Overview

Distribution

Range Description

This species ranges through much of northern and eastern Australia, and occurs in the lowlands of southern and south-eastern New Guinea (Indonesia and Papua New Guinea). It ranges from sea level to 1,200 m asl. In Queensland, Australia its range has contracted from parts of inland pastoral country and it has undergone local contraction in distribution elsewhere due to the impacts of development, farming, and grazing (G. Gordon pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The large short-nosed bandicoot, a marsupial, is found only on the northern and eastern coasts of Australia and nearby islands, mainly Papua New Guinea. It is not, however, found far inland in Australia where the environment is extremely hot and unsuitable for most organisms.

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These bandicoots can be set apart from other marsupials by two traits. They are both polyprotodont and syndactylous (Seebeck et al. 1990). I. macrourus have typical body and tail lengths of 40cm and 15cm, respectively. On average they weigh 1200g. This rodent-like marsupial has a thick harsh coat but is not spiny. The dorsal pelage is light brown in appearance with speckled black patterns throughout. On the ventral surface it is solid white (Grzimek 1990). This bandicoot also has short, rounded ears and a short nose. One can easily mistake large short-nosed bandicoots for Isoodon obesulus, or small short-nosed bandicoots. The two species differ in both size, with I. macrourus larger, and regional locality, in that I. obesulus are found only on the southern coastline of Australia (Seebeck et al. 1990).

The male is typically 5-7cm longer and half a kilogram heavier than the female (Seebeck et al. 1990).

Range mass: 260 to 1500 g.

Average mass: 1200 g.

Average basal metabolic rate: 3.202 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Northern Brown Bandicoot is found in areas of tall grassland, shrubland, savanna and various forested habitats containing some grassy or open areas. It can be found in disturbed areas including suburban gardens (Gordon 2008). Females give birth to a litter of between one and seven young, with several litters born during the breeding season (Gordon 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The populations of I. macrourus live in two different habitats: one during the dry season and the other during the wet season. During the dry season, this species lives in thick vegetation consisting of tall weeds, small trees, and dense shrubs. This probably occurs because of the sparse food supply that can be found. During the wet season though, I. macrourus "come out" and roams open grasslands where a more abundant food source exists (Friend and Taylor, 1985).

Large short-nosed bandicoots make individual nests or homes on the ground consisting of simple mounds of hay and twigs that are well camouflaged and waterproof. The inside is hollow and large enough for just the single bandicoot. Some bandicoots use hollowed out tree trunks or abandoned rabbit dens for shelter. In general however, I. macrourus show a strong preference for homes in areas of low ground cover (Seebeck et al. 1990).

Terrestrial Biomes: savanna or grassland ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

I. macrourus is omnivorous. They eat insects, earthworms, berries, and grass seeds. Sometimes when food is scarce, the female bandicoot will eat her young. These marsupials forage alone during the night and have a keen sense of smell. This allows bandicoots to find food either laying in the open or burried underground. Hunting at night, however, also has its consequences. The bandicoot is prime prey for many nocturnal cats, foxes, and owls found in Australia (Grzimek 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
1.0 years.

Average lifespan

Status: wild:
3.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.8 years (captivity) Observations: Among all mammals, this animal has the shortest gestation period recorded. One captive animal lived for 6.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The large short-nosed bandicoot breeds throughout the year. An average litter consists of 2-4 young. Being marsupials, the newborns are naked and immature and thus undergo extensive development within the mother's pouch (Gemmell and Johnson, 1985). The gestation period (12.5 days) is the shortest recorded for any mammal (Seebeck et al., 1990). Bandicoots are also the only metatherian marsupials that have placentas similar to eutherian mammals. Juveniles are weaned at 60 days post partum. By this time, the marsupial young are capable of sustaining endothermy on their own (Gemmell and Johnson, 1985). I. macrourus have a lifespan of approximately two years.

Female bandicoots produce between 8-11 litters in their lifetime (Gemmell and Hendricks, 1993). Male bandicoots don't play a signifacant role in the care of juvenile I. macrourus.

Average birth mass: 0.1883 g.

Average gestation period: 12 days.

Average number of offspring: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
200 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
122 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Isoodon macrourus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0052-06|AF358864|Isoodon macrourus| AACCGTTGACTATTCTCAACTAATCATAAAGATATTGGCACCCTATATCTTCTATTTGGTGCCTGAGCAGGGATAGTAGGGACTGCTCTG---AGCTTGTTAATCCGAGCAGAACTTGGCCAACCCGGAACATTACTTGGAGAT---GACCAGATCTACAATGTAATTGTTACTGCTCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGCTTCGGAAACTGACTTGTTCCTCTAATA---ATTGGTGCTCCCGATATAGCTTTCCCACGAATAAATAATATAAGCTTCTGACTTCTTCCACCATCATTTCTACTACTTTTAGCTTCATCTACAGTTGAAGCAGGGGCAGGTACAGGATGAACTGTATATCCCCCATTAGCAGGAAATCTTGCCCACGCAGGAGCCTCTGTAGATCTA---GCCATCTTCTCCCTTCATCTAGCCGGTATTTCATCAATTTTAGGAGCAATTAACTTTATTACAACAATCATTAATATAAAACCACCAGCAATATCACAATATCAAACCCCTTTATTTGTTTGATCGGTAATAATTACTGCAGTATTATTGCTCCTATCATTACCAGTACTAGCAGCA---GGAATTACTATACTACTTACTGATCGTAACCTAAATACAACTTTCTTTGACCCTGCAGGTGGCGGAGACCCTATTCTTTATCAACATCTATTTTGATTCTTTGGTCATCCTGAAGTCTATATTCTTATTTTACCCGGATTTGGTATAATCTCTCATATTGTCACTTATTACTCAGGTAAAAAA---GAACCATTCGGATATATAGGAATAGTTTGAGCCATAATATCAATTGGGTTCCTAGGATTTATCGTTTGAGCCCACCATATGTTTACAGTAGGATTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Isoodon macrourus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Lunney, D., Dickman, C. & Woinarski, J.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, occurrence in several protected areas, tolerance of a broad range of habitats, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Over the past century, populations of I. macrourus have decreased after the European introduction of rabbits and livestock into Australia. This dramatically heightened the direct competition for food and habitat. Bandicoot populations further suffered after the introduction of the fox and cat, both predators of small animals (Grzimek 1990).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common in some parts of its range in suitable habitat, although somewhat sparsely distributed in the tropical savanna regions in the north.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
On New Guinea, the species is threatened by overhunting for meat. Although the range of the species contracted in Australia with European settlement, the species is adaptable and has survived well even in modified habitat (Gordon 2008). Depredation by domestic dogs, however, may be a problem in some areas.

In Queensland, Australia it has contracted from part if its range in inland pastoral country and has undergone local contraction in distribution elsewhere due to the impact of development, farming, and grazing (G. Gordon pers. comm.). Inappropriate fire regimes, in the form of too frequent burning, have resulted in declines in some regions, particularly across the tropical savanna in the north.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Northern Brown Bandicoots are present in several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Large short-nosed bandicoots are a delicacy to the aboriginal populations of Australia. Also, this species can be bred with relative ease in captivity. This could allow it to serve as a "model animal" for future experimental studies (Seebeck et al. 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern Brown Bandicoot

The northern brown bandicoot (Isoodon macrourus), a marsupial species, is a bandicoot found only on the northern and eastern coasts of Australia and nearby islands, mainly Papua New Guinea. It is not, however, found far inland.[1]

Contents

Physical description

This species can be set apart from other marsupials by two traits. It is both polyprotodont (i.e., several pairs of lower front teeth) and syndactylous.[3] The northern brown bandicoot has typical body and tail lengths of 40 and 15 cm (16 and 5.9 in), respectively. On average it weighs 1,200 g (2.6 lb). This marsupial has a thick harsh coat but is not spiny. The dorsal pelage is light brown in appearance with speckled black patterns throughout. On the ventral surface it is solid white.[4] This bandicoot also has short, rounded ears and a short nose. One can easily mistake northern brown bandicoot for the southern brown bandicoot. The two species differ in both size, with the northern brown bandicoot larger, and regional locality, in that the southern brown bandicoot is found only on the southern coastline of Australia.[3]

The male is typically 5–7 cm (2.0–2.8 in) longer and about 0.5 kilograms (1.1 lb) heavier than the female.[3]

Ecology

The populations of the northern brown bandicoot live in two different habitats: one during the dry season and the other during the wet season. During the dry season, this species lives in thick vegetation consisting of tall weeds, small trees, and dense shrubs. This probably occurs because of the sparse food supply that can be found. During the wet season though, the northern brown bandicoot "comes out" and roam open grasslands where a more abundant food source exists.[5]

The northern brown bandicoot makes individual nests or homes on the ground consisting of simple mounds of hay and twigs that are well camouflaged and waterproof. The inside is hollow and large enough for just the single bandicoot. Some bandicoots use hollowed out tree trunks or abandoned rabbit dens for shelter. In general, however, the northern brown bandicoot shows a strong preference for homes in areas of low ground cover.[3]

The northern brown bandicoot is omnivorous. It eats insects, earthworms, berries, and grass seeds. Sometimes when food is scarce, the female bandicoot will eat her young. This marsupial forages alone during the night and has a keen sense of smell. This allows it to find food either laying in the open or buried underground. Hunting at night, however, also has its consequences. The bandicoot is prime prey for many nocturnal cats, foxes, and owls found in Australia.[4]

Life history

The northern brown bandicoot diligently marks and retains its territory. It has scent glands on the ears, mouth, pouch, and cloaca.[4] This solitary marsupial is aggressive only towards others of its species. If a bandicoot is startled in its nesting site, it will flee. Hardly ever will the northern brown bandicoot defend itself unless two males confront one another over territorial rights. Then, either a male is killed or one male becomes subordinate to the other and avoids confrontation. The subordinate male also forfeits to the dominant male all sexual relations with local females.[6] Bandicoots are not social animals and do not live in groups, with the exception of mother and her young.

The northern brown bandicoot breeds throughout the year. An average litter consists of 2 to 4 young. Being marsupials, the newborns are naked and immature and thus undergo extensive development within the mother's pouch.[7] The gestation period (12.5 days) is the shortest recorded for any mammal.[3] Bandicoots are also the only metatherian marsupials that have placentas similar to eutherian mammals. Juveniles are weaned at 60 days post partum. By this time, the marsupial young are capable of sustaining endothermy on their own.[7] I. macrourus have a lifespan of approximately two years.

Female bandicoots produce between 8 and 11 litters in their lifetime.[8] Male bandicoots don't play a significant role in the care of juvenile I. macrourus.

Conservation status

Over the past century, populations of the northern brown bandicoot have decreased after the European introduction of rabbits and livestock into Australia. This dramatically heightened the direct competition for food and habitat. Bandicoot populations further suffered after the introduction of the fox and cat, both predators of small animals.[4]

References

  1. ^ a b Groves, Colin P. (16 November 2005). "Order Peramelemorphia (pp. 38-42)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 39. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=10900016. 
  2. ^ Lunney, D., Dickman, C. & Woinarski, J. (2008). Isoodon macrourus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ a b c d e Seebeck, J.; Brown, P.; Wallis, R.; Kemper, C., ed. (1990). Bandicoots and Bilbies. Chipping Norton NSW: Surrey Beatty & Sons. ISBN 0-949324-33-7. 
  4. ^ a b c d Grzimek, B. (1990). Encyclopedia of Mammals, Volume 1. New York, NY: McGraw Hill. 
  5. ^ Friend, G.; Taylor, J. (1985). Australian Journal of Ecology. 10. pp. 173–185. 
  6. ^ Stonehouse, B.; Gilmore, D. (1977). The Biology of Marsupials. Baltimore, Maryland: University Park Press. ISBN 0839108524. 
  7. ^ a b Gemmell, R.; Johnston, G. (1985). "The development of thermoregulation and the emergence from the pouch of the marsupial bandicoot Isoodon macrourus". Physiological Zoology 58 (3): 299–302. doi:10.1007/BF01303671. 
  8. ^ Gemmell, R.; Hendrikz, J. (1993). "Growth rates of the bandicoot Isoodon macrourus and the brushtail possum Trichosurus vulpecula". Australian Journal of Zoology 41 (2): 141–9. doi:10.1071/ZO9930141. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!