 140 days. Sexual maturity is reached at 18 months in females and 24 months in males. Saguinus oedipus gives birth to non-identical twins twice each year.

Breeding interval: Saguinus oedipus breeds twice each year

Average number of offspring: 2.

Average gestation period: 140 days.

Average age at sexual or reproductive maturity (female): 18 months.

Average age at sexual or reproductive maturity (male): 24 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 39.36 g.

Average gestation period: 178 days.

Average number of offspring: 1.9.

Average age at sexual or reproductive maturity (male)

Sex: male:
550 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
548 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Saguinus oedipus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA2264-09|FJ785424|Saguinus oedipus| AATCGCTGATTATTTTCAACCAACCACAAAGACATCGGAACATTATACCTACTATTTGGCGCATGAGCGGGAGCTGTGGGAACAGCCCTA---AGTTTCCTTATCCGAGCAGAACTAGGCCAACCTGGGAGCTTGTTTGAGGAT---GATCATGTCTATAATGTTATCGTTACATCCCACGCATTTATTATAATTTTCTTCATAGTTATACCCATTATAATCGGGGGTTTTGGCAACTGACTAATCCCCCTAATA---ATTGGCGCCCCAGACATAGCATTCCCTCGAATAAATAATATAAGCTTCTGACTTCTACCCCCATCACTCCTCCTTCTACTTGCATCCTCAACCTTAGAGGCCGGCGCTGGAACTGGCTGAACAGTATACCCACCCCTAGCAGGAAACATATCACATCCAGGCGCCTCTGTAGACCTA---GTTATTTTCTCACTGCACCTGGCAGGTGTGTCTTCCATCTTAGGGGCTATCAACTTCATCACCACAATCATTAACATAAAACCCCCTGCCATAACCCAGTACCAAACCCCCTTATTCGTATGATCCGTTTTAATCACAGCAGTTCTTCTTCTACTCTCCCTGCCTGTCTTAGCTGCC---GGAATTACTATACTACTAACTGACCGAAATCTTAACACTACTTTCTTCGACCCTGCAGGCGGCGGTGATCCTATCCTGTACCAACACCTATTCTGATTCTTTGGTCATCCCGAAGTATATATTCTTATCCTACCAGGGTTCGGAATAATTTCACACATTGTAACATACTACTCTAATAAAAAA---GAGCCGTTTGGATACATAGGCATAGTTTGAGCTATAATATCTATCGGATTTTTAGGGTTTATCGTATGAGCTCATCACATATTTACAGTCGGAATGG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Saguinus oedipus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Savage, A. & Causado, J.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
This species is listed as Critically Endangered due to a severe reduction in population, estimated to be greater than 80% over the past 3 generations (18 years) due to destruction of habitat.

History
  • 2000
    Endangered
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Endangered
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The main problems contributing to the cotton-top tamarin's status as endangered is the clearing of their forest habitat and population depletion from animal trade. Nature reserves have been set up to help maintain populations of Saguinus oedipus.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 10/19/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Saguinus oedipus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN B1 + 2abcde, C2a) on the IUCN Red List 2002 (1), listed as endangered by the USDI (3) and listed on Appendix 1 of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the late 1960s and early 1970s, 20,000-30,000 individuals were exported to the United States for biomedical research (Hernández-Camacho and Cooper 1976). Current population estimates for the species are 6,000 individuals (approximately 2,000 mature individuals).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Saguinus oedipus occurs in an area of intensive colonization and forest loss. Neyman (1978) estimated that 75% of the original distribution of S. oedipus had been cleared for agriculture and pasture, and that the remainder of its range was represented by small isolated forest patches along with its main stronghold, the Paramillo National Natural Park of 460,000 ha. Cerquera (1985) reported on the threats regarding the construction of two hydroelectric dams, Urra I and Urra II, on the Ríos Sinu and San Jorge, in the south of its range. Urra II is sited within the Paramillo National Natural Park and is expected to flood more than 54,000 ha of primary and secondary forest, within what is considered to be the last major stronghold for the species.

The three protected areas where they occur have lost a significant portion of their forests (Barbosa et al. 1988). Paramillo has lost approximately 42% of its original forested habitat and Montes de Maria and Los Colorados lost 70 and 71%, respectively. To date, almost 200,000 ha of the original forested areas within protected boundaries of the parks and reserves dedicated to Cotton-top Tamarin conservation efforts have been lost. This suggests, therefore, that there is less than 2,600 km² that will be protected in perpetuity for Cotton-top Tamarins by the Colombian Ministerio del Medio Ambiente. Although these areas are protected, they continue to suffer from the pressure of the growing local populations to extract resources or clear areas for agricultural activities.

Defler (1994, 2004; pp.196-201) discusses the conservation status and threats to this species (see also Defler and Rodríguez-Mahecha 2003; Defler et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Deforestation is this species' greatest threat (6). It has already lost most of its habitat through forest clearing for timber, charcoal, human settlement, agricultural land and industry (3). The forest areas in which it now exists are so fragmented, it is believed that they are too small to maintain the tamarin populations (3). Sadly the continuous expansion of human settlement in northern Colombia has brought the cotton-headed top tamarin more bad luck. With easier access to the tamarin's habitat, animal collectors trap these small monkeys and sell them in port cities, either for export or local trade (10). Populations in the past have also suffered from the export of significant numbers for biomedical research in the 1960s and 1970s (5) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Legally protected in Colombia since 1969. Major threat in the past was export for the pet trade, zoos and biomedical research, but export was banned in 1974. Listed on CITES Appendix I.

There are three protected areas where Saguinus oedpipus occurs: Paramillo National Natural Park (460,000 ha), decreed in 1977; Los Colorados Fauna and Flora Sanctuary (1,000 ha) decreed in 1977; and Reserva Forestal Cerro de Coraza-Monte de Marja (7,460 ha) decreed in 1983. They were also introduced to Tayrona National Natural Park in 1974 (Defler 1994).

Proyecto Tití, a conservation programme for the Cotton-top Tamarin in Colombia, was established in 1987 to begin the first long-term field study on this species in collaboration with Colombian biologists, educators, NGO?s and government authorities (INDERENA, Ministerio del Medio Ambiente) (Savage 1988, 1993, 1995, 1996, 1997; Savage et al. 1996a,b, 1997, 2001a,b). Initial research focused on understanding the factors influencing reproductive strategies of Cotton-top Tamarins, but it quickly grew into a comprehensive conservation programme including educational efforts, capacity building, training Colombian students, development of economic alternatives, and the development of an agricultural training programme to decrease the pressure on the forest by local communities (Savage and Giraldo 1990; Savage et al. 1990, 1996, 1997).

In addition to the studies of Cotton-top Tamarins in the field, there has been a major and comprehensive assessment of the remaining habitat within the historic distribution of the Cotton-top Tamarin in Colombia, along with surveys to assess population numbers remaining. This information has provided important insights into the long-term viability of this population given the current rate of habitat destruction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The cotton-headed tamarin has been listed as endangered since 1970 by the International Union for Conservation of Nature and Natural Resources (IUCN) (1). It is also recognised as endangered on the USDI (3), and its listing under Appendix I of the Convention for International Trade of Endangered Species (CITES) means that international trade of this species is prohibited (3). However, its numbers have continued to dwindle away, as has its habitat and hope of survival. If this species is to survive, it is essential that immediate conservation measures are implemented (3) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cottontop tamarin

The cotton-top tamarin (Saguinus oedipus), also known as the Pinché tamarin, is a small New World monkey weighing less than 1 lb (0.5 kg). It is found in tropical forest edges and secondary forests where it is arboreal and diurnal.

Cotton-top tamarin eating a grasshopper

Contents

Etymology

In German-speaking areas, the cottontop tamarin is commonly known as "Lisztaffe" (literally "Liszt monkey") most likely due to the resemblance of its hairstyle with that of Hungarian composer and piano virtuoso Franz Liszt.[4]

Physical characteristics

This tamarin species has a long sagittal crest, white hairs from forehead to nape flowing over the shoulders ("Cottontop"). The back is brown, and the underparts, arms and legs are whitish-yellow. The rump and inner thighs are reddish-orange.

It is considered one of the bare-faced tamarins because of the lack of facial hair. Its lower canine teeth are longer than its incisors, so it seems as if it has small tusks. It is about the size of a squirrel and weighs 10-18 ounces.[citation needed] The males are only slightly larger than females. A medium cottontop tamarin weighs 432 g.[5] Tamarins are among the smallest of the primates. Head body length of this species is 17 cm and tail length is 25 cm.[6] Forelimbs are shorter than the hind limbs. Like other members of the Callithrix family,it has claws on most of its fingers and toes. Only the big toe has the flat nails that most other primates have.

Communication

The cottontop tamarin vocalizes with birdlike whistles, soft chirping sounds, high-pitched trilling, and staccato calls. Researchers say its repertoire of 38 distinct sounds is unusually sophisticated, conforming to grammatical rules and able to express curiosity, fear, dismay, playfulness, warnings, joy, and calls to young.[6] It has loud territorial songs as well as songs when it is excited. It moves its tongue across the lips. This may be a recognition signal, or could be used to communicate anger or curiosity. A "threat face" consists of lowering the forehead until it forms a bulge which almost covers the eyes; the lips are pushed forward and the head and neck crests are erected. This apparently is sufficient since no other body language is used.

Conservation status

Life span in captivity has been as high as 25 years whereas life span in the wild is about 13–16 years. The wild population is estimated at about 6000, with 2000 adults.[7] This species is critically endangered, having lost more than three-quarters of its original habitat to deforestation.[8] Clearing of forest habitat by humans is the main problem and populations have also been depleted by the pet trade and scientific research. They are now protected by international law; although they are numerous in captivity, they are still critically endangered in the wild. The species is considered to be one of "The World's 25 Most Endangered Primates."[9]

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 135. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100251. 
  2. ^ Rylands AB and Mittermeier RA (2009). "The Diversity of the New World Primates (Platyrrhini)". In Garber PA, Estrada A, Bicca-Marques JC, Heymann EW, Strier KB. South American Primates: Comparative Perspectives in the Study of Bahavior, Ecology, and Conservation. Springer. pp. 23–54. ISBN 978-0-387-78704-6. 
  3. ^ Savage, A. & Causado, J. (2008). Saguinus oedipus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 2 January 2009.
  4. ^ German Wikipedia article
  5. ^ Cotton-top Saguinus oedipus)
  6. ^ a b Oakland Zoo - Cotton Topped Tamarin
  7. ^ Savage, A. & Causado, J. 2008. Saguinus oedipus. In: IUCN 2009. IUCN Red List of Threatened Species. Version 2009.2. <www.iucnredlist.org>. Downloaded on 09 December 2009.
  8. ^ Endangered Species Feature: Cotton-top Tamarin
  9. ^ Mittermeier, R.A.; Wallis, J.; Rylands, A.B. et al, eds. (2009) (PDF). Primates in Peril: The World's 25 Most Endangered Primates 2008–2010. Illustrated by S.D. Nash. Arlington, VA.: IUCN/SSC Primate Specialist Group (PSG), International Primatological Society (IPS), and Conservation International (CI). pp. 1–92. ISBN 978-1-934151-34-1. http://www.primate-sg.org/PDF/Primates.in.Peril.2008-2010.pdf. 

Gallery

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!