Overview

Brief Summary

Biology

This solitary, nocturnal species shelters by day in a simple ground nest of grasses, leaves and twigs, generally under some form of vegetation cover, and emerges at dusk to forage for food (2) (5). Abandoned rabbit burrows are also sometimes used as daytime refuges (5). This omnivorous opportunist feeds at night on a wide range of invertebrates and plants, most of which are found in the soil or leaf-litter (1) (2). The animal's strong claws and long slender snout are used to dig small conical holes in the ground, from which its quarry is extracted (4). Food items include grubs, earthworms, beetles, grasshoppers, adult weevils, insect larvae and slugs, as well as roots, berries, grasses, mosses and seeds (4) (5). Individuals come together to breed, but only one adult bandicoot occupies a nest (4). Young are born from June to February in Tasmania and at any time of the year on mainland Australia (5). A female may produce as many as three to four litters during a year in favourable conditions, each litter typically containing one to four young. The reproductive rate is high, but so too is the juvenile mortality rate. Young remain in the mother's pouch for around 55 days and in the nest for a week or two after that (4). Both sexes begin to breed at four months of age (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The eastern barred bandicoot is a small marsupial with large, pointed ears, a long, tapering snout, pink nose and whiskered muzzle (3) (4). The soft, sandy greyish-brown fur is patterned with three to four distinctive diagonal pale bars on the hindquarters, giving the species its common name and distinguishing it from the brown bandicoot (Isoodon obesulus), which lacks such stripes (3) (5). The belly, feet and short, thin tail are pale grey to creamy white (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Eastern Barred Bandicoot is endemic to south-eastern Australia, where it occurs over much of Tasmania and in a few reintroduction sites in Victoria (Seebeck and Menkhorst 2008). At one time, this species occurred from Melbourne west across the volcanic plain to south-eastern South Australia. It is now extinct in South Australia. Four small reintroduced populations exist in Victoria, including one of >700 animals has been established near Melbourne (only this one appears on the map). The Tasmanian population is most widely distributed in the northern and eastern parts of the island (Seebeck and Menkhorst 2008). The species ranges in elevation from sea level to 950 m in Tasmania, but it is usually found much lower there and on the mainland (Seebeck 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Perameles gunnii, the Eastern Barred Bandicoot, is restricted to Australia and Tasmania. The species once lived between Melbourne and the South Australian border and in the north and east of Tasmania. Because of serious decline in their population, their number on the continent of Australia is now limited, but the survival rate in Tasmania is much higher.

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Formerly distributed across south-eastern South Australia and Victoria, P. g. nova is now thought extinct in South Australia, as it has not been seen there for over 100 years (1) (6); and is extremely rare in Victoria, largely restricted to the basalt plains extending from near the South Australian border to the Melbourne area (1) (7). The subspecies P. g. gunnii is found in Tasmania (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Perameles gunni has a head and body length of up to 340 mm. The skull is flattened and the rostrum is very long. The head is elongated and slender, and it tapers to a pink nose. The Eastern Barred Bandicoot has a whiskered muzzle and large, prominent ears, similar to those of a rabbit. Its fur is greyish brown and very soft, while the torso and hindquarters bear the characteristic pale bars or stripes that give the marsupial its name. The Eastern Barred Bandicoot is easily distinguishable from the Brown Bandicoot because the Brown Bandicoot lacks stripes.

The underside of the animal is creamy white. The tail is around 100 mm long and is also creamy white. It is not prehensile. Strong claws are attached to the animals hands and feet. The dental formula for the Eastern Barred Bandicoot is 4/3, 1/1, 3/3, 4/4.

Females have a pouch.

Average mass: 640 g.

Average mass: 766 g.

Average basal metabolic rate: 1.902 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
In Tasmania, populations inhabit open grasslands and areas of pastoral development with patches of dense groundcover (Seebeck 2001; Seebeck and Menkhorst 2008). On the mainland, the species formerly occupied the native grasslands and grassy woodlands of the western volcanic plains of Victoria. Reintroduced populations have been established in grasslands and grassy woodlands, often dominated by exotic plant species (Maxwell et al. 1996). Females give birth to between one and five young (but usually 2 or 3) (Seebeck and Menkhorst 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Eastern Barred Bandicoot is found in the grasslands and grassy woodland of Australia and Tasmania. Bandicoots habitat includes tall dense grass and shrub cover; most are found near a water supply. Many have adapted to living in tree shelter belts, bush blocks, and on farms where they can hide from predators. Many have found their way into gardens, cemetaries, and car dumps.

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Original native habitat is grassland and grassy woodland, usually on flat or gently rolling plains (1), particularly along watercourses (7). In more recent years, the eastern barred bandicoot has adapted to living in highly modified habitats such as tree plantations, farmland, gardens, parklands, rubbish tips, cemeteries and under out-buildings. These areas are often dominated by introduced weed species, providing areas of dense cover close to suitable feeding habitat (1) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Eastern Barred Bandicoot eats small vertebrates, a variety of invertebrates, and some vegetation. Their main diet, however, consists of invertebrates from the soil. They use their well developed sense of smell to locate food. They then use strong claws and their long slender nose to dig small conical holes in the ground from which their food is extracted. Food items include root-eating grubs, cockchafers, and corbies. They also feed on earthworms, beetles, and some plant material such as roots and berries. A study in Australia reported a high number of berries in the Eastern Barred Bandicoot's diet. Perameles gunnii is nocturnal. After dusk it emerges from its nest and immediately begins foraging for food.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
3.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.1 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The reproductive rate for Perameles gunnii is very high. But the mortality rate is also extremely high, particularly among juveniles. Bandicoots are solitary animals and only mix with other bandicoots when breeding. In Tasmania, young are born between late May and December. Females may begin breeding around the age of 3 months. A female may produce as many as 3-4 litters during a breeding season. The common litter size is 1-4 young. This means that a female barred bandicoot has the reproducitve capacity of producing up to nearly 16 young in one breeding season. Young remain in the mother's pouch for about 55 days. The young generally remain with the mother in the nest for a week or two after they leave the pouch. This is the only time that one will find an Eastern Barred Bandicoot sharing its nest. The home range for males is approximately 100 acres ( 40 hectares ), and 75 acres ( 30 hectares ) for females. These territories do overlap.

Average birth mass: 0.25 g.

Average gestation period: 12 days.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (male)

Sex: male:
152 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
91 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Perameles gunnii

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0140-06|AJ639872|Perameles gunnii| AACCGTTGACTATTCTCAACCAACCATAAAGATATTGGTACCTTATATCTATTATTTGGTGCCTGAGCAGGTATAGTAGGAACTGCCCTT---AGCCTACTAATCCGAGCAGAATTAGGACAGCCTGGAACACTGCTTGGAGAT---GATCAGATCTACAATGTAATTGTGACTGCTCATGCCTTCGTAATAATTTTCTTTATAGTTATACCCATCATAATTGGAGGCTTTGGAAACTGATTAGTTCCCCTAATA---ATTGGAGCTCCAGATATAGCCTTTCCACGAATAAACAATATAAGCTTCTGGCTTCTTCCTCCATCATTCTTACTTCTACTAGCTTCCTCTACAGTTGAAGCAGGAGCAGGAACAGGATGAACTGTATATCCTCCATTAGCAGGAAACCTTGCACACGCAGGCGCTTCTGTAGACTTA---GCTATTTTCTCTCTTCATCTAGCCGGTATCTCATCAATTCTAGGAGCAATTAATTTTATCACAACAATTATTAACATAAAACCGCCAGCAATATCACAGTATCAAACTCCTTTATTCGTCTGATCTGTAATAATTACAGCAGTTCTCCTACTTCTATCTCTACCAGTACTAGCAGCA---GGTATTACTATATTACTTACAGATCGCAATCTTAATACAACCTTTTTTGATCCTGCAGGAGGCGGAGATCCAATCCTTTACCAACATCTATTTTGATTTTTTGGACATCCTGAAGTTTACATTCTTATCCTACCCGGATTTGGAATAATTTCTCACATTGTAACTTATTACTCAGGTAAAAAA---GAACCATTTGGATATATAGGTATAGTTTGAGCAATAATATCAATTGGATTCCTGGGGTTCATTGTCTGAGCTCACCATATATTTACAGTTGGACTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Perameles gunnii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Menkhorst, P. & Richards, J.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Near Threatened because this species is probably in significant decline (but probably at a rate of less than 30% over ten years) due largely to introduced predators. Almost qualifies as threatened under criterion A2e.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The wild population of Perameles gunnii remains critically endangered and is estimated at between 300 and 400 animals. The wild population of the Eastern Barred Bandicoot has declined due to grazing by Eastern Grey Kangaroos, introduction of predators, and extensive habitat alteration. This has occured over 99% of native grasslands in which the species formerly occured. The introduction of predators, particularly cats and foxes, is now a direct threat to all populations of bandicoots and bilbies. Use of pesticides has contributed to the decline in numbers. Accidents with motor vehicles also play a part. The current recovery team for the Eastern Barred Bandicoot comprises representatives from the Department of Natural Resources and Enviornment, Zoological Parks and Gardens Board of Victoria. This group oversees a field and a captive management group. This group has maintained up to 18 breeding pairs of bandicoots maintained in six sub-populations. The captive program has continued to be productive with positive growth rates and 95.6% of wild source gene diversity retained.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007. Two subspecies are recognised: P. g. gunnii is classified as Vulnerable (VU) and P. g. nova is classified as Critically Endangered (CR) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Tasmanian population is reasonably widespread and fairly common. The population near Melbourne has declined, as have the other reintroduced populations, and the total number of individuals on mainland Australia is likely less than 200, although these numbers fluctuate depending on rainfall.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Eastern Barred Bandicoots probably disappeared from the mainland due to introduced predators and habitat destruction from introduced herbivores. Predation from red foxes is thought to have been particularly detrimental, and the recent introduction of foxes to Tasmania could pose a major threat to the species here. Introduced sheep and rabbits also cleared large areas of bandicoot habitat on the mainland, which must have led to reduced populations. In Tasmania populations are fragmented in parts of its range, but this is probably not a major threat (Seebeck and Menkhorst 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Mainland populations of eastern barred bandicoots have been devastated as a result of habitat loss, with almost 99 percent of the original habitat destroyed or modified, and through predation by introduced species. Although the species suffers from predation by native snakes, raptors, carnivorous marsupials and, formerly, by dingoes and aboriginal humans, this is now far outweighed by predation by, and competition with, introduced species. The most devastating predators are the introduced red fox (Vulpes vulpes) and domestic cat (Felis catus) and dog (Canis familiaris). The introduced European rabbit (Oryctolagus cuniculus) also impacts the eastern barred bandicoot by reducing habitat through excessive grazing, possibly excluding bandicoots from favoured shelter areas, and perhaps competing for food. Toxoplasmosis has been reported in the eastern barred bandicoot in both Tasmania and Victoria, with cats thought to be the probable carrier of the infection. Poisoning by pesticides, collisions with motor vehicles, fires and accidental trappings in rabbit snares are other significant causes of mortality (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Eastern Barred Bandicoot occurs in protected areas. The most important conservation measure for the species as a whole is the control of fox populations in Tasmania.

Recovery efforts on the mainland are complex, multi-disciplinary, and involve many organisations and individuals; several research projects are under way, including collaborative projects with universities, covering biology and ecology of reintroduced populations, establishment at new sites, and population dynamics of foxes at bandicoot release sites; there is considerable community interest and involvement in the recovery program, especially with releases onto private land. A Recovery Plan for the mainland subspecies has been developed (Watson and Halley 2000).

Management actions underway for the mainland population include: captive breeding, ongoing since 1988. The Zoological Parks and Gardens Board (ZPGB) now manages this aspect of the recovery program, and bandicoots are bred at facilities in Victoria, South Australia and New South Wales. There are four reintroduction sites in Victoria, but only one, Woodlands Historic Park near Melbourne, has a reasonably secure population (>700 animals). The others are small, highly vulnerable, and will rely on supplementary releases for the next few years. Not all of these sites contain sufficient habitat for populations to be self-sustaining in the short- to medium-term; habitat management through fencing, tree planting, native grassland management, weed and rabbit control variously occur at all sites; intensive predator control is maintained at all release sites, with regular poisoning, shooting and destruction of dens and other refuges.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Mainland bandicoots, which have declined far more dramatically than on Tasmania, have been brought back from the brink of extinction by an intensive captive breeding and re-introduction programme (3). Captive breeding was first carried out at the Serendip Wildlife Research Station in 1972, although primarily for research purposes rather than breeding for reintroductions (7). At the same time, local conservation actions were initiated at Hamilton, the focus of the remaining population (1). The Serendip captive colony closed down by 1979 but, in 1988, another captive colony was established in large pens at Woodlands Historic Park, and an intensive captive breeding programme was carried out to produce offspring for release into the nature reserve. In 1992, the Zoological Parks and Gardens Board of Victoria assumed responsibility for captive breeding (7). Captive-bred individuals from here have since been released at seven reintroduction sites (7), including two protected by fox proof fences at Hamilton Community Parklands and Woodlands Historic Park, three released into the wild at 'Mooramong' near Skipton, Lake Goldsmith Wildlife Reserve near Beaufort and Floating Islands Nature Reserve near Colac, and one on a private property 'Lanark' at Branxholme (8). As a result of these efforts, there is now a total population of around 2000 individuals (3). Despite concentrated predator control efforts at Floating Islands and Lake Goldsmith, the populations at these sites have struggled and are now considered lost completely from Floating Islands (8). A studbook has also been established to manage the genetic stability of the captive population (7). Although P. g. gunnii is still relatively secure in Tasmania, evidence of declines prompted the federal government to fund a recovery programme, and management now focuses on habitat improvement and control of feral and domestic cats. Fortunately, Tasmania has no red foxes, and native carnivorous marsupials do not pose a significant threat (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are very few to no negative affects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Perameles gunnii is in such danger of extiction now that the benefit to humans is slim to none. They do in fact eat beetles, grubs, and similar invertebrates that can potentially harm crops and fields

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eastern barred bandicoot

The eastern barred bandicoot (Perameles gunnii) is a small, rabbit-sized marsupial native to Tasmania and Victoria, southeastern Australia. It is one of three extant bandicoot species in the genus Perameles.

Contents

Description

The eastern barred bandicoot weighs less than 1 kg (2.2 lb) and has a short tail and three to four whitish bars across the rump.[3] It lives for just two to three years and is not gregarious.[3] Males occupy large home ranges compared to females and only consort with females for mating. This species is nocturnal. It emerges from its nest at dusk to forage for a variety of invertebrates including crickets, beetles and earthworms.[3] During the day it rests in a grass-lined nest. When foraging, it uses its long nose to probe deep into the soil and then digs eagerly when it locates food. Females have 8 nipples and can produce a maximum of 5 young in one litter with an average of 2 to 3 young. Gestation lasts just 12 days—this is one of the shortest gestation periods of any mammal. Young are weaned at 55 days and emerged juveniles remain dependent upon the mother and forage with her until day 86.[3] Given ideal conditions, females can have up to five litters per year although reproduction becomes depressed in summer and ceases altogether in times of drought.[3] also when the female does not respect its mate is bites its ears or his behind

Distribution and conservation status

The eastern barred bandicoot was once distributed across the Basalt Plains of south west Victoria, and in Tasmania.[3] Due to predation by introduced foxes and cats, along with land-clearing for farming practises, the Victorian subspecies is critically endangered. Since 1989, eight reintroduction sites have been established across the bandicoot's former range. Unfortunately, populations at four sites are now extinct (Floating Islands Nature Reserve, Lanark, Cobra Killuc Wildlife Reserve and Lake Goldsmith Nature Reserve), functionally extinct at Woodlands Historic park, declining at Mooramong and increasing at Hamilton Community Parklands and Mount Rothwell.[3] The last remaining wild population which was once found along the Grange Burn (a creek) in Hamilton has also been declared extinct. The estimated population size for the Victorian Eastern Barred bandicoot is 150 individuals.[3]

The Tasmanian subspecies (P. g. gunni) is vulnerable to extinction.[4]

Recovery efforts

In the state of Victoria, a Recovery Team oversees actions aimed at conserving the Victorian subspecies. Representatives of government agencies, NGOs and private conservation groups collaborate to develop and implement actions to improve the species' outlook. Groups include Conservation Volunteers, Zoos Victoria, Parks Victoria www.parkweb.vic.gov.au, Mount Rothwell Biodiversity Interpretation Centre, University of Melbourne, Conservation Enterprises Unlimited, National Trust of Australia (Victoria) and Department of Sustainability and Environment. Volunteers are encouraged to participate in recovery efforts arranged by Conservation Volunteers as part of the Wild Futures program.

Phylogeny and evolutionary relationships

The eastern barred bandicoot is most closely related to the other species of bandicoot in its genus, of which only two species are still extant today. These surviving relatives are the western barred bandicoot (P. bougainville) and the Long-nosed Bandicoot (P. nastua). It is also closely related to the desert bandicoot of the same genus, but this species has become extinct. There are about 20 other bandicoots in the same family, Peramelidae. They share similar features of long pointed snouts, and small ears. The bandicoots are closely related to the bilbies, which share the same order, Peramelemorphia. These are all from the infraclass Marsupialia, shared of course with other species such as koalas and kangaroos, which means they diverged from the other placental mammals about 100 million years ago.

All the species of this order are native to Australia and New Guinea; however it is unclear how closely related this order is to the rest of the marsupials. The bandicoots have two features that suggest separate and quite opposite ideas of their evolution. They have three pairs of lower front incisors, which would usually suggest evolution from the order Dasyuromorphia, which consists of carnivorous marsupials; however, the bandicoot's middle two digits are syndactylous, meaning they are joined together except for the claw. This would suggest they share the common ancestor of the Diprotodontia which includes the kangaroos and koalas.

There are, of course, theories using these features to describe their evolution. The incisors could, in fact, be analogous features shared between the bandicoot and the Dasyuromorphia order. They share the same function, after all, and though they are structurally similar the incisors of the carnivorous marsupials are a lot sharper than the flatter versions in the Bandicoot. The Bandicoot may have evolved the third tooth separately. If this was the case, it would seem logical that the syndactyl feet were homologous features shared between the Bandicoots and the kangaroos, wombats, possums and other species. This would make sense as syndactyly is so rare it is unlikely that it would evolve twice in two separate populations. The feet of the bandicoot when compared to, say, the kangaroo are structurally quite similar. This similarity suggests that the bandicoots share a more recent ancestor with them.

Nevertheless, though this idea is more likely, simply because of the rarity of syndactyly, it is possible that syndactyly evolved in the two different populations, and that bandicoots are actually more closely related to species such as the Tasmanian devils and the Numbat. This would mean the incisors were homologous features, structurally the same but with a slightly different function (as the carnivorous marsupials use them to rip through flesh), and the syndactyl hind feet are analogous features, as they are used for the same basic function but are not evidence of divergent evolution.

Current molecular evidence does not support or disprove any of these theories, or any other related theories that are not suggested here. It is not quite definitive where the bandicoot sits exactly in the tree of life, but whatever the case, it seems that the relationship between the bandicoots and bilbies with the other orders is a distant one.

Illustration from Mammals of Australia, 1863

References

  1. ^ Groves, Colin P. (16 November 2005). "Order Peramelemorphia (pp. 38-42)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 40. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=10900025. 
  2. ^ Menkhorst, P. & Richards, J. (2008). Perameles gunnii. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is listed as near threatened
  3. ^ a b c d e f g h Winnard, A. L., and G. Coulson. 2008. "Sixteen years of Eastern Barred Bandicoot Perameles gunnii reintroductions in Victoria: a review." Pacific Conservation Biology 14:34-53.
  4. ^ Australasian Marsupial & Monotreme Specialist Group (1996). Perameles gunnii ssp. gunnii. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 2007-04-12. Listed as Vulnerable (VU A1b v2.3)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!