Overview

Brief Summary

Biology

Greater bilbies are nocturnal and spend the day in burrows that spiral into the ground (5). These burrows can be as much as 3 metres long (5) and each individual may use up to a dozen burrows with one entrance each (4). Bilbies are predominantly solitary animals, with the exception of when they are breeding, which can occur at any time of the year (9). After a gestation period of roughly two weeks, females give birth to a litter of 1 to 2 young, who are born at an immature stage of development and then stay in the backwards-facing pouch for around 80 days (9). Bilbies are omnivores and uncover food by digging with their front feet. They eat a range of food including insects, bulbs and fungi (4). Obtaining all the moisture they require from their diet, these animals do not need to drink (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The greater bilby is the largest of the small, rat-like marsupials (3) that are known as bandicoots (7). It has a comical appearance with its oversized hairless ears and long slender hind legs that resemble those of a kangaroo (4). The soft, silky coat is a bluey-grey colour with subtle tan markings and a white belly (5). The long tail is grey towards the body and then black, followed by white at the tip (4). It is carried like a stiff banner during the bilby's cantering run (5), and there is a tuft of elongated hairs folding over the naked tail tip (4). Bilbies also have a long, pink and hairless snout (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Bilby formerly occurred over 70% of the mainland Australia. Wild populations are now restricted predominantly to the Tanami Desert (Northern Territory), the Gibson and the Great Sandy Deserts (Western Australia), and one outlying population between Boulia and Birdsville (south-west Queensland) (Johnson 2008). It has gone extinct from portions of southern Queensland within the last few decades.

There are reintroduced populations in: Currawinya National Park (Queensland); Scotia Sanctuary (New South Wales); Arid Recovery at Roxby Downs, Venus Bay Conservation Park, Thistle Island, Yookamurra Sanctuary (South Australia); Dryandra Woodland, François Peron National Park (Western Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Greater bilbies were historically found over 70% of continental Australia with populations throughout South Australia, Western Australia, the Northern Territory, and New South Wales. Limited populations were also found in southwestern Queensland. Upon the introduction of feral cats (Felis silvestris), red foxes (Vulpes vulpes), and rabbits Oryctolagus cuniculus by Europeans, the home range of Macrotis lagotis was greatly reduced. Today, bilbies are limited to 20 to 30% of their original territory. Macrotis lagotis is found in Great Sandy, Tanami, and Gibson deserts in northwest Australia and the south west tip of Queensland. Greater bilbies are now considered extinct in South Australia. Reintroduction programs have begun in southern South Australia, southwestern Queensland, western New South Wales, and areas of Western Australia with some success due to the addition of predator-proof enclosures and intense monitoring of reintroduced populations.

Biogeographic Regions: australian (Native )

  • Department of Environment and Conservation. National Recovery Plan for the Greater Bilby Macrotis lagotis. 2129. Northern Territory: Australian Government, Department of Natural Resources, Environment, and the Arts. 2006. Accessed March 19, 2009 at http://www.epa.qld.gov.au/publications/p02129aa.pdf/National_recovery_plan_for_the_Greater_Bilby_emMacrotis_lagotis/em_/_prepared_by_Northern_Territory_Department_of_Natural_Resources_Environment_and_the_Arts.pdf.
  • Department of the Environment, Water, Heritage and the Arts, 2009. "Bilby (Macrotis lagotis)" (On-line). Australian Government Department of the Environment, Water, Heritage and the Arts. Accessed March 19, 2009 at http://www.environment.gov.au/biodiversity/threatened/publications/bilby.html.
  • Northern Territory Government, 2006. "A Management Program for the Greater Bilby (Macrotis lagotis) In the Northern Terrrtory of Australia" (On-line). Northern Territory Government Australia. Accessed March 20, 2009 at www.nt.gov.au/nreta/wildlife/programs/pdf/bilby.pdf.
  • Queensland Environmental Protection Agency, 2007. "Bilby- Australia's Easter Bunny" (On-line). Queensland Government Environmental Protection Agency. Accessed March 19, 2009 at http://www.epa.qld.gov.au/nature_conservation/wildlife/threatened_plants_and_animals/endangered/bilby/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Australia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

At the beginning of the 20th Century the bilby was still common throughout southern Australia. Today however, two subspecies are restricted to small fragmented populations: the western bilby (Macrotis lagotis lagotis) found in the border area between Western Australia and the Northern Territory and the eastern bilby (M. l. sagitta) in southwest Queensland (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Greater bilbies are known for their large, relatively hairless, rabbit-like ears, and long pointed snouts with sensory vibrissae and a hairless pink nose. Their fur is soft, silky and bluish grey in color with a mix of fawn over the majority of the body. The belly is covered in white or cream fur. The first part of the tail is the same bluish grey as the body with the remainder of it being black and the final 40% being pure white. The pouch of females opens to the rear so as to avoid filling with soil when the animal is burrowing. The forelimbs are strong and consist of three clawed digits and two clawless digits. Greater bilby hind limbs are slender and similar to those of kangaroos. Rather than hopping, bilbies use their legs to gallop around the desert. Their tongues are long, sticky, and slender, making it easy to catch termites. Males and females are sexual dimorphic, with the male's body mass being twice that of females (800 to 2500 g for males relative to 600 to 1100 g for females). Along with being larger, males also have enlarged foreheads and longer canines (National Recovery Plan for the Greater Bilby).

Range mass: 600 to 2500 g.

Range length: 29 to 55 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 2.4 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat of the extant populations includes tall shrublands and open woodlands of the semi-arid regions, and the hummock grasslands and sparse forblands in the arid areas of Australia (Pavey 2006). However, from its former range, the Bilby appears able to live in habitats from the driest desert areas to the temperate areas such as those found in the south, east, and west of the country (Pavey 2006). This species is dependent on fire, as it feeds on many disturbance (e.g., fire) promoted plants, such as seed from Yakirra australience (R. Southgate pers. comm.). It is also able to occupy recently burnt areas, as it uses burrows for refuge (R. Southgate pers. comm.).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Greater bilbies are commonly found in dry, hot areas including deserts, dunes, and grasslands. There are three main vegetation types commonly associated with bilby habitat. These are tussock grassland commonly found on the hills and uplands, mulga woodlands and shrublands, and hummlock grasslands found on dunes and sandy plains. Greater bilbies are fossorial, found in areas of rocky and clayey soil.

Habitat Regions: terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits arid areas, mainly associated with tussock and hummock grasslands and acacia shrublands (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Greater bilbies do not drink water, they obtain water from their food. They have an opportunistic diet consisting of seeds, especially those of the grasses Dactyloctenium radulans and Yakirra australiense, bulbs, larvae, termites, ants, spiders, fruit, fungi, lizards and occasionally eggs, snails, or small mammals. The proportion of insect to plant material that makes up their diet depends on the habitat and the season.  Along with a keen sense of smell, greater bilbies have excellent hearing. Placing their enormous ears against the ground, greater bilbies are able to hear termites and other insects burrowing underground. They then use their sharp claws and strong forelimbs to dig up insects, bulbs, and other buried food. Since greater bilbies have soft fur that does not protect their bodies well from termite bites, they dig tunnels leading to termite chambers and lap them up with their long, slender tongues. Unfortunately, this method of feeding leads to a large consumption of soil and sand as well. Controlled fires are actually important to greater bilbies because fire promotes growth and seed production of preferred food plants.

Animal Foods: mammals; reptiles; eggs; insects; terrestrial non-insect arthropods; mollusks

Plant Foods: roots and tubers; seeds, grains, and nuts; fruit

Other Foods: fungus

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

While they are a source of food for a number of predators, both native and introduced, the most important role played by Macrotis lagotis is that of an “ecosystem engineer.” Ecosystem engineers are “organisms that modify, maintain, create or destroy structure within the physical environment” (Eldridge and James, 2007). As greater bilbies forage for bulbs, seeds, and insects, they dig pits up to 25 cm deep that are then abandoned. These pits become areas where seeds, water, and other organic matter settle and begin to decompose. Greater bilby pits become “fertile patches” in the Australian desert where some seeds are provided the extra fertilization to germinate in an otherwise extremely difficult environment.  Studies compared environments without greater bilbies and a similar, native fossorial group, bettongs (Bettongia) to those where these two native species are present. It was concluded that environments without these native fossorial animals suffered from devastating losses of native Australian fauna despite the presence of rabbits, which also dig burrows.

  • Eldridge, D., A. James. 2007. Reintroduction of fossorial native mammals and potential impacts on ecosystems in an Australian desert landscape. Biological Conservation, 138: 351-359. Accessed April 03, 2009 at http://www.sciencedirect.com.proxy.lib.umich.edu/science?_ob=ArticleURL&_udi=B6V5X-4P0N26J-2&_user=99318&_coverDate=09%2F30%2F2007&_alid=896008938&_rdoc=13&_fmt=high&_orig=search&_cdi=5798&_sort=d&_docanchor=&view=c&_ct=67&_acct=C000007678&_version=1&_urlVersion=0&_userid=99318&md5=ae40547f891cdb0ba923afd9b246068e.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

While native species such as carpet pythons (Morelia spilota), monitor lizards (Varanidae), and some raptors (Accipitridae) are potential predators of greater bilbies, the most common and destructive predators are introduced species. Non-native species that prey on greater bilbies include dingos (thought to have been introduced in Australia about 3500 years ago), red foxes, and feral cats. Red foxes were brought to Australia for the purpose of recreational hunting in 1855 by European settlers. Within 100 years of their introduction, red foxes spread across continental Australia and currently inhabits all regions of the continent with the exception of the tropical northern region of Australia. Domestic cats were originally released throughout Australia around 1855 to control the population of another invasive species, European rabbits, as well as mice and rat populations. Domestic cats quickly expanded over the entire continent of Australia, killing many native species.

Known Predators:

  • Department of the Environment, Water, Heritage, and the Arts, 2004. "European red fox -Invasive Species fact page" (On-line). Australian Government Department of the Environment, Water, Heritage, and the Arts. Accessed March 21, 2009 at http://www.environment.gov.au/biodiversity/invasive/publications/pubs/european-red-fox.pdf.
  • Department of the Environment, Water, Heritage, and the Arts, 2004. "Feral Cat -Invasive species fact sheet" (On-line). Australian Government Department of the Environment, Water, Heritage, and the Arts. Accessed March 21, 2009 at http://www.environment.gov.au/biodiversity/invasive/publications/cat-factsheet.html.
  • Hintze, M. 2002. "Canis lupus dingo" (On-line). Animal Diversity Web. Accessed March 21, 2009 at http://animaldiversity.ummz.umich.edu/site/accounts/information/Canis_lupus_dingo.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Greater bilbies have poor eyesight and mainly rely on hearing and olfaction for perceiving their environment. They have a keen sense of smell, which is used to sniff out food buried underground as well as perceive scent markings of other individuals. With their enormous ears, greater bilbies also listen for insects underground as well as predators. However, hearing seems much less important than olfaction. The ears of greater bilbies are also used to help regulate body temperature. Communication between males usually occurs through scent markings. Males mark the outside of their burrows by rubbing their urogenital area along the burrow entrance. Males may also mark burrows where they have mated with a female. Scent marking seems directly correlated to dominance; dominant males mark over areas less dominant males have previously marked. Also, less dominant males tend to avoid entering burrows of dominant males. Females rarely scent mark their territories. Scent marks by males have little effect on the females since males are rarely, if ever, aggressive towards females.

Communication Channels: chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest greater bilby in captivity lived about 10 years, although 6 to 7 years of age is a typical maximum lifespan in captivity. The lifespan of greater bilbies in the wild is unknown.

Range lifespan

Status: captivity:
10 (high) years.

Average lifespan

Status: captivity:
6-7 years.

Average lifespan

Status: captivity:
7.2 years.

Average lifespan

Status: captivity:
5.0 years.

  • Friend, T., K. Moris, J. van Weenen. 2008. "Macrotis lagotis" (On-line). 2008 IUCN Red List of Threatened Species. Accessed March 18, 2009 at http://www.iucnredlist.org/details/12650.
  • Tydale-Bicsoe, H. 1973. Life of Marsupials. New York: American Elsevier Publishing Company Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.6 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Greater bilbies have a polygynous mating system in which the most dominant male will mate with the most dominate female and additional females while lower males will mate with females equal or below them in the social hierarchy. Males initiate sexual interactions by approaching and following a female. This is followed by the male sniffing the female around her face, shoulders, flanks, or under the tail as well as licking the female’s urogenital opening. Females may also sniff the male. Females may aggressively rebuff the advances of lower-ranked males. Copulation seems to take place underground with the longest mating sessions recorded taking place for around 18 hours. There is no evidence of pair bonding, though males will often scent mark the burrow after mating with a female. This is thought to ward off lower-ranked males. These results were observed in a study of captive bilbies. Little has been recorded about bilby mating in the wild due to their decreasing numbers and semi-fossorial, nocturnal lifestyle.

Mating System: polygynous

Greater bilbies have the ability to breed throughout the year, whether breeding occurs depends on environmental conditions. In their arid environments, females may delay mating until conditions are appropriate to support the nutritional demands of lactation and independence of the young. When environmental conditions are favorable, a female bilby may produce up to 4 litters a year, each typically consisting of 1 to 2 offspring, though up to 4 offspring have been reported.  Female greater bilbies reach sexual maturity at around 5 months old (or 560 g) while males take around 8 months (or at a weight of 800 g) to reach maturity. The female oestrus cycle lasts around 21 days. Greater bilbies have one of the shortest gestation periods of all mammals, only 14 days. After gestation, the tiny, premature offspring climbs into its mother's pouch, attaches itself to a nipple and remains in the pouch for around 75 days. The young are cared for by the mother for an additional 14 days. After that, the young will leave their mother's burrow and be left to fend for themselves.

Breeding interval: Greater bilbies have up to four litters a year.

Breeding season: Breeding may occur throughout the year.

Range number of offspring: 1 to 4.

Average number of offspring: 1-2.

Average gestation period: 14 days.

Average birth mass: 200 g.

Average weaning age: 75 days.

Average time to independence: 14 days.

Average age at sexual or reproductive maturity (female): 5 months.

Average age at sexual or reproductive maturity (male): 8 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average gestation period: 17 days.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (female)

Sex: female:
150 days.

Females are the only caregivers of young. After their short gestation, young greater bilbies climb into their mother’s pouch where they remain for the majority of their time with their mother. During the 75 days the young bilbies remain in the pouch, the babies continue to grow at a very fast rate, reaching 200 g by the time they leave the pouch. While in the pouch, the offspring obtain all of their nourishment from mother’s milk. Bilby females have nipples both deep inside the pouch and nipples that hang outside the pouch. Each type of nipple provides a different type of milk for the offspring living outside the pouch versus inside the pouch. Once the young emerge from their mothers pouch, they do not return. Many times, the female has already mated and a new neonate enters the pouch soon after the previous litter has left. These young juveniles are cached by the mother in one of her burrows where she returns regularly over the next two weeks to allow her babies to suckle. After these two weeks, the young leave the burrow and must fend for themselves with no additional parental care. It is estimated that only 25% of offspring produced will reach adulthood while the rest will become prey for predators or succumb to the elements.

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female)

  • Department of Environment and Conservation. National Recovery Plan for the Greater Bilby Macrotis lagotis. 2129. Northern Territory: Australian Government, Department of Natural Resources, Environment, and the Arts. 2006. Accessed March 19, 2009 at http://www.epa.qld.gov.au/publications/p02129aa.pdf/National_recovery_plan_for_the_Greater_Bilby_emMacrotis_lagotis/em_/_prepared_by_Northern_Territory_Department_of_Natural_Resources_Environment_and_the_Arts.pdf.
  • Humble, G. 2006. "The secret life of the bilby" (On-line). ABC Science. Accessed March 21, 2009 at http://www.abc.net.au/science/articles/2006/04/06/2042654.htm.
  • Johnson, C., K. Johnson. 1983. Behavior of the Bilby (Macrotis lagotis) in Captivity. Australian Wildlife Research, 10: 77-87. Accessed March 29, 2009 at http://www.publish.csiro.au.proxy.lib.umich.edu/?act=view_file&file_id=WR9830077.pdf.
  • Queensland Environmental Protection Agency, 2007. "Bilby- Australia's Easter Bunny" (On-line). Queensland Government Environmental Protection Agency. Accessed March 19, 2009 at http://www.epa.qld.gov.au/nature_conservation/wildlife/threatened_plants_and_animals/endangered/bilby/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Foraging aids revegetation: greater bilby
 

The foraging behavior of bilbies helps revegetate arid landscapes by creating pits that naturally catch plant matter, seeds, and nutrients.

           
  "Fertile patches are created and maintained by a combination of physical  and biologically-mediated processes including soil disturbance by  animals. We examined the creation of fertile patches by 4 vertebrates,  the greater bilby Macrotis lagotis, burrowing  bettong Bettongia lesueur, European rabbit Oryctolagus cuniculus, and Gould's sand goanna Varanus gouldii within dunes, ecotones, and swales in a  dunefield in arid South Australia. These animals all create pits when  foraging for subterranean food resources. We hypothesized that 1) the  effect of pits on litter capture would vary among landscapes and animal  species, 2) larger pits would trap more litter and seed, 3) pits would  contain more viable seed than the surrounding matrix, and 4) the effect  of pits on soil chemistry would vary among animal species, and be  greater in landscapes with more finely textured soils. We found that  litter was restricted almost exclusively to the pits, and was greater in  pits with larger openings. Litter capture was greater in ecotones and  dunes than in swales. A total of 1307 seedlings from 46 genera  germinated from litter samples taken from the pits, but no seedlings  emerged from samples taken from soil surrounding the pits. Foraging pits  contained significantly higher levels of total C and N than surrounding  soil, and total C and N concentrations were greatest in swales and  lowest in dunes. Pits contained ca 55% more mineralisable N that surface  soils, and pits constructed by bilbies and bettongs contained half the  concentration of mineralisable N as those of rabbits and goannas.  Concentrations of mineral N and mineralisable N were also greatest in  the swales. Our results demonstrate the importance of animal-created  pits as nutrient sinks and sites for seedling establishment, and suggest  that changes in the composition of arid zone vertebrates may have  resulted in profound changes to nutrient and soil dynamics in arid  Australia." (James et al. 2009:723)
  Learn more about this functional adaptation.
  • James AI; Eldridge DJ; Hill BM. 2009. Foraging animals create fertile patches in an Australian desert shrubland. Ecography. 32(5): 723 - 732.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macrotis lagotis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0628-06|NC_006520|Macrotis lagotis| AATCGTTGACTATTCTCAACTAATCATAAAGATATCGGTACTCTATATTTACTATTTGGCGCCTGAGCCGGAATAGTAGGTACAGCTCTA---AGTCTTCTAATTCGAGCAGAATTAGGACAACCAGGTACATTACTAGGAGAC---GATCAAATTTATAATGTTATTGTTACTGCTCATGCCTTCGTAATAATTTTCTTTATAGTTATGCCTATTATAATCGGAGGATTTGGAAACTGATTAGTCCCTCTAATA---ATTGGAGCCCCTGATATAGCGTTTCCACGAATAAATAACATGAGTTTCTGGCTTCTACCTCCATCCTTCTTATTATTACTGGCCTCTTCAACAGTAGAGGCTGGGGCTGGAACAGGCTGAACCGTTTATCCACCATTAGCTGGTAACCTTGCCCATGCTGGAGCCTCTGTAGACCTA---GCTATCTTTTCTCTCCACTTGGCTGGTATCTCGTCTATCCTTGGTGCAATTAATTTTATTACTACTATCATCAATATAAAACCTCCAGCTATATCTCAATATCAAACCCCACTATTCGTTTGATCAGTAATAATTACAGCAGTATTATTACTTCTATCATTACCCGTATTAGCAGCA---GGAATTACAATATTACTTACCGATCGTAACCTAAACACAACTTTCTTTGATCCTGCAGGCGGTGGAGATCCAATCTTATATCAACATTTATTTTGATTCTTTGGACACCCAGAAGTCTATATTCTTATTTTACCCGGATTCGGAATAATTTCACACATTGTAACTTATTATTCAGGAAAAAAA---GAACCATTTGGATATATAGGCATAGTTTGAGCCATAATATCAATCGGATTTTTAGGATTCATTGTTTGAGCTCATCATATATTTACAGTTGGACTTG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macrotis lagotis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C1

Version
3.1

Year Assessed
2008

Assessor/s
Friend, T., Morris, K. & van Weenen, J.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Vulnerable because, although it has a large extent of occurrence, it is patchily distributed; the total population size might be less than 10,000 mature individuals (it is considered as such for the purposes of listing), and the population suffers from an ongoing decline estimated to exceed 10% over the last 10 years.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Endangered
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Greater bilbies are listed as Vulnerable on the IUCN red list, endangered under the U.S. Endangered Species List, and are on Appendix I of CITES. The conservation status in each of the Australian territories is as follows: Queensland - extinct, Northern Territory - threatened, Western Australia - vulnerable, South Australia - endangered, New South Wales - presumed extinct. Greater bilbies are the only extant member of Thylacomyidae after their closest relative, lesser bilbies (Macrotis leucura), became extinct between the 1930's and 1960's. Like M. leucura, greater bilbies have suffered a significant drop in population over the past 200 years due to the introduction of invasive predators such as dingos, red foxes, and feral cats, and invasive herbivores such as European rabbits. Along with the introduction of invasive species, a number of new diseases have also been brought to Australia. Greater bilbies are highly susceptible to the parasites and diseases of introduced animals and are commonly infected when they come into contact with feces of introduced species while digging. Without immunities to fight these parasites and diseases, many die as a result.  The introduction of both European rabbits and livestock has greatly reduced the abundance of grasses, seeds, and other plant matter typically fed upon by native greater bilbies. As well as the reduction of plants through feeding, grazing has also led to the degradation of bilby habitat. Greater bilby habitat is also being destroyed as a result of human development and they are hit by cars along roads. Greater bilbies are protected under Australian law. A number of breeding and reintroduction projects are underway, as well as projects to control populations of harmful invasive species. Since the 1990's, greater bilby conservation groups have promoted the idea of replacing the Easter Bunny with the Easter Bilby. Chocolate shops around Australia began selling chocolate bilbies with a portion of the profit going to help fund bilby conservation. Greater bilbies have their own Australian holiday, National Bilby Day, anually held in mid-September in hopes of raising funds and educating the public on bilby conservation.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

  • Burbidge, A., K. Johnson, C. Dickman. 2008. "Macrotis leucura" (On-line). 2008 IUCN Red List of Threatened Species. Accessed April 10, 2009 at http://www.iucnredlist.org/details/12651.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 12/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Macrotis lagotis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU - C2a) on the IUCN Red List 2002 and listed on Appendix I of CITES (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
About 500 individuals on Thistle Island, 500 in Arid Recovery, 100 in Venus Bay, 200 in Peron, 40 in Scotia, 200-500 in Queensland. There are fewer than 1,000 individuals in the Northern Territory and 5,000-10,000 in non-reintroduced Western Australia. The global population might be under 10,000 individuals. The species is wide-ranging and patchily distributed. The population estimates of Bilbies in the Northern Territory and Western Australia are very approximate, as there are no published numbers in peer-reviewed journals (R. Southgate pers. comm.). It is known from aerial surveys that Bilby signs (diggings) in the areas where Bilbies are persistent occur less than 15 to 20 km apart (R. Southgate pers. comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The current Bilby distribution is associated with a low abundance or absence of foxes, rabbits, and livestock. Major threats relate to predation from foxes, habitat destruction from introduced herbivores, and changed fire regimes (Pavey 2006). Predation pressures from feral cats and dingoes occurring in association with pastoral practices may be a threat to the Bilby. Feral cats have affected the success of reintroduced populations. Additional threats to the Bilby include mining and other development, and road mortality (Pavey 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Bilby numbers have been decimated by human activities; they have been hunted extensively for their skins and accidentally killed in rabbit traps or by poisoned baits (4). Predation by introduced foxes and feral cats poses one of the major causes of mortality today. Populations are also under pressure from long periods of drought, which tends to concentrate animals such as bilbies, rabbits, feral predators and livestock on smaller areas of land that may be unable to sustain them (4). The severely fragmented populations of bilbies are particularly vulnerable to these extreme events.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Bilby is listed as a threatened species under Australian law. It occurs in a number of protected areas. A national recovery plan was completed for the species, and the conservation measures which follow are adapted, and/or taken directly, from it (Pavey 2006). It is listed on CITES Appendix I.

The recovery plan stresses the need to survey for the species to achieve an accurate extent of occurrence and area of occupancy. Methods need to be developed to improve the monitoring of distribution and abundance in order to compile trends. There should also be a monitoring program for exotic Bilby predators, and control measures of these species should be intensified, especially at priority sites. Research into threats such as predators, altered fire regimes, and habitat degradation in various forms is needed to determine their relative importance.

Management of captive populations and reintroductions into predator-free or predator-controlled sites should continue. Captive programs need to maintain the current levels of genetic diversity. Further research into husbandry should proceed. Finally, the Bibly recovery team needs to continue its efforts to improve recovery management and promote awareness of Bilby recovery among stakeholders and the public.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Bilbies are protected within Australia and have been found to breed well in captivity (4). Successful reintroductions of captive-bred individuals have occurred at sites in Western (5) and South Australia (6), from which bilbies had previously been lost. These are being carefully monitored at present and appear to be doing well. The Save the Bilby Fund is working to reintroduce bilbies to Currawinya National Park in Southwest Queensland (8). The Queensland Parks and Wildlife Service has established a captive breeding colony in Charleville, and these bilbies will be used in the reintroduction programme (8). The future is looking slightly more promising for this unusual but appealing marsupial.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Macrotis lagotis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Greater bilbies were once a favorite traditional food and source of fur for Aboriginal peoples of Australia. The rarity and protected status of greater bilbies means this practice has been all but abandoned. Greater bilbies are promoted as a mascot for the Commonwealth of Australia Endangered Species Program. They are also replacing rabbits as the Australian symbol of Easter, with chocolate bilbies are being sold as an alternative to chocolate bunnies.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bilby

This article deals with the species. For the Genus see Macrotis.

The bilby (Macrotis lagotis) is an Australian species of nocturnal omnivorous animal in the Peramelemorphia order. The common name "bilby" usually refers to this species, but can also be distinguished from Macrotis leucura (the lesser bilby) that became extinct in the 1950s by the name greater bilby. It is also referred to as the dalgyte, pinkie, or "rabbit-eared bandicoot".[3] Bilbies live in arid areas of central Australia. Their range and population is in decline.

Contents

Habitat

Once widespread in arid, semi-arid and relatively fertile areas, the bilby is now restricted to arid regions and remains a threatened species. It makes its home in a burrow that spirals down, making it hard for its predators to get in. The bilby prefers arid habitats because of the spinifex grass and the acacia shrubs.[4]

Characteristics

Bilbies have the characteristics of long bandicoot muzzle and very long ears. They are about 29–55 centimetres (11–22 in) in length. Compared to bandicoots, they have a longer tail, bigger ears, and softer, silky fur. The size of their ears allows them to have better hearing as well. At 1 to 2.4 kilograms (2.2 to 5.3 lb), the male is about the same size as a rabbit; although male animals in good condition have been known to grow up to 3.7 kilograms (8.2 lb) in captivity. The female is smaller, and weighs around 0.8 to 1.1 kilograms (1.8 to 2.4 lb). Bilbies have an excellent sense of smell and sharp hearing. Their fur is blue-grey with patches of tan and is very soft. The tail is black and white with a distinct crest. Bilbies have strong forelimbs and thick claws, which they use to dig for food and make burrows.

Unlike bandicoots, they are excellent burrowers and build extensive tunnel systems with their strong forelimbs and well-developed claws. A bilby typically makes a number of burrows within its home range, up to about a dozen; and moves between them, using them for shelter both from predators and the heat of the day. The female bilby's pouch faces backwards, which prevents her pouch from getting filled with dirt while she is digging.

Bilbies have a very short gestation period of about 12–14 days, one of the shortest among mammals.[5]

Diet

Bilbies are nocturnal omnivores that do not need to drink water, as they get all the moisture they need from their food, which includes insects and their larvae, seeds, spiders, bulbs, fruit, fungi, and very small animals. Most food is found by digging or scratching in the soil, and using their very long tongues.[5]

Conservation

Bilbies are slowly becoming endangered because of habitat loss and change as well as the competition with other animals. Feral cats pose a major threat to the bilby's survival, and there is some competition between bilbies and rabbits for food. There is a national recovery plan being developed for saving these animals: this program includes breeding in captivity, monitoring populations, and reestablishing bilbies where they once lived. There have been reasonably successful moves to popularise the bilby as a native alternative to the Easter Bunny by selling chocolate Easter Bilbies (sometimes with a portion of the profits going to bilby protection and research). Reintroduction efforts have also begun, with a successful reintroduction into the Arid Recovery Reserve in South Australia in 2000,[6] and plans underway for a reintroduction into Currawinya National Park in Queensland,[7] with a recent success with six bilbies released into the feral-free sanctuary in early February 2006.

Successful reintroductions have also occurred onto Peron Peninsula in Western Australia as a part of [8] Western Shield. Successful reintroductions have also occurred on other conservation lands, including islands and the Australian Wildlife Conservancy's[9] Scotia[10] and Yookamurra Sanctuaries.[11] There is a highly-successful bilby breeding program at Kanyana Wildlife Rehabilitation Centre,[12] near Perth, Western Australia.

Taxonomy

Nomenclature

A scientific description of the bilby was first published in 1837 by a Mr J. Reid. Reid based his description on a specimen that he erroneously stated to have come from Van Diemen's Land (now Tasmania), where the species has not occurred in historical times.[13] As all bandicoot species were then placed in a broadly circumscribed Perameles,[14] Reid placed the bilby there too. However, noting how different it was from other members of the genus, he added that "should more of the same form be discovered, the above characters would constitute a subgenus to which the name of Macrotis might be applied". The specific epithet lagotis was chosen "from its resemblance to the Rabbit".[15]

The following year, Richard Owen read a paper before the Zoological Society of London, in which he proposed to erect a new genus for this species, named Thylacomys.[16] This name was widely adopted and remained in use for many years. Thus it was that when B. Arthur Bensley erected a subfamily to hold the genus in 1903, he named it Thylacomyinae. This name remains valid, and has since been promoted to family rank as Thylacomyidae, but Thylacomys itself is no longer considered valid, as Reid's original paper is held to have established the generic name Macrotis. Thus the currently accepted scientific name for the species is Macrotis lagotis.[citation needed]

Classification

The placement of bilbies within the Peramelemorphia has changed in recent years. Vaughan (1978) and Groves and Flannery (1990) both placed this family within the Peramelidae family. Kirsch et al. (1997) found them to be distinct from the species in Peroryctidae (which is now a subfamily in Peramelidae). McKenna and Bell (1997) also placed it in Peramelidae, but as the sister of Chaeropus in the subfamily Chaeropodinae.[17]

Etymology

The term bilby is a loan word from the Yuwaalaraay Aboriginal language of northern New South Wales, meaning long-nosed rat. It is known as dalgite in Western Australia, and the nickname pinkie is sometimes used in South Australia.[18] The Wiradjuri of New South Wales also call it bilby.[19]

Popular culture

A National Bilby Day is held in Australia on the second Sunday in September to raise funds for conservation projects.[20]

References

  1. ^ Groves, Colin P. (16 November 2005). "Order Peramelemorphia (pp. 38-42)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 38. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=10900004. 
  2. ^ Friend, T., Morris, K. & van Weenen, J. (2008). Macrotis lagotis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is listed as vulnerable
  3. ^ Ellis, Richard (2005). No Turning Back: The Life and Death of Animal Species. New York: Harper Perennial. p. 224. ISBN 0-06-055804-0. 
  4. ^ "Bilby". AustralianAnimals.net. http://australian-animals.net/bilby.htm. Retrieved December 2010. 
  5. ^ a b Gordon, Greg (1984). Macdonald, D.. ed. The Encyclopedia of Mammals. New York: Facts on File. pp. 846–9. ISBN 0-87196-871-1. 
  6. ^ Moseby, K.E.; O'Donnell, E.O. (2003). "Reintroduction of the greater bilby, Macrotis lagotis (Reid) (Marsupialia: Thylacomyidae), to northern South Australia: survival, ecology and notes on reintroduction protocols". Wildlife Research 30: 15–27. http://www.publish.csiro.au/paper/WR02012.htm. 
  7. ^ "Save The Bilby Appeal". Queensland Government. 2004. http://www.epa.qld.gov.au/about_the_epa/media_room/media_statements/fact_sheets/save_the_bilbies/. 
  8. ^ Western Australian Department of Environment and Conservation 'Project Eden'
  9. ^ Australian Wildlife Conservancy
  10. ^ Australian Wildlife Conservancy Scotia Sanctuary
  11. ^ Australian Wildlife Conservancy Yookamurra Sanctuary
  12. ^ Kanyana Wildlife Rehabilitation Centre (Inc.)
  13. ^ Southgate, R.I. (1990). "Distribution and abundance of the Greater Bilby Macrotis lagotis Reid (Marsupialia: Peramelidae)". In Seebeck, J.H.; Brown, P.R.; Wallis, R.L.; Kemper, C.M.. Bandicoots and Bilbies. Chipping Norton: Surrey Beatty & Sons. pp. 293–302. ISBN 0-949324-33-7. 
  14. ^ Bandicoots and Bilbies 1990, Groves, Colin; Flannery, Tim. "Revision of the families and genera of bandicoots". pp. 1–11. 
  15. ^ Reid, J (January 1837). "Description of a new species of the genus Perameles (P. lagotis)". Proceedings of the Zoological Society of London 5 (1): 129–131. doi:10.1111/j.1469-7998.1837.tb06823.x. http://onlinelibrary.wiley.com/doi/10.1111/j.1469-7998.1837.tb06823.x/abstract. 
  16. ^ Owen, Richard (1838). "[Thylacomys"]. The Athenaeum: 747. http://books.google.com/books?id=iGxIAAAAYAAJ&pg=PA747. 
  17. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 38. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  18. ^ http://www.anu.edu.au/andc/res/aewords/aewords_ab.php[dead link]
  19. ^ Yokose, Hiroyuki (2001). "Aboriginal Words in Australian English" (PDF). p. 171 (3 in PDF). http://www.tsukuba-g.ac.jp/library/kiyou/2001/13.YOKOSE.pdf. 
  20. ^ "http://www.savethebilbyfund.com/". http://www.savethebilbyfund.com/. Retrieved 8 April 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!